SEA type thalassemia gene detection method based on nucleic acid index isothermal amplification and self-G-tetramer

Abstract

The invention belongs to the technical field of biology, and particularly relates to an SEA type thalassemia gene detection method based on nucleic acid index isothermal amplification and self-G-tetramer. The invention provides a technology for detecting SEA type thalassemia on the basis of taking a G-tetramer structure as a self-primer and combining a nucleic acid index isothermal amplification technology. The method can be used for detecting gene deletion of the SEA type thalassemia simply, sensitively and high-throughout. At present, a detection system of the SEA type thalassemia gene has been established based on the invention, and the lowest detection limit is about 2fM. The method can be applied to direct detection of other mutation sites of thalassemia.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for detecting SEA-type thalassemia genes based on nucleic acid exponential isothermal amplification and self-G-tetramer. Background Art

[0002] Thalassemia is the most widespread single-gene genetic disease in the world. The most effective way to reduce the birth rate of children with thalassemia is prenatal diagnosis, and clinical diagnosis of thalassemia must rely on genetic testing. At present, the methods used for genetic diagnosis of thalassemia mainly include restriction fragment length polymorphism linkage analysis (RFLP), probe dot hybridization technology (Allele-specific oligonucleotide, ASO), reverse dot hybridization method (Reverse dot hybridization RDB), cross-break site polymerase chain reaction (Gap PCR), amplification refractory mutation systems (ARMS), real-time fluorescence quantitative PCR (real-time PCR), single-stranded conformational polymorphism PCR (PCR-SSCP) combined with PCR, etc. [1,2] Among them, the genetic diagnostic methods for thalassemia that are commonly used in clinical practice and have been certified by the State Food and Drug Administration (SFDA) are gap-break site polymerase chain reaction (GapPCR) and polymerase chain reaction combined with reverse dot hybridization (PCR-RDB), which can detect the common deletion and non-deletion types of α-thalassemia and 17 common point mutations of β-thalassemia in the current population. PCR-RDB has gradually become the most commonly used diagnostic method in clinical practice due to its advantages such as accurate detection of thalassemia genes and small sample size. However, this method also has many disadvantages: (1) The test is time-consuming. The experimental process takes at least 2 days and is mainly manual. (2) It is difficult to achieve automation and the detection throughput is low: this technology has many manual operation steps, and two skilled testing technicians can only test a maximum of 80 specimens every two days, which cannot meet clinical needs at all, and also increases the labor cost of the laboratory department. (3) The testing instrument requirements are high, and expensive equipment such as high-precision PCR amplifiers are required. It cannot be routinely carried out in grassroots laboratories or remote areas. (4) α-thalassemia and β-thalassemia can only be tested separately: Current methods cannot detect both thalassemias simultaneously, thus doubling the workload and reducing efficiency. (5) Unstable results: Test results are often unstable due to multiple factors, including manual operation, DNA quantity and purity, PCR reaction system, hybridization membrane strips, and buffer solutions. They are also easily affected by ambient temperature and humidity. Therefore, developing a simple, convenient, economical, rapid, and high-throughput thalassemia gene detection technology is of great significance.

[0003] In recent years, isothermal amplification technology that does not rely on PCR gene amplifiers has received widespread attention. This method has low instrument requirements, and while maintaining high sensitivity and specificity, it is also highly resistant to inhibitors in the sample and has a short amplification time, which has the potential to achieve point-of-care testing (POCT). Currently, some isothermal amplification technologies have commercial products, such as loop-mediated isothermal amplification (LAMP). [3] , recombinase polymerase amplification (RPA) [4] , Isothermal exponential amplification reaction (EXPAR) [5] , Helicase-dependent amplification (HDA) [6] , Strand displacement amplification (SDA) [7] , Nucleic acid sequence-based amplification (NASBA) [8] , Rolling circle amplification (RCA) [9] Isothermal amplification technology has the advantages of accuracy, applicability for on-site detection, high amplification efficiency, and high sensitivity. It has been widely reported in the fields of rapid detection of pathogenic microorganisms such as environmental monitoring, food safety, and disease diagnosis. This indicates that these technologies are playing an increasingly important role in clinical applications.

[10] However, there are no relevant literature reports in the field of thalassemia detection.

[0004] References:

[0005] [1] Li Peng, Zhang Jie, et al. Research progress in genetic testing methods for thalassemia[J]. Chinese Journal of Maternal and Child Health, 2016, 3(4):891-894.

[0006] [2] Chen Li, Progress in laboratory diagnosis of thalassemia[J], World Latest Medical Information Digest, 2019, 19(58): 63-64.

[0007] [3]Notomi T,Okayama H,et al.Loop-mediated isothermal amplification ofDNA[J].Nucleic Acids Res,2000,28(12):E63.

[0008] [4]Piepenburg O,Williams C,Stemple D,et al.DNA detection usingrecombination proteins[J].PLoS Biol,2006,4(7):1115-1121.

[0009] [5]Van Ness J,Van Ness LK,Galas DJ.Isothermal reactions for theamplification of oligonucleotides[J].PNAS,2003,100(8):4504-4509.

[0010] [6]Vincent M,Xu Y,Kong H.Helicase-dependent isothermal DNAamplification[J].EMBO Reports,2004,5(8):795-800.

[0011] [7]Zhang L,Zhu G,Zhang C.Homogeneous and label-free detection ofmicroRNAs using bifunctional strand displacement amplification mediatedhyperbranched rolling circle amplification[J].Analytical Chemistry,2014,86(13):6703-6709.

