CAPS molecular marker of GhFRO7 gene of upland cotton and application of CAPS molecular marker in early flowering character identification and breeding

Abstract

The invention discloses a CAPS molecular marker of a GhFRO7 gene of upland cotton and application of the CAPS molecular marker in early blossoming character identification and breeding, and belongs to the field of molecular biology. Whole genome association analysis is carried out based on a high-density SNP marker, an SNP site which is located on an upland cotton GhFRO7 gene and is remarkably related to the flowering time character is identified and obtained, and then a CAPS molecular marker with the sequence shown as SEQ ID NO.34 and a primer pair with the sequence shown as SEQ ID NO.3-4 are developed. The CAPS molecular marker and the primer pair thereof provided by the invention can be applied to identification of early flowering upland cotton varieties and molecular marker-assisted selective breeding, and can effectively save the detection cost, shorten the period and improve the detection efficiency. The invention provides a new method for genetic improvement of cotton prematurity, and provides important genetic resources for developing cotton varieties adapting to specific climate conditions.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a CAPS molecular marker of the GhFRO7 gene of upland cotton and its application in early flowering trait identification and breeding. Background Art

[0002] Cotton (Gossypium spp.) is an important crop for producing natural fiber, edible oil, and plant protein. Currently, 95% of cotton fiber produced comes from Upland cotton (Gossypium hirsutum L., AADD, 2n = 4x = 52), the most widely cultivated cotton variety. The Northwest region is a major cotton-producing region. However, in the inland Northwest, spring temperatures rise slowly, the final frost ends late, and autumn temperatures drop rapidly, with the first frost occurring early, the frost-free period being relatively short, and the effective cumulative temperature being relatively low. These climatic conditions are unfavorable for the growth of cotton seedlings, resulting in reduced yield and fiber quality. Early-maturing cotton can effectively adapt to these climatic conditions due to its shorter whole growth period (WGP). Therefore, cultivating early-maturing varieties for cotton production in these regions is crucial.

[0003] Cotton early maturity is a complex quantitative trait primarily involving flowering time (FT) and flowering time (WGP). FT, closely related to WGP, is a key trait influencing early maturity. FT also marks the transition from vegetative to reproductive growth in cotton and is influenced by both the external environment and endogenous genes. Linkage and association analysis are two popular QTL mapping techniques used to determine the genetic basis of complex quantitative traits in cotton. Over the past 20 years, several genetic populations have been generated, and numerous genetic maps have been constructed using simple sequence repeat (SSR) markers for linkage analysis, leading to the discovery of numerous QTLs associated with FT. However, due to the narrow genetic base of these populations, the accuracy of linkage analysis needs to be improved. Association analysis does not require the construction of specialized segregating populations and can directly leverage the extensive genetic variation in natural populations, making it significantly more accurate than linkage analysis. Since the genome of the standard upland cotton line TM-1 was released, numerous association analyses have been conducted using natural populations. Based on linkage disequilibrium, association analyses have mapped SSRs associated with FT. In addition, many single nucleotide polymorphism (SNP) markers closely associated with FT have been identified through genome-wide association studies (GWAS). Although association analysis has revealed several genomic regions associated with FT, more genomic regions need to be explored in the future to breed early-maturing varieties.

