Monascus purpureus and application thereof

Abstract

The invention provides monascus purpureus and application thereof. The invention provides monascus purpureus XK-G-1 which is preserved in the China Center for Type Culture Collection, and the preservation number of the monascus purpureus XK-G-1 is CCTCC (China Center for Type Culture Collection) NO: M20232397. The invention also provides a leavening agent which contains the monascus purpureus. The invention further provides red yeast rice decoction pieces and red yeast rice, the red yeast rice decoction pieces and the red yeast rice are prepared from the leavening agent, and the content of ring-opening lovastatin in the red yeast rice decoction pieces is 15-17mg / g; the total color value of the red yeast rice is 3655-3855 u / g, and the color value of the orange pigment is 1300-1426 u / g. The content of ring-opening lovastatin in the red yeast rice decoction pieces prepared by the method is stabilized at 15-17mg / g, citrinin is not detected, and the red yeast rice decoction pieces are stable in quality and safe. The monascus purpureus and the leavening agent thereof are suitable for various fermentation substrates and compositions thereof such as rice, # imgabs0 oat, highland barley, maize and sticky rice, the fermentation substrates are wide, and a new choice is provided for high added value of agricultural and sideline products.

Description

Technical Field

[0001] The invention relates to purple monascus and application thereof, and belongs to the field of fermentation. Background Art

[0002] Monascus, a filamentous fungus with a polyketide metabolic pathway, is an important fermentation microorganism for traditional foods and traditional Chinese medicines. Its primary fermentation product is red yeast rice. Monascus is made by inoculating steamed or sterilized, cooled rice with Monascus spp. and fermenting it under suitable temperature and humidity conditions. During fermentation, Monascus metabolites produce a variety of active substances, such as lovastatin and red yeast pigment. Lovastatin has attracted considerable attention for its efficacy in significantly lowering low-density lipoprotein (LDL) and cholesterol, while also being highly safe. In 1979, Akira Endo first isolated from a Monascus culture an active substance that significantly inhibits cholesterol synthesis. He named it Monacolin K, which was later confirmed to be lovastatin. Monacolin K's structure is similar to that of HMG-CoA reductase, a key rate-limiting enzyme in cholesterol synthesis. It competitively inhibits HMG-CoA reductase during cholesterol synthesis, effectively lowering LDL cholesterol levels. Goldstein and Brown were awarded the Nobel Prize in 1985 for uncovering the mechanism of action of Monacolin K.

[0003] With the improvement of living standards and the aging of the population, the global incidence of hyperlipidemia has been increasing annually. Hyperlipidemia is primarily characterized by elevated serum cholesterol (TC) and triglycerides (TG), decreased high-density lipoprotein cholesterol (HDL-C), and elevated low-density lipoprotein (LDL). Hyperlipidemia has become a significant risk factor for common diseases such as fatty liver disease, coronary heart disease, and atherosclerosis. Currently, the following lipid-lowering drugs are commonly used clinically: 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins), bile acid sequestrants, nicotinic acid (niacin) and its derivatives, phenoxyaromatic acids (fibrates), and fish oil preparations (polyunsaturated fatty acids). Currently, statins have become the most commonly prescribed drugs for the treatment of hypercholesterolemia. The statins currently available on the market include: lovastatin, simvastatin, pravastatin, atovastatin, etc., and Chinese patent medicines containing red yeast rice such as Xuezhikang, Zhibituo, and Zhibitai.

[0004] Monascus pigments primarily consist of red, orange, and yellow pigments, with the total color value being the sum of these three. Numerous studies have shown that Monascus orange pigment has significant inhibitory effects against bacteria, yeast, filamentous fungi, Bacillus subtilis, Candida, Gram-positive bacteria, and Escherichia coli; possesses anti-tumor efficacy similar to that of paclitaxel; and exhibits strong cytotoxic and antimitotic effects on IHKE (immortalized human renal epithelial) cells. Furthermore, a threonine derivative of Monascus orange pigment significantly reduces low-density lipoprotein (LDL) levels in mouse serum and increases high-density lipoprotein (HDL) levels and the HDL-to-LDL ratio.

[0005] Application number: 201710071293.6, invention title: A method for promoting the production of red koji orange pigment by liquid fermentation of Monascus purpurogenum. This invention relates to the field of microbial fermentation technology. The invention inoculates a liquid culture medium with a red koji seed culture solution and ferments it at 30°C for 6-8 days. Within 24 hours of fermentation, a surfactant is added to the fermentation medium to promote the synthesis of the active substance, red koji orange pigment, during the growth of the Monascus purpurogenum.