[0012] [8]Compton J.Nucleic acid sequence-based amplification[J].Nature,1991,350(6313):91-92.

[0013] [9]Li N,Jablonowski C,Jin H,et al.Stand-alone rolling circleamplification combined with capillary electrophoresis for specific detectionof small RNA[J].Anal Chem,2009,81(12):4906.

[0014]

[10] Gao Weifang et al., Research progress of isothermal amplification technology and its combination with CRISPR in rapid detection of microorganisms [J]. Biotechnology Bulletin, 2020, 36(5): 22-31. Summary of the Invention

[0015] In order to solve the above technical problems, the present invention aims to develop a rapid thalassemia gene detection technology based on nucleic acid exponential isothermal amplification (EXPAR) technology and the characteristics of SEA thalassemia self-G-tetramer as a self-primer, combined with the microplate hybridization method, to establish a new technology suitable for population screening and on-site detection of SEA thalassemia genes.

[0016] The first aspect of the present invention aims to provide a probe for detecting the SEA thalassemia gene.

[0017] The purpose of the second aspect of the present invention is to provide the use of the probe of the first aspect of the present invention in the preparation of a product for detecting the SEA thalassemia gene.

[0018] The third aspect of the present invention is to provide a kit for detecting SEA thalassemia gene.

[0019] The fourth aspect of the present invention aims to provide a method for detecting SEA thalassemia gene.

[0020] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0021] The first aspect of the present invention provides a probe for detecting the SEA thalassemia gene.

[0022] G-tetramer structures can generate colorimetric, fluorescent, and chemiluminescent signals and are widely used in analytical detection, nanostructures, and logic gates. The present invention discovered that SEA thalassemia is characterized by a loss of 19,303 bases (AE006462.1) between 155,396 and 174,699 in region 1, band 3, subband 3 of the short arm of chromosome 16 (16p13.3). The breakpoint region (BPR) results in a new nucleic acid sequence (AE006462.1): ggggttcacttggggggcgccttggggaggttcacttggaggctgggg (SEQ ID NO: 14). This DNA contains four GGG repeats and can assemble into a G-quadruplex with catalytic activity similar to horseradish peroxidase. The nucleic acid near 155,396 and 174,699 on chromosome 16 in normal individuals or non-SEA-deletion thalassemia is only partially complementary to SEA-type nucleic acids. The upstream and downstream sequences of SEA-type nucleic acids are: WT1-1GGGTTCACTTGGGGGGCGCCTTGGGGAGGTTCTAGCCCCTGAGCACC (SEQ ID NO: 5) and WT2-1TAGTGCACACCTATGTCCCAGTTACTTGGAGGCTGGGGCAGGAGGAT (SEQ ID NO: 6). Neither contains a complete G-tetramer sequence. A G-tetramer is composed of a G-base-rich nucleic acid sequence that forms a unique spatial structure through Hoogsteen hydrogen bonding. Under certain conditions, this sequence can specifically bind to hemin, forming a G-tetramer-hemin complex. This complex exhibits catalytic activity similar to that of horseradish peroxidase, catalyzing the color development of reducing substrates such as 3,3',5,5'-tetramethylbenzidine (TMB).

[0023] Therefore, the present invention designs target sequences of different lengths based on this position. In some embodiments of the present invention, the optimal target sequence is GGGAGGTTCACTTGGAGGCTGGG (SEQ ID NO: 4), and a detection probe is designed based on this sequence.

[0024] In some embodiments of the present invention, the sequence of the probe is shown in SEQ ID NO: 1.

[0025] The principle diagram of the present invention is as follows Figure 1 The probe consists of four parts: blue, yellow-green, red, and black.

[0026] The blue sequence is ATTTTGACTC and CACTTGGAGGCTGGG, where CACTTGGAGGCTGGG is identical to the 5' end of the target. The yellow-green sequence is AACCTCCC, which is the recognition site for the nicking endonuclease Nt.BstNBI.

[0027] Among them, the red sequence is: TCCAAGTG, which serves to complement the 8 bases (AGGTTCAC) in the middle region of the target.

[0028] Among them, the black sequence is: CCCAGCC, which serves to complement the 7 bases (GGGTCGG) at the 5' end of the target.

[0029] The detection principle of the present invention is:

[0030] The breakpoint sequence of the SEA thalassemia gene contains G-rich repeats that can assemble into a G-tetramer with catalytic activity similar to horseradish peroxidase. Experimental verification identified an optimal sequence whose peroxidase activity could be specifically distinguished from that of the wild-type sequence. This optimal sequence was selected as the target sequence.

[0031] The hairpin probe is matched with the G-tetramer sequence connected to the breakpoint of the SEA thalassemia gene sequence, and the site of the clamp probe is developed by nicking enzyme cutting. The hairpin ring structure is reversely folded, and under the action of polymerase, amplified the single-stranded DNA containing G-tetramer identical to the target sequence, and the single-stranded DNA identical to the target sequence in the original sequence is replaced. The single-stranded DNA can serve as a self-primer to initiate new nicking, polymerization, chain conversion and open a new amplification cycle. This process is repeated to amplify a large amount of single-stranded DNA containing G-tetramer, amplify the signal, and realize the detection of the SEA thalassemia target gene. The entire experiment can be carried out on a pretreated 96-well microplate. Finally, only a common enzyme reader is needed for signal detection to realize visualization of the test results. High-throughput detection can be easily achieved in combination with an enzyme reader. The principle diagram is as follows Figure 1 shown.