[0004] Furthermore, through functional genomics combined with efficient genetic transformation techniques, many FT-related genes have been identified. Several genes have been shown to be associated with FT using a single genetic transformation technique. For example, overexpression of GhAGL17.9, GhFT1, GhCOL1, GhLFY, GhSPL3, GhSWEET42, GhMADS22, GhUCE, GhFPF1, and GhSAMDC1 in Arabidopsis or tobacco has demonstrated that these genes play important roles in flowering regulation. Virus-induced gene silencing (VIGS) has revealed that genes such as GhAP1, GhCIP1, GhAGL6, GhEMF2, GhGASA14, GhASHH1, GhASHH2, and GhKMT3 regulate flowering in cotton. As revealed by cotton RNAi assays, the GhPHYA gene has been shown to potentially regulate flowering. Furthermore, several genes have been shown to play a role in cotton flowering using both genetic transformation techniques. For example, the genes GhPIF4a, GhFUL2, GhSOC1, GhD2HGDH, GhELF3, GhLUX1, GhNAC79, GhAAI66, and GhAP1.7 play key roles in flowering, as demonstrated by overexpression in cotton (Arabidopsis) and VIGS experiments. Overexpression in Arabidopsis and RNA interference (RNAi) testing in cotton revealed that the genes GhCAL, GhHB12, GhSPL10, and GhmiR157 are also involved in flowering control. The key function of the GhAP1-D3 genes in controlling flowering was confirmed by gene editing and overexpression in cotton. Although many studies have examined the regulation of FT, the genetic mechanism of FT as a quantitative trait is more complex because it is regulated by multiple genes and environmental factors. Therefore, further exploration of potential genes and related molecular markers associated with FT expression is needed to expand the library of early-maturing genes for breeding early-maturing cotton varieties. Summary of the Invention

[0005] The purpose of the present invention is to provide a CAPS molecular marker of the GhFRO7 gene of upland cotton and its application in the identification and breeding of early flowering traits to solve the problems existing in the above-mentioned prior art. The CAPS molecular marker provided by the present invention will provide important genetic resources for the identification of early-flowering upland cotton and the development of cotton varieties adapted to specific climatic conditions.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a CAPS molecular marker for detecting flowering time of upland cotton. The nucleotide sequence of the CAPS molecular marker is shown in SEQ ID NO.34, and the polymorphism of the 368th base of the sequence is C or T.

[0008] Preferably, a CAPS molecular marker primer pair is used to amplify an 879 bp band in the genomic DNA of upland cotton, wherein the amplified band of the early-flowering variety of upland cotton is digested with BstB I to produce bands of 369 bp and 510 bp; the amplified band of the late-flowering variety of upland cotton is digested with BstB I to obtain a band of 879 bp;

[0009] The nucleotide sequence of the forward primer of the CAPS molecular marker primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0010] The present invention also provides a primer pair for detecting the above-mentioned CAPS molecular marker. The nucleotide sequence of the forward primer of the primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0011] The present invention also provides a use of the primer pair in preparing a product for detecting the CAPS molecular marker.

[0012] The present invention also provides a kit for detecting the CAPS molecular marker, comprising the primer pair.

[0013] Preferably, the restriction endonuclease BstB I is also included.

[0014] The present invention also provides an application of the CAPS molecular marker, the primer pair or the kit in identifying early-flowering varieties of upland cotton.

[0015] The present invention also provides an application of the CAPS molecular marker, the primer pair or the kit in molecular marker-assisted selection breeding of flowering time traits of upland cotton.

[0016] The present invention also provides a method for identifying early-flowering varieties of upland cotton, comprising the following steps:

[0017] Extracting DNA from the upland cotton sample to be tested;

[0018] Using the DNA as a template, amplification is performed using the above primer pair, and the amplified product is collected;

[0019] Performing enzyme digestion on the amplified product, and performing electrophoresis detection on the enzyme digestion product;

[0020] According to the electrophoresis results, if only the 879 bp band is found, it is a late-flowering variety of upland cotton; if the 369 bp and 510 bp bands are found, it is an early-flowering variety of upland cotton.

[0021] Preferably, the enzyme used for the enzymatic digestion is the restriction endonuclease BstB I.