[0006] Purple Monascus is one of the most widely used red yeast rice fermentation strains and is also the designated strain in most red yeast rice product standards. It is highly safe and has a strong ability to produce lovastatin and red yeast rice pigments.

[0007] Application number 202110330370.1, invention name: A purple Monascus Z-27 with high lovastatin production and its application, discloses a purple Monascus Z-27 with high lovastatin production and its application, belonging to the field of fermentation engineering and biotechnology. Through ultraviolet mutagenesis screening, a purple Monascus was obtained that has improved lovastatin production, Monascus pigment synthesis, stability, etc., and does not produce citrinin. In the preparation of red yeast rice fermentation agent by solid-state fermentation of purple Monascus, the lovastatin production can reach 20-24 mg / g, and the color value can reach 3000-3200 μ / g, both of which are at a high level and no citrinin is detected. In addition, the strain or fermentation agent is applied to the preparation of fermented foods such as rice wine, bean paste, soy sauce, vinegar, and bread, and no citrinin is detected, and the lovastatin production can reach 40.70 mg / g. CN202110305070.8, invention name: A purple Monascus W-4 with high lovastatin production and its application, discloses a purple Monascus W-4 with high lovastatin production and its application, belonging to the field of fermentation engineering and biotechnology. The present invention selects a purple Monascus W-4 that can produce high lovastatin and is free of citrinin by atmospheric and room temperature plasma (ARTP) technology. The purple Monascus solid-state fermentation is used to prepare red yeast rice fermentation agent, and the lovastatin yield can reach 30-35 mg / g, and the color value can reach 5000-6000 μ / g. It is applied to the preparation of fermented foods such as rice wine, vinegar, soy sauce, broad bean paste, bread, etc., and the lovastatin content is at a high level and no citrinin is detected.

[0008] There are currently no reports on purple Monascus strains that can stably and efficiently produce both open-loop lovastatin and red yeast orange pigment without producing citrinin. Therefore, the development of safe purple Monascus strains that can stably and efficiently produce both open-loop lovastatin and red yeast orange pigment has significant practical and research significance for the development and application of Monascus strain resources and the industrialization of Monascus. Summary of the Invention

[0009] The invention relates to purple monascus and application thereof.

[0010] The invention provides a purple Monascus purpureus XK-G-1, which is preserved in China Center for Type Culture Collection with a preservation number of CCTCC NO: M20232397.

[0011] The present invention provides the use of the purple monascus in preparing monascus decoction pieces.

[0012] The invention provides the use of the purple monascus in preparing red yeast rice.

[0013] The invention provides application of the purple Monascus in preparing orange pigment.

[0014] The rRNA gene sequence of the purple Monascus purpureus XK-G-1, including the ITS rRNA gene sequence and the 18S rRNA gene sequence, are respectively:

[0015] ITS rRNA gene sequence:

[0016] GGGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAACCTTCCCACCC

[0017] GTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCCGGGGCCCGCCGGAGACATCTTCTCGA

[0018] ACCGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAAC

[0019] GGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA

[0020] ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGT

[0021] CCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCTCCGG

[0022] GCAAGGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCT

[0023] TTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAG;

[0024] 18S rRNA gene sequence:

[0025]

[0026] The invention provides a fermentation agent, which comprises the purple monascus.

[0027] Among them, the number of purple Monascus spores in each milliliter of fermentation agent is ≥1×10 5 .

[0028] The present invention also provides a method for preparing a fermented product using the fermentation agent, which comprises the following steps:

[0029] a. preparing a steamed fermentation matrix;

[0030] b. Add the fermentation agent according to claim 5 or 6, the amount of the fermentation agent is 8-10% of the fermentation substrate, ferment at 28-30 ° C for 1 day, and break up;

[0031] c. Ferment at 22-25℃ for 10-11 days, turning the koji over every 4 days. When the fermentation is complete, collect the koji, dry it, and you will get the fermented product.

[0032] Wherein, the fermentation substrate is rice, Any one of oats, barley, corn, and glutinous rice, or a combination of two or more.

[0033] Wherein, the fermented products are red yeast rice slices and foods.

[0034] The present invention also provides a red yeast rice prepared by the method. The red yeast rice contains 15-17 mg / g of open-loop lovastatin, a total color value of 3655-3855 u / g, and an orange pigment color value of 1300-1426 u / g.