[0032] The second aspect of the present invention provides use of the probe according to the first aspect of the present invention in the preparation of a product for detecting SEA thalassemia genes.

[0033] In some embodiments of the present invention, the product includes a reagent or a kit.

[0034] In some embodiments of the present invention, the kit further comprises a polymerase, a nicking enzyme, heme, a color development reagent, and a reaction buffer.

[0035] In some embodiments of the present invention, the polymerase includes Bst DNA polymerase and Taq DNA polymerase.

[0036] In some embodiments of the invention, the nicking enzyme comprises Nt.BstNBI enzyme.

[0037] In some embodiments of the present invention, the color developing reagent includes a color developing substrate and an oxidizing agent.

[0038] In some embodiments of the invention, the oxidizing agent comprises hydrogen peroxide.

[0039] In some embodiments of the present invention, the chromogenic substrate includes at least one of 3,3',5,5'-tetramethylbenzidine (TMB), 2,2'-hydrazine-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), 3,3'-diaminobenzidine (DAB), and o-phenylenediamine (OPD).

[0040] The third aspect of the present invention provides a kit for detecting SEA thalassemia gene, comprising the probe of the first aspect of the present invention.

[0041] In some embodiments of the present invention, the kit further comprises a polymerase, a nicking enzyme, heme, a color development reagent, and a reaction buffer.

[0042] In some embodiments of the present invention, the polymerase includes Bst DNA polymerase and Taq DNA polymerase.

[0043] In some embodiments of the invention, the nicking enzyme comprises Nt.BstNBI enzyme.

[0044] In some embodiments of the present invention, the color developing reagent includes a color developing substrate and an oxidizing agent.

[0045] In some embodiments of the invention, the oxidizing agent comprises hydrogen peroxide.

[0046] In some embodiments of the present invention, the chromogenic substrate comprises at least one of 3,3',5,5'-tetramethylbenzidine, 2,2'-hydrazine-bis(3-ethylbenzothiazoline-6-sulfonic acid), 3,3'-diaminobenzidine, and o-phenylenediamine.

[0047] A fourth aspect of the present invention provides a method for detecting a SEA thalassemia gene, comprising the following steps:

[0048] The probe described in the first aspect of the present invention is mixed with a test sample, a nicking enzyme, a polymerase, heme, and a reaction buffer, and reacted, and a color developing reagent is added for color development.

[0049] In some embodiments of the present invention, the color developing reagent includes a color developing substrate and an oxidizing agent.

[0050] In some embodiments of the invention, the oxidizing agent comprises hydrogen peroxide.

[0051] In some embodiments of the present invention, the chromogenic substrate comprises at least one of 3,3',5,5'-tetramethylbenzidine, 2,2'-hydrazine-bis(3-ethylbenzothiazoline-6-sulfonic acid), 3,3'-diaminobenzidine, and o-phenylenediamine.

[0052] In some embodiments of the present invention, the concentration of the probe is 50 nM to 1 μM.

[0053] In some embodiments of the present invention, the concentration of the polymerase is 0.08-0.32 U / μL.

[0054] In some embodiments of the present invention, the concentration of the nicking enzyme is 0.06-0.16 U / μL.

[0055] In some embodiments of the present invention, the concentration of heme is 1 to 100 μM.

[0056] In some embodiments of the present invention, the reaction temperature is 25-50°C, preferably 42°C.

[0057] In some embodiments of the present invention, the reaction time is 15 to 45 minutes, preferably 30 minutes.

[0058] The beneficial effects of the present invention are:

[0059] The present invention provides a probe for detecting the SEA thalassemia gene. The probe can be used as a self-primer based on the G-tetramer structure to perform nucleic acid exponential isothermal amplification detection, and has the following advantages:

[0060] (1) This SEA thalassemia detection method is easy to operate and can be used to directly detect SEA thalassemia samples. It can be completed in as little as 1 hour, and the reaction does not require a strict thermal cycling process.

[0061] (2) This SEA thalassemia detection method can complete the detection sensitively and quickly, and can be used in combination with an enzyme-linked microplate reader in grassroots laboratories.

[0062] (3) The present SEA thalassemia detection method is simple in design and only requires one primer hairpin to achieve isothermal amplification, whereas loop-mediated isothermal amplification similar to the present invention requires the design of multiple pairs of primers to achieve tandem repeat amplification of the target gene.

[0063] (4) This SEA thalassemia detection method has good specificity, is not easily affected by other nucleic acids, and can identify the gene deletion of SEA thalassemia.

[0064] (5) This method for detecting SEA-type thalassemia is feasible and highly sensitive, with a detection limit of 2 fM. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0066] Figure 1 Schematic diagram of the detection method of the present invention.

[0067] Figure 2 This is a G-tetramer activity detection diagram for detecting different lengths of the target thalassemia Southeast Asian deletion type (SEA) breakpoint junction sequence (target sequence), where A, B, and C are the target detection results of different lengths, and the "^" symbol represents the breakpoint position.

[0068] Figure 3 This is the result of T-SEA-3EXPAR amplification, where M: marker; 1: SEA-H4; 2: T-SEA-3; 3: SEA-H4, T-SEA-3; 4: SEA-H4, Bst DNA polymerase, Nt.BstNBI; 5: SEA-H4, Bst DNA polymerase; 6: SEA-H4, Nt.BstNBI; 7: SEA-H4, T-SEA-3, Bst DNA polymerase, Nt.BstNBI; 8: SEA-H4, T-SEA-3, Bst DNA polymerase; 9: SEA-H4, T-SEA-3, Nt.BstNBI.