[0022] The present invention discloses the following technical effects:

[0023] Based on extensive SNP analysis and screening of genes related to flowering time of upland cotton, the present invention identified and obtained a SNP site on the upland cotton FRO7 gene that is significantly correlated with the flowering time trait, and then developed a CAPS molecular marker with a sequence as shown in SEQ ID NO.34 and a primer pair with a sequence as shown in SEQ ID NO.3-4. The CAPS molecular marker and primer pair provided by the present invention can be applied to the identification of early-flowering upland cotton varieties and molecular marker-assisted selection breeding, which can effectively save detection costs, shorten cycles, and improve detection efficiency. The present invention provides a new method for the genetic improvement of early-maturing cotton and provides important genetic resources for the development of cotton varieties that adapt to specific climatic conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 Figure 2 shows the results of functional analysis experiments on candidate genes related to flowering time in upland cotton (GhFRO7, GhCML1, GhPCMP-E88, and GhCLASRP); (a) shows the budding time phenotype of different plants (TRV:00, TRV:GhFRO7, TRV:GhCML1, TRV:GhPCMP-E88, and TRV:GhCLASRP); (b) shows the flowering time phenotype of different plants; (c) shows the plant height, first fruiting branch node, and initial node height phenotype of different plants; (d) shows the statistical results of budding time, flowering time, plant height, first fruiting branch node, and initial node height of different plants; data are mean ± standard error (n ≥ 9); different letters indicate significant differences at the 5% level according to Duncan's test;

[0026] Figure 2 Statistical graphs of the relative expression levels of key flowering-related genes in TRV:00 and different silenced plants; (a) is TRV:00 and TRV:GhFRO7; (b) is TRV:00 and TRV:GhCML1; (c) is TRV:00 and TRV:GhPCMP-E88; (d) is TRV:00 and TRV:GhCLASRP; different letters indicate significant differences at the 5% level according to Duncan's test;

[0027] Figure 3 Figure 1 shows the identification results of flowering time haplotypes on chromosomes A02, D10, and D11; (a) Manhattan plots of chromosomes A02, D10, and D11 and LDBLOCK near significant SNPs; (b) major haplotypes and genetic structures of A02_Hap, D10_Hap, and D11_Hap;

[0028] Figure 4 Figure 1 is the identification result of flowering time haplotypes on chromosomes A02, D10 and D11; (a) is the flowering time of A02_Hap1, A02_Hap2 and A02_Hap3; (b) is the flowering time of D10_Hap1, D10_Hap2 and D10_Hap3; (c) is the flowering time of D11_Hap1, D11_Hap2 and D11_Hap3; (d) is the frequency distribution of A02_Hap in Max-50 and Min-50; (e) is the frequency distribution of D10_Hap in Max-50 and Min-50; (f) is the frequency distribution of D11_Hap in Max-50 and Min-50; different letters indicate significant differences at the 5% level according to Duncan's test;

[0029] Figure 5 Figure 1 shows the results of developing CAPS markers using D10_61214168 and D11_24001762. (a) is a schematic diagram of the enzyme digestion of the PCR product of the D10_61214168 allele; (b) is a schematic diagram of the enzyme digestion of the PCR product of the D11_24001762 allele; (c) is the detection of the D10_61214168 allele using the restriction endonuclease BstBI; (d) is the detection of the D11_24001762 allele using the restriction endonuclease BstBI; Ref is reference, Alt is alternative, and M is DNA marker.

[0030] Figure 6 Statistical graph of flowering time of different genotypes identified by CAPS markers developed for D10_61214168; different lowercase letters indicate statistically significant differences. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] The flowering time (FT) in the present invention refers to the time from cotton sowing to flowering.

[0037] The GhFRO7 gene in the present invention is ferric reduction oxidase 7. The nucleotide sequence of the GhFRO7 gene is shown in SEQ ID NO.1, and the CDS sequence of the GhFRO7 gene is shown in SEQ ID NO.2.

[0038] The nucleotide at position 1794 in SEQ ID NO. 1 is the nucleotide polymorphic site of the CAPS marker D10_61214168 of the present invention, and the polymorphism is C / T, and the polymorphism of its reverse complementary sequence is G / A. In the present invention, these two polymorphism relationships are used simultaneously to describe the CAPS marker, and those skilled in the art can undoubtedly determine that the two descriptions have exactly the same meaning.

