PCAMBIA1300-miniRNA3-BC-NLPPya vector, construction method and application of vector in high cucumber mosaic virus resistance

Abstract

The invention discloses a pCAMBIA1300-mini RNA3-BC-NLPPya vector as well as a construction method and application of the pCAMBIA1300-mini RNA3-BC-NLPPya vector in high cucumber mosaic virus resistance, the vector is characterized in that mini RNA3-BC-NLPPya is constructed to a pCAMBIA1300 vector skeleton, and the gene sequences of mini RNA3-BC and NLPPya are as shown in SEQ ID NO: 2 and SEQ ID NO: 5. The invention finds that the miniRNA3-BC-NLPPya can efficiently inhibit the infection of the CMV and effectively weaken the harm caused by the CMV, does not need to apply any medicine, is an efficient and green disease-resistant technology, and can provide a new strategy for preventing and controlling the cucumber mosaic virus and similar viruses thereof.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a pCAMBIA1300-miniRNA3-BC-NLP Pya Vector, construction method and application in high resistance to cucumber mosaic virus. Background Art

[0002] Cucumber mosaic virus (CMV) is one of the most devastating plant viruses, belonging to the genus Cucumovirus in the family Bromoviridae. CMV particles have an icosahedral structure, approximately 29 nanometers in diameter, and their genome consists of three single-stranded positive-sense RNAs (RNA1, RNA2, and RNA3). RNA1 encodes 1a and RNA2 encodes 2a, which together form the viral replicase complex responsible for viral genome replication. RNA2 encodes 2b, a multifunctional protein that functions as a gene silencing suppressor. RNA3 encodes the MP protein, which is responsible for viral motility. The CP protein, encoded by RNA3, encapsidates the viral RNA to form protective viral particles. The virus has a broad host range, infecting over 1,200 dicotyledonous and monocotyledonous plant species, including several important economic crops such as cucumber, tomato, pepper, tobacco, and banana. CMV is primarily transmitted non-persistently by aphids, but can also be spread by mechanical contact and seeds. Typical symptoms of viral infection include mosaic, yellowing, leaf deformity, and dwarfing. In severe cases, crop yields can decrease by 30% to 100%. The virus exhibits significant genetic diversity, with multiple strains identified. New control methods based on molecular technologies such as RNA interference and gene editing can avoid environmental pollution and pesticide resistance, achieving disease control.

[0003] The double-stranded RNA structure (uAUG-ds) upstream of the start codon uAUG of TBF1 mRNA inhibits protein translation, while the immune-induced RNA helicase can unwind uAUG-ds and promote the translation of defense proteins. The 5'UTR region of TBF1 contains uAUG-ds and is named B-uAUG-ds (containing 105 nucleotides). Class 1 uAUG-ds is named C-uAUG-ds (containing 54 nucleotides). B-uAUG-ds and C-uAUG-ds are concatenated and named BC-uAUG-ds. NLP from the plant pathogenic oomycete Pythium aphanidermatum PyaThe protein can form transient pores in the lipid membrane, leading to plasma membrane disintegration and cell lysis, and activate the expression of plant defense genes, ultimately inducing cell necrosis. This plant defense activation mechanism triggered by cell damage is similar to the activation process of inflammasomes in vertebrates. The present invention can achieve the expression of immune-related proteins specifically induced by pathogen infection, thereby conferring plant resistance without affecting plant growth. Summary of the Invention

[0004] The purpose of the present invention is to provide a pCAMBIA1300-miniRNA3-BC-NLP Pya Vector and construction method and its application in high resistance to cucumber mosaic virus. The present invention discovered that CMV infection efficiently induces miniRNA3-BC-NLP Pya NLP under control Pya Efficient expression, thus miniRNA3-BC-NLP Pya Endowing Arabidopsis with high resistance to CMV infection is of great significance for the prevention and control of CMV, and also provides a reference for the cause of virus prevention and control.