[0069] Figure 4 The results show the effect of the deficiency of each component on the exponential isothermal amplification reaction when the final concentration of T-SEA-3 is 1 μM and the final concentration of SEA-H4 is 1 μM, where M: marker; 1: SEA-H4, T-SEA-3, Bst DNA polymerase, Nt.BstNBI; 2: SEA-H4, Bst DNA polymerase, Nt.BstNB; 3: SEA-H4, T-SEA-3, Bst DNA polymerase; 4: SEA-H4, T-SEA-3, Nt.BstNBI; 5: SEA-H4, WT1-3, Bst DNA polymerase, Nt.BstNBI; 6: SEA-H4, WT2-3, Bst DNA polymerase, Nt.BstNBI.

[0070] Figure 5Figure 2 shows the effect of component deletion on exponential isothermal amplification when the final concentration of T-SEA-3 is 10 nM and the final concentration of SEA-H4 is 500 nM. M: marker; 1: SEA-H4; 2: T-SEA-3; 3: WH1-3; 4: WH2-3; 5: SEA-H4, T-SEA-3; 6: SEA-H4, WH1-3; 7: SEA-H4, WH2-3; 8: SEA-H4, Bst DNA polymerase, Nt.BstNBI; 9: SEA-H4, T-SEA-3, Bst DNA polymerase, Nt.BstNBI; 10: SEA-H4, Bst DNA polymerase, Nt.BstNBI; 11: SEA-H4, T-SEA-3, Bst DNA polymerase; 12: SEA-H4, WT1-3, Bst DNA polymerase enzyme, Nt.BstNBI enzyme; 13: SEA-H4, WT2-3, Bst DNA polymerase enzyme, Nt.BstNBI enzyme.

[0071] Figure 6 is the effect of different amplification conditions on the amplified product, where A is the absorbance of the amplified product at different reaction temperatures (25°C, 37°C, 42°C, 50°C); B is the ratio of the absorbance of the amplified product to the negative control at different reaction temperatures (25°C, 37°C, 42°C, 50°C); C is the absorbance of the amplified product at different reaction times (15min, 30min, 45min); D is the ratio of the absorbance of the amplified product to the negative control at different reaction times (15min, 30min, 45min); E is the absorbance of the amplified product at different nicking enzyme concentrations (0.06U / μL, 0.1U / μL, 0.16U / μL) (3U, 5U and 8U); F is the absorbance of the amplified product at different nicking enzyme concentrations (0.06U / μL, 0.1U / μL, 0.16U / μL); G is the absorbance of the amplified product at different Hemin concentrations (1 μM, 2 μM, 4 μM); H is the ratio of the absorbance of the amplified product at different Hemin concentrations (1 μM, 2 μM, 4 μM) to the negative control; I is the absorbance of the amplified product at different polymerase concentrations (0.08 U / μL, 0.16 U / μL, 0.32 U / μL), i.e., (4 U, 8 U and 16 U); J is the ratio of the absorbance of the amplified product at different polymerase concentrations (0.08 U / μL, 0.16 U / μL, 0.32 U / μL), i.e., (4 U, 8 U and 16 U) to the negative control.

[0072] Figure 7This is the feasibility analysis result of the optimized reaction system.

[0073] Figure 8 This is the sensitivity analysis result.

[0074] Figure 9 The results of specificity analysis. DETAILED DESCRIPTION

[0075] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0076] The sequence information involved in the present invention is shown in Table 1.

[0077] Table 1

[0078]

[0079]

[0080] In Table 1, “ / ” indicates the position of the breakpoint.

[0081] Example 1 Detection of G-tetramer activity of different lengths of breakpoint junction sequences (target sequences) in thalassemia (SEA type)

[0082] 1. Experimental methods

[0083] The activity of synthesized oligonucleotide short chain template targets (T-SEA1, T-SEA2, T-SEA3) containing different numbers of bases was detected, and the experiments were grouped according to the different lengths of the target sequences. The wild-type group was set as the control. The experimental group was added with synthesized target oligonucleotide short chains (T-SEA1, T-SEA2, T-SEA3) + Hemin + TMB, and the wild-type control group was added with synthesized wild-type oligonucleotide short chain templates (WT1-1, WT2-1, WT1-2, WT2-2, WT1-3, WT2-3) + Hemin + TMB, without adding targets. Each group of experiments was repeated three times and the average was taken. The experimental steps are as follows:

[0084] (1) Take 10 μL of Hemin preservation solution and add 990 μL of ultrapure water to prepare a reaction solution with a final concentration of 100 μM.

[0085] (2) Take 5 μL of T-SEA1, T-SEA2, and T-SEA3 and add 995 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0086] (3) Take a clean eight-tube strip, place it on an ice box, and use a pipette to add the following reaction system: 1 μL of T-SEA or T-SEA2 or T-SEA3 or WT1-1 or WT2-1 or WT1-2 or WT2-2 or WT1-3 or WT2-3, 5 μL of Hemin reaction solution, and make up to 50 μL with ultrapure water.

[0087] (4) Place the eight-tube strips in a PCR instrument and incubate at 42°C for 30 minutes.

[0088] (5) After the reaction is complete, transfer the reaction solution to an ELISA reaction plate and sequentially add 50 μL of colorimetric solution A (containing at least 0.3 g / L peroxide) (Product No.: T117928) and colorimetric solution B (containing at least 0.2 g / L TMB) (Product No.: T820899). Incubate at room temperature for 15 min.