[0039] The CAPS marker primers are:

[0040] D10_61214168-F: 5'-GCAGGTGGCATTGGGATTTC-3' (SEQ ID NO.3);

[0041] D10_61214168-R: 5'-GAAATCCCAATGCCACCTGC-3' (SEQ ID NO.4);

[0042] The nucleotide polymorphism site of the CAPS marker D11_24001762 of the present invention is located at the 712th nucleotide of the GhCML1 gene shown in SEQ ID NO. 5, the polymorphism is G / T, and the polymorphism of its reverse complementary sequence is C / A;

[0043] The CAPS marker primers are:

[0044] D11_24001762-F: 5'-GCATCCACCCCTCGAATCAT-3' (SEQ ID NO.6);

[0045] D11_24001762-R: 5'-GGCTTGTTTAGGTCCCCGA-3' (SEQ ID NO. 7).

[0046] qRT-PCR method of the present invention: Samples were collected from plant leaves and immediately stored at -80°C. The material was then pulverized in a mortar cooled with liquid nitrogen, and RNA was extracted using the RNAprep PurePlantPlus kit (Tiangen Biotechnology, Beijing, China). UnionScript First-Strand cDNA Synthesis Mix for qPCR (containing dsDNase, Genesand Biotech, Beijing, China) was used to synthesize cDNA. qRT-PCR amplification was performed using Bright Cycle Universal SYBR Green qPCR Mix with UDG (ABclonal, China).

[0047] Example 1

[0048] Based on the differences in expression levels between early-flowering and late-flowering varieties, the present invention screened four candidate genes, GhFRO7 (SEQ ID NO. 1), GhCML1 (SEQ ID NO. 5), GhPCMP-88 (SEQ ID NO. 8), and GhCLASRP (SEQ ID NO. 9) (except GhFRO7, the sequences of the other three candidate genes are all CDS sequences); the relative expression levels of the four candidate genes are significantly higher in late-flowering varieties than in early-flowering varieties, and they may regulate the flowering time of upland cotton.

[0049] 1. Experimental Methods

[0050] 1.1 Gene silencing

[0051] VIGS experiments were performed using Zhongmian 113 as the recipient material to functionally verify the four candidate genes. The corresponding silencing fragments (300-500 bp) of the four candidate genes were introduced into the TRV-based (pYL156) vector and named TRV:GhFRO7, TRV:GhCML1, TRV:GhPCMP-E88, and TRV:GhCLASRP.

[0052] The vector was then introduced into Agrobacterium strain GV3101 using the freeze-thaw method. The primers used to construct the pYL156 vector for silencing the four candidate genes are shown in SEQ ID NOs. 10-17.

[0053] Primers for cloning silent fragments:

[0054] GhFRO7-F: 5'-TGAGAAGTATGTCATTTTCCACCTG-3' (SEQ ID NO. 10);

[0055] GhFRO7-R: 5'-GCATGCTCAAAAGGGATGTCT-3' (SEQ ID NO. 11);

[0056] GhCML1-F: 5'-GGGAGAGGTGCTTGACATAGG-3' (SEQ ID NO. 12);

[0057] GhCML1-R: 5'-ACAAAGGCCCTAGGTTGATGA-3' (SEQ ID NO. 13);

[0058] GhPCMP-E88-F: 5'-GGGAGGGAAGTTGGGTTCTG-3' (SEQ ID NO. 14);

[0059] GhPCMP-E88-R: 5'-CCCTGTTCTGAGTGCAAACGC-3' (SEQ ID NO. 15);

[0060] GhCLASRP-F: 5'-CCCTCAAAACAGGGGCAGAT-3' (SEQ ID NO. 16);

[0061] GhCLASRP-R: 5'-GGTGAACGGGAATTTGAGCG-3' (SEQ ID NO. 17).