[0005] To achieve the above purpose, the technical solutions adopted by the present invention are as follows:

[0006] pCAMBIA1300-miniRNA3-BC-NLP Pya The method for constructing a vector comprises the following steps:

[0007] (1) Artificially synthesized miniRNA3 and miniRNA3-BC, whose sequences are shown in SEQ ID NO: 1-2. The 5'UTR region of TBF1 contains uAUG-ds, named B-uAUG-ds (105nt). Class 1 uAUG-ds containing 54nt is named C-uAUG-ds. The tandem sequence of B-uAUG-ds and C-uAUG-ds is named BC-uAUG-ds, whose sequence is shown in SEQ ID NO: 3. Using artificially synthesized miniRNA3 and miniRNA3-BC as templates, a specific PCR band was obtained using primers F / R-miniRNA3. The sequence of F / R-miniRNA3 is shown in SEQ ID NO: 6-7;

[0008] F-miniRNA3:GAAGTTTCATTTCATTTGGAGAGG gtaatcttaccactgtgtgtgtg

[0009] R-miniRNA3:TACGAACGAAAGCTCGGATCC agctctcccttagccatccg

[0010] The PCR target band was constructed into the pCAMBIA1300 vector linearized with SacI and BamHI to obtain the vectors containing pCAMBIA1300-miniRNA3 and miniRNA3-BC.

[0011] (2) To determine whether CMV efficiently induces the expression of proteins controlled by miniRNA3-BC. GFP, which emits green fluorescent protein when irradiated with ultraviolet light, was used as a candidate protein to evaluate the effect of CMV-induced expression. Using TMV-GFP as a template, primers F-GFP / R-GFP were used to amplify the GFP nucleotide sequence to obtain a specific PCR band; the GFP sequence is shown in SEQ ID NO: 4. The sequence of F-GFP / R-GFP is shown in SEQ ID NO: 9-10:

[0012] F-GFP: CAGTTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC

[0013] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA

[0014] The GFP PCR fragment was constructed into the pCAMBIA1300 vector linearized with MluI and XbaI to obtain the pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP vectors.

[0015] (3) The pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP vectors were transformed into EHA105 competent Agrobacterium tumefaciens cells, and positive Agrobacterium colonies were identified using primers F-GFP / R-pCAM. The sequences are shown in SEQ ID NOs: 9 and 8. Agrobacterium containing pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP were inoculated into Nicotiana benthamiana leaves. GFP fluorescence intensity, GFP protein accumulation, and GFP mRNA levels confirmed that miniRNA3-BC-GFP can more effectively inhibit GFP protein accumulation and can efficiently initiate GFP expression through CMV.

[0016] (4) Synthetic NLP Pya As a template, use primer F-NLP Pya / R-NLP PyaAmplifying NLP Pya Nucleotide sequence, a specific PCR band was obtained; NLP Pya The sequence is shown in SEQ ID NO: 5. F-NLP Pya / R-NLP Pya Its sequence is shown in SEQ ID NO: 11-12:

[0017] F-NLP Pya :aattgagtcgagtcACGCGT ATGGTGAGGTTTGTTAGCGCATTG

[0018] R-NLP Pya :ctgggaacacggaaTCTAGATCA TTGAAAGAAAGCCTTCACGAGTTTATC

[0019] NLP Pya The PCR fragment was constructed into the pCAMBIA1300 vector linearized with MluI and XbaI to obtain pCAMBIA1300-miniRNA3-BC-NLP Pya carrier.

[0020] The pCAMBIA1300-miniRNA3-BC-NLP of the present invention Pya The application of the vector in high resistance to cucumber mosaic virus is as follows:

[0021] (1) Place the plasmid containing pCAMBIA1300-miniRNA3-BC-NLP Pya The results showed that after 2.5 days of inoculation, NLP under the control of miniRNA3-BC Pya It can be specifically induced by CMV and trigger cell necrosis, which confers resistance to CMV infection in plants.