[0089] (6) Add 50 μL of stop solution (containing sulfuric acid at a concentration not higher than 2 M).

[0090] (7) Place the plate in a URIT-660 microplate reader, set the primary wavelength to 450 nm and the secondary wavelength to 630 nm, and perform colorimetry.

[0091] 2. Experimental results

[0092] like Figure 2 As shown in Figure A, the target sequence (T-SEA) has a single-stranded structure of (GGGN)×, which can produce significant G-tetramer activity, increasing the light absorption of the TMB substrate. At the same time, the wild-type sequences before and after the breakpoint sequence, upstream and downstream of the target sequence, and of the same length, also have G-tetramer activity. These wild-type sequences contain two (GGGN) and may form G-tetramers through double-stranded folding and assembly. In this example, the target sequence length is shortened to a (GGGN)× structure, and the upstream and downstream wild-type sequences are also shortened to the same length, as shown in Figure 1. Figure 2 As shown in B, the three sequences also produce the same G-tetramer activity. The reason why the two wild-type sequences produce G-tetramer activity may be that they are composed of (GGGN)× double-stranded structures. This example further shortens the target to 23 bases (such as Figure 2 C), resulting in a target sequence with only the (GGGN)× structure. In this case, only the SEA-type target sequence exhibits G-tetramer activity, while the upstream and downstream wild-type sequences are incapable of forming G-tetramers. Therefore, in this example, the 23-base T-SEA3 sequence was selected as the detection target, as it can specifically distinguish between SEA-type and wild-type sequences. Finally, a corresponding hairpin probe was designed and synthesized based on this target.

[0093] Example 2 Verification of the Effect of Component Deficiency on Exponential Isothermal Amplification

[0094] 1. Experimental methods

[0095] In this example, a hairpin probe, SEA-H4, was designed to recognize the optimal target. To further verify the feasibility of the amplification reaction and ensure efficient and specific amplification of the target product, grouping experiments were conducted based on the lack of each component in the system. Groups lacking one or two of the four components, T-SEA3, SEA-H4, DNA polymerase, and Nt.BstNBI, were set up. The following experiments were conducted using the same experimental conditions, including reaction temperature, reaction time, and experimental operator, for each experimental group.

[0096] (1) Annealing of hairpin probe SEA-H4: Place 500g of ice in a foam box, place an eight-tube rack on ice, and prepare the probe SEA-H4 to a final concentration of 1μM. The reaction system includes 1μL of 100μM hairpin probe, which is then diluted to a final concentration of 1μM; 89μL of DEPC-treated water; 10μL of 1× Cut Smart buffer, with a final concentration of 1× (50mM PotassiumAcetate, 20mM Tris-acetate, 10mM MagnesiumAcetate, 100μg / mL RecombinantAlbumin, pH 7.9, 25℃). After preparation, place the mixture on a PCR instrument and set the reaction program to 95℃, 10min, 0.1℃ / s, then reduce to 25℃ and place at room temperature for 60min. After the hairpin is treated in this way, store it at -20℃ for subsequent experiments.

[0097] (2) Take 10 μL of Hemin preservation solution and add 990 μL of ultrapure water to prepare a reaction solution with a final concentration of 100 μM.

[0098] (3) Take 5 μL of T-SEA3 and add 995 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0099] (4) Take 100 μL of the treated probe SEA-H4 and add 100 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0100] (5) Take a clean eight-tube strip, place it on an ice box, and use a pipette to add the following reaction system: 1× CutSmart buffer (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9) 5μL, T-SEA3 reaction solution 1μL, Hemin reaction solution 5μL, SEA-H4 reaction solution 5μL, DNA polymerase 1μL, 25mM dNTP 0.5μL, Nt.BstNBI 0.5μL, and make up to 50μL with ultrapure water.

[0101] (6) Place the eight-tube strips in a PCR instrument and incubate at 42°C for 30 minutes.

[0102] (7) Agarose gel electrophoresis verification: Weigh 0.9g NuSieve GTG and 0.3g agarose powder, add them to 1×TBE solution, place in a centrifuge to mix, melt in a microwave oven and wait for cooling. When cooled to 55℃~65℃, pour into a gel rack and then place it horizontally at room temperature for 15min, and then place in a 4℃ refrigerator to cool for 30min. After ensuring that the colloid is completely solidified, remove the comb and set aside.

[0103] (8) Sample loading: Take 8 μL of each reaction product, add 1 μL of NA-Red dye and 1 μL of 10× loading buffer. Electrophorese at 65V for 75 min in 1× TBE solution. After electrophoresis, place the sample on a chemiluminescence gel imaging system for scanning and imaging.

[0104] 2. Experimental results

[0105] from Figure 3 As can be seen, a clear amplification product is observed at the 10 bp position in lane 7, while no obvious amplification bands are observed in lanes 5, 6, 8, and 9. Lane 4, in which the amplification system includes SEA-H4, Bst DNA polymerase, and Nt.BstNBI, lacks the T-SEA target sequence, but an amplification product band is still observed, indicating that the self-priming EXPAR detection system can specifically amplify the T-SEA-3 target sequence but suffers from nonspecific interference.