[0062] TRV:GhCLA1 (positive control), TRV:00 (negative control), TRV:GhFRO7, TRV:GhCML1, TRV:GhPCMP-E88, and TRV:GhCLASRP were then mixed with the helper vector pYL192 at a 1:1 ratio and incubated in the dark at 28°C for 3 hours before injection into the cotyledons of 7-day-old cotton plants. Virus-infected seedlings were incubated in the dark for 24 hours in a climate chamber and then transferred to long-day conditions (16 hours light / 8 hours dark). For the positive control (TRV:GhCLA1), after albinism appeared, gene-silenced plants with expression levels less than 50% of those in TRV:00 plants were selected by qRT-PCR; these selected plants are designated TRV:GhFRO7, TRV:GhCML1, TRV:GhPCMP-E88, and TRV:GhCLASRP.

[0063] 1.2 Phenotypic observation

[0064] We investigated five early maturity-related traits in TRV:00, TRV:GhFRO7, TRV:GhCML1, TRV:GhPCMP-E88, and TRV:GhCLASRP: bud break time (BT), FT, plant height (PH), first fruiting branch node (FFBN), and first fruiting branch node height (HFFBN). At least nine plants were used for each VIGS construct.

[0065] 1.3 Detection of related gene expression

[0066] To validate the roles of these four candidate genes in flowering regulation, we examined several key flowering genes in silenced cotton plants, including GhFT, GhCAL, GhSOC1, GhAP1, GhCOL2, GhSVP, and GhLFY. We used cDNA from the third true leaf of TRV:GhFRO7, TRV:GhCML1, TRV:GhPCMP-E88, TRV:GhCLASRP, and TRV:00 plants as templates for qRT-PCR experiments. The primers used were as follows:

[0067] Table 1 Primer list

[0068] name Primers Sequence number qGhSVP-F ATTGGGTTGAGCCGTGTGAT SEQ ID NO.18 qGhSVP-R GGTAACTTGTCTTGGGCCGT SEQ ID NO.19 qGhLFY-F TGGCAAAAAGAACGGCCTTG SEQ ID NO.20 qGhLFY-R TAGTGGGGCATTTTTCGCCA SEQ ID NO.21 qGhSOC1-F AAGTACGGTCTGTTGCCAGG SEQ ID NO.22 qGhSOC1-R CTGTTGAGTTGGGTTGCACG SEQ ID NO.23 qGhFT-F TGCTCCAAGTCCAAGTGACC SEQ ID NO.24 qGhFT-R ACGATGGATACCGACCGTTG SEQ ID NO.25 qGhAP1-F ATGTGGAGCAGGCACATTGG SEQ ID NO.26 qGhAP1-R TCATCCATGGCAGCAAGACG SEQ ID NO.27 qGhCAL-F GCGATGCTGATGTTGCTTTGA SEQ ID NO.28 qGhCAL-R ATTCAGAACCAGTTGGGGCAT SEQ ID NO.29 qGhCOL2-F GCCTGGATTACGATGCCTCA SEQ ID NO.30 qGhCOL2-R TGTACCTTTAGGCGGCCTTG SEQ ID NO.31 GhActin-F ATCCTCCGTCTTGACCTTG SEQ ID NO.32 GhActin-R TGTCCGTCAGGCAACTCAT SEQ ID NO.33

[0069] 2. Experimental Results

[0070] 2.1 Phenotypic observations

[0071] Compared with TRV:00 control plants, plants silenced for GhFRO7, GhCML1, GhPCMP-E88, or GhCLASRP all showed an early flowering phenotype, as shown in Figure 1 In addition, the bud break time (BT) of these gene silenced plants was significantly earlier than that of the TRV:00 control plants, see Figure 1 (a) and (d) Compared with the control plants, the plants with GhCML1 gene silenced showed lower pH and HFFBN values, and their FFBN values were significantly lower than those of the control plants at TRV:00. Figure 1 (c) and (d) in the middle.

[0072] In summary, GhFRO7, GhPCMP-E88 and GhCLASRP may be important candidate genes regulating the late-flowering phenotype of upland cotton, and GhCML1 may play an important role in regulating FT, PH, HFFBN and NFFBN of upland cotton.