[0035] Beneficial effects of the present invention:

[0036] (1) The present invention provides a purple Monascus strain XK-G-1 that produces open-loop lovastatin and stable red yeast orange pigment, and a fermentation agent prepared therefrom. The open-loop lovastatin content of the red yeast rice slices prepared by solid-state fermentation is stable at 15-17 mg / g, and citrinin is not detected, effectively ensuring stable quality and safety. Currently, most commercially available red yeast rice slices have low and highly fluctuating open-loop lovastatin content. The open-loop lovastatin content varies greatly between batches of the same specification from the same manufacturer, and citrinin is detected in most cases.

[0037] (2) The open-loop lovastatin content in the pilot fermentation product of purple red yeast rice involved in the present invention is stable at 15-17 mg / g. Closed-loop lovastatin needs to be metabolized into open-loop lovastatin in the human body to exert its efficacy. This process puts a heavy burden on the human body and causes a large loss of efficacy. A stable open-loop lovastatin content is the key to the development of subsequent products related to red yeast rice and the stability and safety of quality. The maximum daily dose of medicinal lovastatin is 20 mg, and the maximum daily dose of lovastatin specified in health food regulations is 10 mg. There are currently no reports on purple red yeast rice strains with stable open-loop lovastatin production. Compared with 202110330370.1 and CN202110305070.8, the most significant advantage of the present invention is that the strain is stable and capable of producing open-loop lovastatin.

[0038] Open-ring lovastatin itself is highly active, and commercially available red yeast rice products undergo conversion and degradation during storage. Therefore, these products use only closed-ring or total lovastatin as an indicator, avoiding the open-ring lovastatin content indicator. The red yeast rice fermented with the strain of the present invention contains a stable open-ring lovastatin content, resolving the practical and common problem of red yeast rice products avoiding the open-ring lovastatin indicator.

[0039] (3) The amount of fermentation agent used is small (8-10%), and the production cost is low.

[0040] (4) The fermentation time of pilot production of red yeast rice slices is only 11-12 days. The fermentation time and the number of turning over are much shorter than the fermentation time of existing red yeast rice slices, and the fermentation efficiency is high.

[0041] (5) The strains are adaptable to a wide variety of fermentation substrates, which can effectively expand the types of fermentation products and the types of subsequent product development, providing new options for the high added value of agricultural and sideline products.

[0042] (6) The present invention uses the purple Monascus and the fermentation agent prepared therefrom to prepare red yeast rice with a total color value stable at 3655-3855 u / g; the orange pigment color value is stable at 1300-1426 u / g, and the orange pigment value accounts for 35-37% of the total color value throughout the fermentation cycle, and no citrinin is detected. The product can be widely used in the fields of food, colorants, etc., and can effectively improve the color of the product and effectively enhance the health functionality and safety of the product. Currently, no red yeast rice with a high and stable orange pigment color value has been found on the market. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Colony morphology of Monascus purpurogenum XK-G-1 on PDA medium (7 days of culture);

[0044] Figure 2 Optical micrograph of Monascus purpurogenum XK-G-1 cultured on PDA medium for 7 days;

[0045] Figure 3Standard curve of open-ring lovastatin determined by HPLC;

[0046] Figure 4 HPLC chromatogram of open-ring lovastatin from red yeast rice slices prepared from purple Monascus XK-G-1;

[0047] Figure 5 The color value and total color value of red yeast rice orange pigment prepared by purple Monascus XK-G-1. DETAILED DESCRIPTION

[0048] Example 1 Purple Monascus of the present invention

[0049] Purple Monascus purpureus XK-G-1 is deposited in the China Center for Type Culture Collection, the deposit date is November 30, 2023, the deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M20232397.

[0050] Main features and characteristics:

[0051] The strain was cultured on PDA medium ( Figure 1 ), the colony diameter is ≥3cm after 2 days of culture, and conidia are visible after 1 day of culture. After 7 days of culture, the hyphae are septate, multi-branched, and 3-5μm in diameter. The cleistothecia are 20-30μm in diameter, and the ascospores are broadly elliptical, 6-7×4-5μm. Conidia are attached to the top of the sporangium, singly or in clusters, nearly spherical or inverted pear-shaped, 8-12.5×7-10μm ( Figure 2 After 30 hours of fermentation in potato-glucose liquid medium, 8.5±0.47g of mycelium can be harvested per 100ml of fermentation liquid, and the growth cycle is short.