[0106] Figure 4 、 Figure 5 The electrophoresis results of EXPAR amplification of different concentrations of T-SEA-3 and WT1-3, WT2-3 (refer to the experimental conditions above, the concentrations of T-SEA-3 and SEA-H4 were changed). Figure 4It can be seen that when the final concentration of T-SEA-3 is 1μM and the final concentration of SEA-H4 is 1μM, the complete amplification system containing the target sequence in lane 1 shows an obvious amplification band, but at the same time, the amplification system lacking the target sequence in lane 2 and the amplification system composed of two wild-type sequences in lanes 5 and 6 also have amplification products, confirming that under this condition, the self-primer EXPAR detection system can specifically amplify the T-SEA-3 target sequence but there is still non-specific interference. Figure 5 As can be seen, when the final concentration of T-SEA-3 was 10 nM and the final concentration of SEA-H4 was 500 nM, a clear amplification product was observed at the 10 bp position in lane 9, while no amplification product was observed in lanes 8 and 13 (WT2-3), and only a weak amplification product was observed in lane 12 (WT1-3). This indicates that under appropriate conditions, the wild-type strains WT1-3 and WT2-3 do not amplify, nor do they amplify when a single component is missing. Only the complete amplification system of the T-SEA-3 target sequence performs specific EXPAR amplification. This result confirms that exponential isothermal amplification is feasible and that SEA-type thalassemia gene detection can be achieved under appropriate concentrations of T-SEA-3 and SEA-H4.

[0107] Example 3 Effects of different amplification conditions including reaction temperature, reaction time, nicking enzyme and polymerase concentration on amplification products

[0108] In order to explore the effect of reaction temperature on the absorbance of amplified products, four temperature groups of 25°C, 37°C, 42°C, and 50°C were set in this example.

[0109] In order to explore the effect of reaction time on the absorbance of the amplified product, this example set up three groups of 15 min, 30 min, and 45 min.

[0110] In order to explore the effect of different polymerase concentrations on the absorbance of the amplified product, this example set up three groups: 0.08 U / μL, 0.16 U / μL, and 0.32 U / μL.

[0111] In order to explore the effect of different nicking enzyme concentrations on the absorbance of the amplified product, three groups of 0.06 U / μL, 0.10 U / μL, and 0.16 U / μL were set in this example.

[0112] In order to explore the effect of different hemin concentrations on the absorbance of the amplified product, three groups of 1 μM, 2 μM, and 4 μM were set in this example.

[0113] Each experiment was performed as follows, and the experiment was repeated three times. (1) Annealing of hairpin probe SEA-H4: Take 500g of ice in a foam box, place an eight-tube rack on ice, and prepare the probe SEA-H4 to a final concentration of 1μM. The reaction system includes 2μL of 100μM hairpin probe, with a final concentration of 1μM; 178μL of DEPC-treated water; 20μL of 10×Cut Smart buffer, with a final concentration of 1× (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9, 25℃). Dispense into eight tubes, 50μL per tube, and place on a PCR instrument after preparation. Set the reaction program to 95℃, 10min, 0.1℃ / s, reduce to 25℃, and place at room temperature for 60min. The hairpins were treated in this manner and stored at -20°C for subsequent experiments.

[0114] (2) Take 10 μL of Hemin preservation solution and add 990 μL of ultrapure water to prepare a reaction solution with a final concentration of 100 μM.

[0115] (3) Take 5 μL of T-SEA3 and add 995 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0116] (4) Take 200 μL of the treated probe SEA-H4 and add 200 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0117] (5) Take a clean eight-tube strip, place it on an ice box, and use a pipette to add the following reaction system: 1× CutSmart buffer (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9) 5μL, T-SEA3 reaction solution 1μL, Hemin reaction solution 5μL, SEA-H4 reaction solution 5μL, DNA polymerase 1μL, 25mM dNTP 0.5μL, Nt.BstNBI 0.5μL, and make up to 50μL with ultrapure water.

[0118] (6) Place the eight tubes in a PCR instrument and set the reaction temperature at 25°C, 37°C, 42°C, and 50°C for 30 minutes.

[0119] (7) After the reaction is complete, transfer the reaction solution to an ELISA reaction plate and sequentially add 50 μL of colorimetric solution A (containing no less than 0.3 g / L peroxide) and 50 μL of colorimetric solution B (containing no less than 0.2 g / L TMB). Incubate at room temperature for 15 min.

[0120] (8) Add 50 μL of stop solution (containing sulfuric acid at a concentration not higher than 2 M).

[0121] (9) Place the plate in a URIT-660 microplate reader, set the primary wavelength to 450 nm and the secondary wavelength to 630 nm, and perform colorimetry.

[0122] from Figure 6 It can be seen that the optimal amplification conditions are: polymerase 0.16U / μL, nicking enzyme 0.10U / μL, Hemin 2uM, amplification at 42°C for 30min.

[0123] Example 4 Optimized system test results

[0124] To explore the amplification effect of the reaction system, the experiment was carried out with the optimal reaction temperature, reaction time, hairpin probe and enzyme concentration under the condition that the final concentration of the target sequence (T-SEA3) was 100nM; that is, the hairpin probe concentration was 50nM, the polymerase was 0.16U / μL, the nicking enzyme was 0.10U / μL, and the hemin was 2uM. After amplification at 42°C for 30min, the absorbance of the obtained amplified product was detected in a microplate using a microplate reader. Ultrapure water was added to the negative control group. Each group of experiments was carried out according to the following steps, and the experiment was repeated three times.