[0022] (2) Use the flower dipping method to transfer miniRNA3-BC-NLP Pya Transform Arabidopsis thaliana to prepare transgenic plants, and obtain miniRNA3-BC-NLP Pya Positive transgenic plants. Observation 20 days after inoculation revealed that compared with healthy plants, the systemic leaves of Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis inoculated with CMV showed typical CMV symptoms (mosaic and dwarfing). PyaThe transgenic Arabidopsis thaliana showed no virus symptoms in its systemic leaves, and its phenotype was completely consistent with that of healthy Col-0 plants. qRT-PCR analysis showed that the accumulation of CMV RNA was significantly higher in Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis, while in miniRNA3-BC-NLP transgenic plants inoculated with CMV, the accumulation of CMV RNA was significantly higher. Pya CMV mRNA could not be detected in transgenic Arabidopsis.

[0023] Compared with the prior art, the outstanding effects of the present invention are:

[0024] The present invention realizes miniRNA3-BC-NLP Pya It does not induce cell necrosis, but CMV infection can efficiently induce NLP Pya expression to induce cell necrosis, thus discovering miniRNA3-BC-NLP Pya It can effectively inhibit the infection of CMV and effectively reduce the harm caused by CMV without the need to apply any drugs. It is an efficient and green disease-resistant technology that can provide a new strategy for the prevention and control of cucumber mosaic virus and similar viruses.

[0025] The pCAMBIA1300-miniRNA3-BC-NLP of the present invention is described below with reference to the accompanying drawings and specific examples. Pya The vector and construction method as well as its application in high resistance to cucumber mosaic virus are further described. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of miniRNA3 and its derived vectors.

[0027] (A) Schematic diagram of the CMV genome.

[0028] (B) Schematic diagram of miniRNA3-related vectors. The blue line represents the viral sequence of CMV RNA3.

[0029] MiniRNA3 consists of the 5'UTR of CMV RNA3, the first 102 nucleotides of the MP protein, the CP subgenomic promoter sGP618, and the 3' untranslated region, with a total length of 1,160 nucleotides. Restriction endonuclease sites MluI and XbaI are located downstream of sGP618. The 5'UTR region of TBF1 contains uAUG-ds and is named B-uAUG-ds (105nt). The Class 1 uAUG-ds containing 54nt is named C-uAUG-ds. The tandem of B-uAUG-ds and C-uAUG-ds is named BC-uAUG-ds. The purple square at the 3' end represents HDV-RZ.

[0030] Figure 2 CMV infection efficiently induced the expression of GFP protein under the control of miniRNA3-BC.

[0031] (A) GFP fluorescence intensity shows that CMV induces miniRNA3-BC-GFP to produce bright GFP. 600 = 0.5) and Agrobacterium carrying empty vector (EV) or CMV (final OD of each virus chain 600 =0.2, total OD 600 =0.6) were co-infiltrated with Agrobacterium in Nicotiana benthamiana leaves. Two days after inoculation, the infiltrated leaves were photographed under UV light using a yellow filter, followed by Western blot and qRT-PCR analysis. GFP and miniRNA3-GFP were used as controls.

[0032] (B) Western blot analysis confirmed that CMV-induced miniRNA3-BC-GFP elicited high levels of GFP protein expression. Two days after inoculation, samples were probed with anti-GFP, anti-actin, and anti-CMV CP antibodies, with actin serving as a loading control. GFP protein accumulation, shown in the left image, was quantified using ImageJ software and expressed as the mean ± standard error of the mean (SEM, n = 3). Significant differences were determined by Duncan's multiple range test (P < 0.05, using IBM SPSS STATISTICS software).

[0033] (C) qRT-PCR confirmed the efficient transcription of GFP mRNA under the control of CMV-induced miniRNA3-BC-GFP. Error bars represent mean ± standard deviation (SD) (n = 3 biological replicates).

[0034] Figure 3 miniRNA3-BC-NLP Pya Confers high resistance to CMV in Arabidopsis.

[0035] (A) CMV efficiently induces miniRNA3-BC-NLP Pya NLP under control Pya expression and induces cell necrosis.

[0036] (B) CMV inoculation of wild-type Arabidopsis and miniRNA3-BC-NLP Pya Symptoms of transgenic Arabidopsis plants at day 20. The ruler indicates a distance of 2 cm.