[0052] 18S and ITS rRNA sequencing (internal transcribed spacer ribosomal RNA sequencing) are currently commonly used amplicon sequencing methods for identifying and comparing bacteria or fungi in a given sample. The gene sequence of Monascus purpureus XK-G-1 is as follows:

[0053] 1) Strain XK-G-1 ITS rRNA gene sequence:

[0054] GGGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAACCTTCCCACCC

[0055] GTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCCGGGGCCCGCCGGAGACATCTTCTCGA

[0056] ACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAAC

[0057] GGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA

[0058] ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGT

[0059] CCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGG

[0060] GCAAGGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCT

[0061] TTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGA

[0062] CCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAG

[0063] 2) 16S rRNA gene sequence of strain XK-G-118:

[0064] GCAATTTATACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACT

[0065] ACATGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTA

[0066] TTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTAAACGAATCGC

[0067] ATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTG

[0068] GCCTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAA

[0069] ACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGAGGAGGTA

[0070] GTGACAATAAATACTGATACGGGGCTCTTTCGGGTCTCGTAATCGGAATGAGAACGACCTAAATA

[0071] ACCTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAAT

[0072] AGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCCGGTC

[0073] CGCCTCACCGCGAGTACTGGTCCGGCCGGACCTTTCCTTCTGGGGAACCTCATGGCCTTCACTGG

[0074] CTGTGGGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCG

[0075] AATACATTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGT

[0076] AATGATTAATAGGGATAGTCGGGGGCGTCAGTATTCAGCTGTCAGAGGTGAAATTCTTGGATTTGC

[0077] TGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGGGAACGAAAGTTAG

[0078] GGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGAC

[0079] GGGTTTCTATGATGACCCGTTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGT

[0080] ATGGTCGCAAGGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACAAGGCGTGGAGCCTGCG

[0081] GCTTAATTTGACTCAACACGGGGAAACTCACCAGGTCCAGACAAAATAAGGATTGACAGATTGA

[0082] GAGCTCTTTCTTGATCTTTTGGATGGTGGTGCATGGCCGTTCCTAGTTGGTGGAGTGATTTGTCTG

[0083] CTTAATTGCGATAACGAACGAGACCTCGGCCCTTCAATAGCCCGGTCCGCATTTGCGGGCCGCTG

[0084] GCTTCTTAAGGGGACTATCGGCTCAAGCCGATGGAAGTGCGCGGCAATAACAGGTCTGTGATGCC

[0085] CTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACAGGGCCAGCGAGTACATCACCTTGGCCGA

[0086] GAGGCCTGGGTAATCTTGTTAAACCCTGTCGTGCTGGGGATAGAGCATTGCAATTATTGCTCTTCA

[0087] ACGAGGAATGCCTAGTAGGCACGAGTCATCAGCTCGTGCCGATTACGTCCCTGCCCTTTGTACAC

[0088] ACCGCCCGTCGCTACTACCGATTGAATGGCTCAGTGAGGCCTCCGGACTGGCCCAGGGAGGTTGGCAACGACCCCCCCGGGCCGGAAAGCTGGTCAAACTCGGTCATTAG.

[0089] Example 2 Screening of red yeast rice strains producing open-loop lovastatin and red yeast rice with stable orange valence

[0090] Weigh 39.0 g of commercially available PDA medium and dissolve it in 1000 ml of distilled water. Sterilize at 121°C for 15 minutes. Preparation and detection methods for citrinin and seco-lovastatin follow the guidelines in the "Jiangsu Province Traditional Chinese Medicine Processing Standards 2020 Edition, Volume 1, Red Yeast Rice." Color value determination method follows the guidelines in GB 1886.19-2015, "Food Additive Red Yeast Rice."

[0091] (1) Sample collection

[0092] Red yeast rice was collected from Ya'an City, Sichuan Province and stored in a sealable sterile plastic bag at 4°C. A 1.0 g sample of red yeast rice was weighed and ground in a sterile mortar under aseptic conditions. The sample was then placed in a 99 ml Erlenmeyer flask containing sterile saline and glass beads and shaken at 120 rpm for 30 min.

[0093] (2) Strain isolation and purification

[0094] In a clean bench, shake the flask containing 1% m / v red yeast rice sample, draw 1 ml of red yeast rice solution from it for gradient dilution to obtain 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 times sample dilution, take 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 200 μl of five dilution gradient samples were spread on PDA culture medium, inverted, and cultured at 30℃ for 1-7 days. The growth of colonies in the plate was observed, and colonies with typical red yeast rice characteristics were picked. The colonies were repeatedly streaked to purify the colonies. The purified strains were passaged for 5 generations with 3 parallels in each generation and stored at -80℃ with 25% glycerol.

[0095] (3) Genetic stability of strains

[0096] The purified red yeast rice strain was inoculated on a PDA plate using a sterile inoculating needle and cultured at 30°C in the dark for 7 days. The culture was subcultured for 5 generations. The results are shown in the "colony diameter" item in Table 1.