[0073] 2.2 Detection results of related gene expression

[0074] The relative expression levels of seven key flowering genes in the silenced TRV:GhFRO7 plants were significantly higher than those in the control TRV:00 plants, as shown in Figure 2 In the silenced TRV:GhCML1 and TRV:GhPCMP-E88 plants, the relative expression levels of GhFT, GhCAL, GhSOC1, GhAP1, GhCOL2, and GhLFY were significantly higher than those in the control plants, while the relative expression level of GhSVP was significantly lower than that in the control plants, as shown in Figure 2(a). Figure 2 (b) and (c) Compared with the control plants, the expression of GhFT, GhCAL, GhAP1 and GhLFY in the TRV:GhCLASSRP silenced plants increased, while the expression of GhSOC1, GhCOL2 and GhSVP was significantly reduced, see Figure 2 Middle (d).

[0075] These results suggest that the four candidate genes, GhFRO7, GhCML1, GhPCMP-E88, and GhCLASSRP, may be involved in the regulation of FT by affecting the expression of key flowering-related genes.

[0076] Example 2

[0077] In the inventors' previous research, principal component analysis, phylogenetic tree analysis, and population structure analysis were used to classify 418 upland cotton lines into three major subgroups. The linkage disequilibrium (LD) decay rate was approximately 0.46 kb (see the literature "Identification of Elite Alleles and Candidate Genes for the Cotton BollOpening Rate via a Genome-Wide Association Study" for details).

[0078] A GWAS for the FT trait was conducted using 1,574,032 high-quality SNPs in 418 core upland cotton lines. Marker-phenotype association analysis was performed using a mixed linear model (MLM) using GEMMA software and completed with VCF2 GWAS software. -5 SNPs with significant associations were screened for significance thresholds, and significant SNPs with nonsynonymous mutations were further annotated. Haplotypes were identified by calculating LD blocks within 100 kb of significant SNPs with nonsynonymous mutations using LDBlockShow. Given that early maturity is an adaptation to NIR light and is suitable for mechanized harvesting, we believe that lines with short FT have favorable haplotypes / alleles.

[0079] In addition, we selected 100 cotton varieties with the earliest FT (Min-50) and the latest FT (Max-50) and calculated the frequency distribution of haplotypes / alleles in the two populations to further identify favorable haplotypes / alleles.

[0080] To identify haplotypes favoring flowering, we selected significant SNPs with nonsynonymous mutations on chromosomes A02, D10, and D11 (-log 10 (p)>5) LD block analysis revealed the presence of haplotypes on chromosomes A02, D10, and D11, see Figure 3 (a) Through GWAS, two SNP alleles (A02_6711941 and A02_6711947) from chromosome A02 were found to be associated with FT, with the nucleotide polymorphisms being G / A and C / A, respectively. Due to the close linkage between the two SNP loci, three different haplotypes (GG-CC, GA-CA, and AA-AA) were discovered and named A02_Hap1, A02_Hap2, and A02_Hap3, see Figure 3 The A02_Hap3 haplotype, which includes 133 varieties, is considered a favorable haplotype because its average FT (76.87 d) is much lower than that of A02_Hap1 (78.55 d), which includes 454 varieties, and significantly lower than that of A02_Hap2 (77.88 d), which includes 14 varieties. Figure 4 Middle (a).

[0081] Through GWAS, FT was associated with three SNP sites on chromosome D10 (D10_61213074, D10_61213558, and D10_61213909; the nucleotide polymorphisms of the three SNPs are A / G, T / C, and T / C, respectively. These three SNPs are composed of three major haplotypes (AA-TT-TT, AG-TC-TC, and GG-CC-CC), which are named D10_Hap1, D10_Hap2, and D10_Hap3, respectively, due to their close interlocking relationship. Figure 3 (b). D10_Hap1, D10_Hap2, and D10_Hap3 consist of 397, 5, and 192 varieties, respectively. The FT of haplotype D10_Hap3 (76.79 d) is significantly lower than that of D10_Hap1 (78.95 d) and D10_Hap2 (78.13 d), and is therefore considered a favorable haplotype. Figure 4 Middle (b).