[0037] (C) Wild-type and miniRNA3-BC-NLP cells inoculated with CMV PyaArabidopsis thaliana was tested by qRT-PCR and miniRNA3-BC-NLP was found Pya The mRNA level of CMV in Arabidopsis thaliana was significantly lower than that in the wild type, reaching an almost undetectable level. Significant differences were determined using the Duncan multiple range test (P < 0.05, using IBM SPSS STATISTICS software). DETAILED DESCRIPTION

[0038] pCAMBIA1300-miniRNA3-BC-NLP Pya The construction of the vector and its application in high resistance to cucumber mosaic virus are as follows:

[0039] (I) Artificially synthesized miniRNA3 and miniRNA3-BC, whose sequences are shown in SEQ ID NOs: 1-2. The 5'UTR region of TBF1 contains a uAUG-ds, designated B-uAUG-ds (105 nt). A Class 1 uAUG-ds containing 54 nt was designated C-uAUG-ds. The tandem sequence of B-uAUG-ds and C-uAUG-ds was designated BC-uAUG-ds, whose sequence is shown in SEQ ID NO: 3.

[0040] (2) Using synthetic miniRNA3 and miniRNA3-BC as templates, primers F / R-miniRNA3 were used to generate a specific PCR band. The specific PCR band was purified by agarose gel electrophoresis and gel cutting. The sequence of F / R-miniRNA3 is shown in SEQ ID NO: 6-7.

[0041] F-miniRNA3:GAAGTTTCATTTCATTTGGAGAGG gtaatcttaccactgtgtgtgtg

[0042] R-miniRNA3:TACGAACGAAAGCTCGGATCC agctctcccttagccatccg

[0043] The PCR target band was constructed into the pCAMBIA1300 vector linearized with SacI and BamHI and transformed into DH5α competent E. coli. The primers were identified as F-miniRNA3 / R-pCAM. The correct clone was expanded and cultured.

[0044] The plasmid was extracted and sequenced using R-pCAM primers, and its sequence is shown in SEQ ID NO: 8;

[0045] R-pCAM: CACAGTAAATTACAAGCACAAC

[0046] So far, the vectors containing pCAMBIA1300-miniRNA3 and pCAMBIA1300-miniRNA3-BC are obtained, such as Figure 1 shown.

[0047] (3) To determine whether CMV efficiently induces the expression of proteins controlled by miniRNA3-BC, we used GFP, which emits green fluorescent protein upon UV irradiation, as a candidate protein to evaluate the effect of CMV-induced expression.

[0048] 1. Using TMV-GFP as a template, primers F-GFP / R-GFP were used to amplify the GFP nucleotide sequence to obtain a specific PCR band. The specific PCR target band was purified by agarose gel electrophoresis and gel cutting. The GFP sequence is shown in SEQ ID NO: 4. The sequence of F-GFP / R-GFP is shown in SEQ ID NO: 9-10:

[0049] F-GFP: CAGTTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC

[0050] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA

[0051] 2. 600 ng of pCAMBIA1300-miniRNA3 and miniRNA3-BC plasmids, 1 μL of MluI, 1 μL of XbaI, and 2 μL of 10× FastDigest Green Buffer; make up the remaining volume to 20 μL with ddH2O; digest at 37°C for 4 h, then at 80°C for 10 min, and store frozen at -20°C.

[0052] 3. Add 1 μL of the backbone of pCAMBIA1300-miniRNA3 and pCAMBIA1300-miniRNA3-BC plasmids digested with MluI and XbaI, 2 μL of the amplified F-GFP / R-GFP fragment, 5 μL of 2× Master Assembly Mix from Sino-US Taihe Co., Ltd., and add ddH2O to 10 μL. Incubate at 50°C for 15 min.

[0053] 4. Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0054] The identification primers F-GFP / R-pCAM, the sequences of which are shown in SEQ ID NOs: 9 and 8; the correct clones were expanded, the plasmids were extracted, and sequenced using R-pCAM primers.

[0055] Thus, the vectors containing pCAMBIA1300-miniRNA3-GFP and pCAMBIA1300-miniRNA3-BC-GFP were obtained. Figure 1 shown.