[0097] (4) Solid-state fermentation screening

[0098] Preparation of Monascus spore suspension: Inoculate the purified Monascus strain on the slope of a PDA eggplant bottle with a sterile inoculating needle, incubate at 30°C in the dark for 7-10 days, wash the Monascus spores in the eggplant bottle with sterile water, and prepare ≥1×10 5 / ml concentration of spore suspension.

[0099] Solid fermentation rescreening: 250 g of rice and 100 ml of water were placed in a 1000 ml plastic bottle, sealed, and soaked for 2 h at 121 °C, sterilized for 30 min, broken up while hot, cooled to room temperature, and inoculated with 8% of the 1 × 10 5 / ml red yeast rice spore suspension, mix well, ferment at 28℃ for 1 day, break up; then transfer to 22℃, ferment for 10-11 days, break up once every 4 days until the fermentation is completed, collect the koji and dry it.

[0100] (5) Determine the content of open-loop lovastatin, color value, and citrinin in red yeast rice fermentation products.

[0101] (6) The solid-state fermentation screening results are shown in Table 1. The content of open-loop lovastatin in red yeast rice prepared by different generations of purple Monascus XK-G-1 is stable at 15-17 mg / g, and citrinin is not detected (Table 1). The results show that the content and stability of open-loop lovastatin are much better than those of commercial red yeast rice. The orange color value is stable at 1300-1450 u / g and the orange color value accounts for 35-37% of the total color value during the entire fermentation cycle (Table 1, Figure 5 Purple red yeast rice XK-G-1 has the ability to stably produce open-loop lovastatin and red yeast rice orange pigment.

[0102] Table 1 XK-G-1 passage growth, open-loop lovastatin, orange pigment, citrinin

[0103]

[0104]

[0105] Example 3: Application of Purple Red Yeast XK-G-1 in Red Yeast Pieces

[0106] The red yeast rice slices are prepared using purple red yeast rice XK-G-1 or its fermentation agent.

[0107] 250g rice and 100ml nutrient solution were placed in a 1000ml plastic bottle, sealed, and soaked for 2h at 121℃, sterilized for 30min, and then broken up while hot, cooled to room temperature, and inoculated with 9% of the solution at a concentration of not less than 1×10 5 / ml of starter, mix well, ferment at 28-30℃ for 1 day, break up; then transfer to 22-25℃ for 10-11 days, break up once every 4 days until the fermentation is completed, collect the koji and dry it.

[0108] Sampling was conducted to detect open-loop lovastatin and citrinin.

[0109] Test results: Open-loop lovastatin content 16.82±0.33mg / g (see Figure 3 、 Figure 4 ), citrinin was not detected.

[0110] Example 4: Application of Purple Red Yeast XK-G-1 in Red Yeast Rice

[0111] Red yeast rice is prepared using purple red yeast XK-G-1 or its fermentation agent.

[0112] Using aged indica rice as the fermentation substrate, the steamed rice was broken up while still hot and allowed to cool. 15 kg was then placed in a 30 L stainless steel tank and mixed with 10% starter culture. Fermentation was carried out at 28-30°C in the dark for 10 days, with the koji turned over once daily. 35% sterile water was added and mixed thoroughly on the 3rd, 5th, and 7th days. On the 10th day, the koji was collected and dried. Samples were collected and tested for total color value (the sum of the color values ​​of red, orange, and yellow pigments), orange pigment color value, and citrinin content.

[0113] Test results: total color value 3655±8.39u / g, red color value 1207±5.77u / g, orange color value 1388±6.59u / g ( Figure 5 ), citrinin was not detected.

[0114] Example 5: Application of purple red yeast rice XK-G-1 in fermentation on glutinous rice + oats + highland barley to produce orange pigment

[0115] Glutinous rice (80%), oats (10%), and highland barley (10%) were used as the fermentation matrix. The steamed fermentation matrix was broken up while hot and spread to cool. 15 kg of the fermentation matrix was then placed in a 30 L stainless steel tank and mixed with 10% of the starter. The fermentation was carried out at 28-30°C in the dark for 10 days. During this period, the koji was turned over once a day. On the 3rd, 5th, and 7th days, 40% sterile water was added and mixed thoroughly. The koji was collected on the 10th day and dried. Sampling was performed to test the total color value (red color value + orange color value + yellow color value), orange color value, and citrinin content.

[0116] Test results: total color value 3855±7.55u / g, red pigment color value 1100±8.86u / g, orange pigment color value 1392±3.39u / g, citrinin was not detected.

Images