[0082] The other 11 SNP sites associated with FT (D11_24001762, D11_24003645, D11_24003668, D11_24004421, D11_24004651, D11_24009646, D11_24010285, D11_24010356, D11_24010672 and D11_24050721) are closely related to FT and are located on chromosome D11. Due to the tight linkage association among the 11 SNP loci, three core haplotypes (CC-GG-AA-CC-AA-CC-GG-CC-TT-AA, CC-GG-AA-CC-AA-CC-CC-GG-CC-GG-CC-TT-GG, and AA-AA-GG-GG-GG-TT-AA-TT-GG-GG-TT-GG-GG-GG-GG) were identified and named D11_Hap1, D11_Hap2, and D11_Hap3, respectively. Figure 3 (b). D11_Hap1, D11_Hap2, and D11_Hap3 have 385, 4, and 149 varieties, respectively. Similarly, the average FT of the D11_Hap3 line (76.40 d) is shorter than that of the D11_Hap1 line (78.97 d) and the D11_Hap2 line (78.29 d); therefore, D11_Hap3 is called a favorable haplotype, see Figure 4 Middle (c).

[0083] In addition, the present invention calculated the haplotype frequency distribution of Min-50 (83.07 d) and Max-50 (70.88 d) lines to confirm the effect of these haplotypes on FT. We found that Min-50 germplasm showed more favorable haplotype frequencies than Max-50 germplasm. In Max-50 line, the frequencies of A02_Hap1, A02_Hap2 and A02_Hap3 were 0.90, 0.02 and 0.08, respectively; in Min-50 line, the frequencies of A02_Hap1, A02_Hap2 and A02_Hap3 were 0.55, 0.04 and 0.41, respectively. The results showed that A02_Hap3 was the superior haplotype because it was more frequently distributed in the Min-50 population, see Figure 4 Middle (d).

[0084] In the Max-50 line, the frequencies of D10_Hap1 and D10_Hap3 were 0.94 and 0.06, respectively, and in the Min-50 line, the frequencies of D10_Hap1 and D10_Hap3 were 0.41 and 0.59, respectively. The results showed that D10_Hap3 was the superior haplotype because it was more frequently distributed in the Min-50 population, see Figure 4 Middle (e).

[0085] In the Max-50 lineage, the frequencies of D11_Hap1, D11_Hap2, and D11_Hap3 were 0.89, 0.02, and 0.09, respectively; in the Min-50 lineage, the frequencies of D11_Hap1 and D11_Hap3 were 0.36 and 0.64, respectively. The results showed that D11_Hap3 was the superior haplotype because it was more frequently distributed in the Min-50 population. Figure 4 Middle (f).

[0086] Example 3

[0087] We developed two CAPS markers based on the four FT candidate genes in Example 1. These markers rely on changes in the restriction endonuclease BstB I recognition site caused by the D10_61214168 (A / G) and D11_24001762 (A / C) alleles for genotyping.

[0088] Based on two SNPs (D10_61214168 and D11_24001762) within the candidate gene, D10_Hap and D11_Hap in Example 2 were identified. Figure 3 (a)). Since D10_61214168 and D10_Hap have a close linkage relationship, such as Figure 3This is shown in the LDblock for D10 in (a). D11_24001762 is a SNP within D11_Hap, so D11_24001762 can identify D11_Hap. Two specific CAPS markers were developed based on these haplotypes. The relevant primers are shown in SEQ ID NOs. 3-4 and 6-7.