[0125] (1) Annealing of hairpin probe SEA-H4: Place 500g of ice in a foam box, place an eight-tube rack on ice, and prepare the probe SEA-H4 to a final concentration of 1μM. The reaction system includes 5μL of 100μM hairpin probe, with a final concentration of 1μM; 445μL of DEPC-treated water; 50μL of 10×Cut Smart buffer, with a final concentration of 1× (50mM Potassium Acetate, 20mMTris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9, 25℃). Dispense into eight tubes, 50μL per tube. After preparation, place the mixture on a PCR instrument and set the reaction program to 95℃, 10min, 0.1℃ / s, then reduce to 25℃ and place at room temperature for 60min. After the hairpin is treated in this way, store it at -20℃ for subsequent experiments.

[0126] (2) Take 10 μL of Hemin preservation solution and add 990 μL of ultrapure water to prepare a reaction solution with a final concentration of 100 μM.

[0127] (3) Take 5 μL of T-SEA3 and add 995 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0128] (4) Take 200 μL of the treated probe SEA-H4 and add 200 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0129] (5) Take a clean eight-tube strip, place it on an ice box, and use a pipette to add the following reaction system: 1× CutSmart buffer (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9) 5μL, T-SEA3 reaction solution 1μL, Hemin reaction solution 5μL, SEA-H4 reaction solution 1μL / 5μL / 10μL, DNA polymerase 1μL, 25mM dNTP 0.5μL, Nt.BstNBI 0.5μL, and make up to 50μL with ultrapure water.

[0130] (6) Place the eight-tube strips in a PCR instrument and incubate at 42°C for 30 minutes.

[0131] (7) After the reaction is complete, transfer the reaction solution to an ELISA reaction plate and sequentially add 50 μL of colorimetric solution A (containing no less than 0.3 g / L peroxide) and 50 μL of colorimetric solution B (containing no less than 0.2 g / L TMB). Incubate at room temperature for 15 min.

[0132] (8) Add 50 μL of stop solution (containing sulfuric acid at a concentration not higher than 2 M).

[0133] (9) Place the plate in a URIT-660 microplate reader, set the primary wavelength to 450 nm and the secondary wavelength to 630 nm, and perform colorimetry.

[0134] Depend on Figure 7 It can be seen that the optimized reaction system can distinguish the target sequence from the negative control, indicating that this reaction system can realize the detection of SEA thalassemia gene.

[0135] Example 5 Sensitivity Test

[0136] To test the sensitivity of the detection system, the oligonucleotide target was diluted and added to the system. A nine-step gradient was established from 2fM to 200nM, with the concentrations set in ascending order: 2fM, 20fM, 200fM, 2pM, 20pM, 200pM, 2nM, 20nM, and 200nM. Ultrapure water was added to the negative control group (NC group). Each experiment was performed in triplicate according to the following steps.

[0137] (1) Annealing of hairpin probe SEA-H4: Place 500g of ice in a foam box, place an eight-tube rack on ice, and prepare the probe SEA-H4 to a final concentration of 1μM. The reaction system includes 2μL of 100μM hairpin probe, with a final concentration of 1μM; 178μL of DEPC-treated water; 20μL of 10×Cut Smart buffer, with a final concentration of 1× (50mM Potassium Acetate, 20mMTris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9, 25℃). Dispense into eight tubes, 50μL per tube. After preparation, place on a PCR instrument and set the reaction program to 95℃, 10min, 0.1℃ / s, reduce to 25℃, and place at room temperature for 60min. After the hairpin is treated in this way, store it at -20℃ for subsequent experiments.

[0138] (2) Take 10 μL of Hemin preservation solution and add 990 μL of ultrapure water to prepare a reaction solution with a final concentration of 100 μM.

[0139] (3) Take 5 μL of T-SEA3 and add 495 μL of ultrapure water to prepare a reaction solution with a final concentration of 1 μM. Dilute it in a 10-fold gradient to obtain reaction solutions with initial concentrations of 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM, 100 nM, and 1 μM.

[0140] (4) Take 200 μL of the treated probe SEA-H4 and add 200 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0141] (5) Take a clean eight-tube strip, place it on an ice box, and use a pipette to add the following reaction system: 10× CutSmart buffer, final concentration is 1× (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9) 5μL, each reaction concentration group T-SEA3 reaction solution 1μL, Hemin reaction solution 5μL, SEA-H4 reaction solution 5μL, DNA polymerase 1μL, 25mM dNTP 0.5μL, Nt.BstNBI 0.5μL, and ultrapure water to 50μL.

[0142] (6) Place the eight-tube strips in a PCR instrument and incubate at 42°C for 30 minutes.

[0143] (7) After the reaction is complete, transfer the reaction solution to an ELISA reaction plate and sequentially add 50 μL of colorimetric solution A (containing no less than 0.3 g / L peroxide) and 50 μL of colorimetric solution B (containing no less than 0.2 g / L TMB). Incubate at room temperature for 15 min.

[0144] (8) Add 50 μL of stop solution (containing sulfuric acid at a concentration not higher than 2 M).

[0145] (9) Place the plate in a URIT-660 microplate reader, set the primary wavelength to 450 nm and the secondary wavelength to 630 nm, and perform colorimetry.

[0146] This study tested different final concentrations of T-SEA3 sequence (200nM, 20nM, 2nM, 200pM, 20pM, 2pM, 200fM, 20fM, 2fM, 0fM) to investigate the detection sensitivity of this reaction system. The results of colorimetric analysis using a microplate reader showed that the absorbance of the experimental groups at different concentrations was significantly different from that of the negative control group (P < 0.05). The detection limit (LOD) of this method for T-SEA3 sequence was 2fM. Figure 8 .