[0056] (IV) The pCAMBIA1300-miniRNA3-GFP and pCAMBIA1300-miniRNA3-BC-GFP vectors were transformed into EHA105 competent Agrobacterium, and positive Agrobacterium colonies were identified using primers F-GFP / R-pCAM. The sequences are shown in SEQ ID NOs: 9 and 8. Agrobacterium containing pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP were inoculated into Nicotiana benthamiana leaves. Two days after the injection, Figure 2 As shown in A, compared with EV, CMV induced strong GFP fluorescence and high levels of GFP protein accumulation in the area inoculated with miniRNA3-GFP or miniRNA3-BC-GFP ( Figure 2 AB), although the GFP mRNA level of miniRNA3-BC-GFP was lower than that produced by miniRNA3-GFP ( Figure 2 C). Western blot and qRT-PCR analysis showed that, under CMV-uninfected conditions, miniRNA3-BC-GFP did not affect GFP mRNA levels compared with miniRNA3-GFP, but further reduced GFP protein accumulation ( Figure 2 B-2C).

[0057] (V) Since miniRNA3-BC-GFP can more effectively inhibit the accumulation of GFP protein and can initiate GFP expression through CMV, pCAMBIA1300-miniRNA3-BC was selected to be constructed into NLP Pya .

[0058] 1. Synthetic NLP Pya As a template, use primer F-NLP Pya / R-NLP Pya Amplifying NLP Pya Nucleotide sequence was obtained to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; NLP Pya The sequence is shown in SEQ ID NO: 5. F-NLP Pya / R-NLP Pya Its sequence is shown in SEQ ID NO: 11-12:

[0059] F-NLP Pya :aattgagtcgagtcACGCGT ATGGTGAGGTTTGTTAGCGCATTG

[0060] R-NLP Pya :ctgggaacacggaaTCTAGATCATTGAAAGAAAGCCTTCACGAGTTTATC

[0061] 2. 600 ng pCAMBIA1300-miniRNA3-BC plasmid, 1 μL MluI, 1 μL XbaI, 2 μL 10× Fast Digest Green Buffer; make up the remaining system to 20 μL with ddH2O; digest at 37°C for 4 hours, then at 80°C for 10 minutes, and store frozen at -20°C;

[0062] 3. Digest 1 μL of the pCAMBIA1300-miniRNA3-BC plasmid backbone with MluI and XbaI enzymes, and Pya / R-NLP Pya 2 μL of the amplified fragment was added to 5 μL of 2× Master Assembly Mix from Sino-US Taihe Co., Ltd., and the volume was made up to 10 μL with ddH2O. The mixture was reacted at 50°C for 15 min.

[0063] 4. Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0064] Identification primer F-NLP Pya / R-pCAM, the sequence is shown in SEQ ID NO: 11 and 8; the correct clones were expanded and cultured, the plasmids were extracted, and sequenced using R-pCAM primers.

[0065] So far, we have obtained the pCAMBIA1300-miniRNA3-BC-NLP Pya carriers, such as Figure 1 shown.

[0066] (6) Place the pCAMBIA1300-miniRNA3-BC-NLP Pya The Agrobacterium containing EV (empty vector) or CMV was co-inoculated into Nicotiana benthamiana leaves. The results showed that 2.5 days after inoculation, miniRNA3-BC-NLP PyaThe leaves co-inoculated with EV did not induce cell necrosis, while the leaves co-inoculated with CMV showed obvious cell necrosis, e.g. Figure 3 As shown in A. This indicates that NLP under the regulation of miniRNA3-BC Pya It can be specifically induced by CMV and may confer resistance to CMV infection on plants.

[0067] (VII) Use the flower dipping method to transfer pCAMBIA1300-miniRNA3-BC-NLP Pya Transform Arabidopsis thaliana to prepare transgenic plants, and obtain miniRNA3-BC-NLP Pya Positive transgenic plants 5# and 11#. CMV was inoculated into miniRNA3-BC-NLP by mechanical inoculation. Pya Transgenic Arabidopsis, Col-0 wild type and miniRNA3-BC-GFP transgenic Arabidopsis. Observation 20 days after inoculation showed that compared with healthy plants, the systemic leaves of Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis inoculated with CMV showed typical CMV symptoms (mosaic and dwarfing). Pya The transgenic Arabidopsis thaliana systemic leaves showed no virus symptoms and their phenotype was completely consistent with that of healthy Col-0 plants, e.g. Figure 3 As shown in B. qRT-PCR analysis showed that the accumulation of CMV RNA was significantly higher in Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis, while in miniRNA3-BC-NLP inoculated with CMV Pya CMV mRNA could not be detected in transgenic Arabidopsis. Figure 3 These results indicate that miniRNA3-BC-NLP Pya It can confer resistance to CMV infection in Arabidopsis.