[0089] First, genomic DNA was obtained from 4-week-old cotton leaves using the Super Plant Genomic DNA Kit (TiangenBiotech, Beijing, China). The concentration and purity of the collected DNA were determined by agarose gel electrophoresis and spectrophotometry. The extracted DNA was then used as a template for PCR amplification. Finally, the restriction endonuclease BstBI was used to digest the 879 bp and 631 bp PCR products, which were then separated by electrophoresis on a 1.5% (w / v) agarose gel.

[0090] Specifically, PCR products of 879 bp and 631 bp were obtained by primer amplification of the cotton genomic DNA region containing the D10_61214168 and D11_24001762 sites, respectively, and their sequences are shown in SEQ ID NOs. 34-35, respectively.

[0091] Theoretically, the restriction endonuclease BstB I digestion of the PCR amplification product of the D10_61214168_AA genotype should produce two fragments of 369 bp and 510 bp. The PCR amplification product of the D11_24001762_AA genotype should theoretically produce two fragments of 338 bp and 293 bp after BstB I digestion. Figure 5 (a) and (b) in the middle.

[0092] The experimental results showed that after digestion with BstB I, the PCR amplification product of the D10_61214168_AA genotype showed two independent bands in agarose gel electrophoresis. Figure 5 In (c), the PCR amplification product of the D11_24001762_AA genotype showed only one band in agarose gel electrophoresis after enzyme digestion because the two fragments produced were of similar size. Figure 5 Middle (d).

[0093] Example 4

[0094] The 418 core upland cotton lines in Example 2 were divided into AA genotype and GG genotype based on the enzyme digestion results of the PCR product of CAPS marker D10_61214168 screened in Example 3; and the flowering time of different genotypes was detected.

[0095] The results are as follows Figure 6 As shown in the data, the average flowering time of the AA genotype was 76.70 days, the average flowering time of the GG genotype was 78.91 days, and the average flowering time of the GA genotype was 77.69 days. The average flowering time of the GG genotype was significantly later than that of the AA genotype (P<0.05).

[0096] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A CAPS molecular marker for detecting flowering time of upland cotton, characterized in that: The nucleotide sequence of the CAPS molecular marker is shown in SEQ ID NO. 34, and the polymorphism of the 368th base of the sequence is C or T.

2. The CAPS molecular marker according to claim 1, wherein A CAPS molecular marker primer pair was used to amplify an 879 bp band in upland cotton genomic DNA. The amplified band of early-flowering upland cotton varieties was digested with BstB I to produce 369 bp and 510 bp bands; the amplified band of late-flowering upland cotton varieties was digested with BstB I to produce an 879 bp band. The nucleotide sequence of the forward primer of the CAPS molecular marker primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.

4.

3. A primer pair for detecting the CAPS molecular marker according to claim 1 or 2, characterized in that: The nucleotide sequence of the forward primer of the primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

4. Use of the primer pair according to claim 3 in preparing a product for detecting the CAPS molecular marker according to claim 1 or 2.

5. A kit for detecting the CAPS molecular marker according to claim 1 or 2, characterized in that: Comprising the primer pair as claimed in claim 3.

6. The kit according to claim 5, wherein Also included is the restriction endonuclease BstBI.

7. Use of the CAPS molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 5 or 6 in identifying early-flowering varieties of upland cotton.

8. Use of the CAPS molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 5 or 6 in molecular marker-assisted selection breeding for flowering time traits in upland cotton.

9. A method for identifying early-flowering varieties of upland cotton, characterized in that: The following steps are involved: Extracting DNA from the upland cotton sample to be tested; Using the DNA as a template, amplification is performed using the primer pair according to claim 3, and the amplified product is collected; Performing enzyme digestion on the amplified product, and performing electrophoresis detection on the enzyme digestion product; According to the electrophoresis results, if only an 879bp band is found, it is a late-flowering variety of upland cotton; If the electrophoresis results show bands of 369 bp and 510 bp, it is an early-flowering variety of upland cotton.

10. The method according to claim 9, wherein The enzyme used in the enzyme digestion is the restriction endonuclease BstB I.

Images