[0147] Example 6 Specificity Test

[0148] This example analyzes the specificity of the detection system by synthesizing a panel of wild-type WT1, WT2, an α chain 3.7 deletion group, and a β chain 17 and 19 mutation group. Six experimental groups were used: T-SEA3 (SEQ ID NO: 4), WT1-1 (SEQ ID NO: 5), WT2-1 (SEQ ID NO: 6), α3.7 (SEQ ID NO: 11), βCD-17 (SEQ ID NO: 12), and βCD-19 (SEQ ID NO: 13). Ultrapure water was added to the negative control group (NC group). Each experiment was performed according to the following steps, and the experiment was repeated three times.

[0149] (1) Annealing of hairpin probe SEA-H4: Place 500g of ice in a foam box, place an eight-tube rack on ice, and prepare the probe SEA-H4 to a final concentration of 1μM. The reaction system includes 2μL of 100μM hairpin probe, with a final concentration of 1μM; 178μL of DEPC-treated water; 20μL of 10×Cut Smart buffer, with a final concentration of 1× (50mM Potassium Acetate, 20mMTris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9, 25℃). Dispense into eight tubes, 50μL per tube. After preparation, place on a PCR instrument and set the reaction program to 95℃, 10min, 0.1℃ / s, reduce to 25℃, and place at room temperature for 60min. After the hairpin is treated in this way, store it at -20℃ for subsequent experiments.

[0150] (2) Take 10 μL of Hemin preservation solution and add 990 μL of ultrapure water to prepare a reaction solution with a final concentration of 100 μM.

[0151] (3) Take 5 μL each of T-SEA, WT1, WT2, α3.7, βCD-17, and βCD-19 and add 995 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0152] (4) Take 200 μL of the treated probe SEA-H4 and add 200 μL of ultrapure water to prepare a reaction solution with a final concentration of 500 nM.

[0153] (5) Take a clean eight-tube strip, place it on an ice box, and use a pipette to add the following reaction system: 10× CutSmart buffer, final concentration is 1× (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / mL Recombinant Albumin, pH 7.9) 5μL, T-SEA, WT1, WT2, α3.7, βCD-17, βCD-19 reaction solution 1μL each, Hemin reaction solution 5μL, SEA-H4 reaction solution 5μL, DNA polymerase 1μL, 25mM dNTP 0.5μL, Nt.BstNBI 0.5μL, and make up to 50μL with ultrapure water.

[0154] (6) Place the eight-tube strips in a PCR instrument and incubate at 42°C for 30 minutes.

[0155] (7) After the reaction is complete, transfer the reaction solution to an ELISA reaction plate and sequentially add 50 μL of colorimetric solution A (containing no less than 0.3 g / L peroxide) and 50 μL of colorimetric solution B (containing no less than 0.2 g / L TMB). Incubate at room temperature for 15 min.

[0156] (8) Add 50 μL of stop solution (containing sulfuric acid at a concentration not higher than 2 M).

[0157] (9) Place the plate in a URIT-660 microplate reader, set the primary wavelength to 450 nm and the secondary wavelength to 630 nm, and perform colorimetry.

[0158] In this example, to evaluate the specificity of nucleic acid isothermal amplification technology for detecting T-SEA3 sequences, five template sequences were synthesized: wild-type WT1, WT2, α3.7 with the same α chain deletion as T-SEA3, βCD-17 and βCD-19 with the same thalassemia genotype as T-SEA3, and different hemoglobin chains. The absorbance of the final reaction product was measured using a microplate reader at a final concentration of 100 nM. The results showed that the absorbance value of the T-SEA3 group was significantly different from that of the negative control group (P < 0.05). Figure 9 Compared with the negative control group, the other five groups had no significant differences, P>0.05, see Figure 9 The results showed that the method of the present invention has good specificity.

Claims

1. A probe for detecting the SEA thalassemia gene, characterized by: The sequence of the probe is shown in SEQ ID NO:

1.

2. The probe according to claim 1, wherein: The probe specifically recognizes the target sequence as shown in SEQ ID NO:

4.

3. Use of the probe according to claim 1 or 2 in the preparation of a product for detecting SEA thalassemia gene.

4. The use according to claim 3, characterized in that: The products include reagents and test kits.

5. A kit for detecting SEA thalassemia gene, characterized by: Comprising the probe according to claim 1 or 2.

6. The kit according to claim 5, characterized in that: The kit also includes a polymerase, a nicking enzyme, heme, a color development reagent, and a reaction buffer.

7. The kit according to claim 6, wherein: The polymerase includes Bst DNA polymerase and Taq DNA polymerase; The nicking enzyme includes Nt.BstNBI enzyme.

8. A method for detecting SEA thalassemia gene, comprising the following steps: Mixing the probe according to claim 1 or 2 with a test sample, a nicking enzyme, a polymerase, heme, and a reaction buffer, reacting the mixture, and adding a color developing reagent for color development; The method is used for non-disease diagnosis or treatment purposes.

9. The method according to claim 8, characterized in that: The color developing reagent includes a color developing substrate and an oxidizing agent; The oxidant includes hydrogen peroxide; The color developing substrate includes at least one of 3,3',5,5'-tetramethylbenzidine, 2,2'-hydrazine-bis(3-ethylbenzothiazoline-6-sulfonic acid), 3,3'-diaminobenzidine, and o-phenylenediamine.

10. The method according to claim 8, characterized in that: The concentration of the probe is 50nM to 1μM; The concentration of the polymerase is 0.08 to 0.32 U / μL; The concentration of the nicking enzyme is 0.06-0.16 U / μL; The concentration of the hemoglobin is 1-100 μM.

Images