[0068] RNA was extracted using the Trizol method and reverse transcribed to obtain cDNA. qRT-PCR was performed using the cDNA as a template and primers qPCR-GFP-F / R were used to detect GFP mRNA. The primers qPCR-GFP-F / R are shown in SEQ ID NOs: 13-14. qRT-PCR was performed using primers qPCR-CMV-F / R to detect CMV RNA levels. The primers qPCR-CMV-F / R are shown in SEQ ID NOs: 15-16.

[0069] qPCR-GFP-F: CAATGTATACATCACGGCAGAC

[0070] qPCR-GFP-R:TTTCGAAAGGGCAGATTGTG

[0071] qPCR-CMV-F: TGTAAAGGATTCCGAGGTCA

[0072] qPCR-CMV-R:TCCTCCGAAGTCTAAGACGAG

[0073] The total plant protein was extracted using the urea method, and GFP protein was detected by Western blot.

[0074] The above experimental results show that the present invention utilizes miniRNA3, BC-uAUG-ds and NLP pya It confers high resistance to CMV infection in Arabidopsis.

[0075] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. pCAMBIA1300-miniRNA3-BC-NLP Pya The method for constructing a vector is characterized in that: The following steps are involved: (1) Using artificially synthesized miniRNA3-BC as a template, primers F / R-miniRNA3 were used to obtain a specific PCR band; the PCR target band was constructed into the pCAMBIA1300 vector to obtain a pCAMBIA1300-miniRNA3-BC vector; wherein miniRNA3-BC is shown in SEQ ID NO: 2; the sequence of F / R-miniRNA3 is shown in SEQ ID NO: 6-7; F-miniRNA3:GAAGTTTCATTTCATTTGGAGAGG gtaatcttaccactgtgtgtgtg R-miniRNA3:TACGAACGAAAGCTCGGATCC agctctcccttagccatccg (2) Synthetic NLP Pya As a template, use primer F-NLP Pya / R-NLP Pya Amplifying NLP Pya Nucleotide sequence, a specific PCR band was obtained; among them, NLP Pya The sequence is shown in SEQ ID NO: 5; F-NLP Pya / R-NLP Pya Its sequence is shown in SEQ ID NO: 11-12: F-NLP Pya :aattgagtcgagtcACGCGT ATGGTGAGGTTTGTTAGCGCATTG R-NLP Pya :ctgggaacacggaaTCTAGATCATTGAAAGAAAGCCTTCACGAGTTTATC NLP Pya The PCR fragment was constructed into the pCAMBIA1300-miniRNA3-BC vector linearized with MluI and XbaI to obtain pCAMBIA1300-miniRNA3-BC-NLP Pya carrier.

2. pCAMBIA1300-miniRNA3-BC-NLP obtained by the construction method of claim 1 Pya carrier.

3. pCAMBIA1300-miniRNA3-BC-NLP according to claim 2 Pya Application of vectors in high resistance to cucumber mosaic virus.

4. pCAMBIA1300-miniRNA3-BC-NLP according to claim 3 Pya The application of the vector in high resistance to cucumber mosaic virus is characterized by: Agrobacterium containing pCAMBIA1300-miniRNA3-BC-NLPPya was inoculated into Nicotiana benthamiana leaves.

5. pCAMBIA1300-miniRNA3-BC-NLP according to claim 3 Pya The application of the vector in high resistance to cucumber mosaic virus is characterized by: pCAMBIA1300-miniRNA3-BC-NLP was inserted into the Pya Transform Arabidopsis thaliana to prepare transgenic plants, and obtain pCAMBIA1300-miniRNA3-BC-NLP Pya Positive transgenic plants.

Images