Breeding method of hypoxia-resistant grouper

Abstract

The invention discloses a breeding method of anti-hypoxia grouper, and belongs to the technical field of grouper breeding. The method comprises the steps of parent fish selection, hypoxia domestication, juvenile fish screening, SNP molecular marker assisted breeding and the like, and finally the hypoxia-resistant grouper variety is obtained. By means of the method, the grouper variety high in hypoxia resistance can be cultivated, the cultivation cost is reduced, and sustainable development of the grouper cultivation industry is promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of grouper breeding, and in particular relates to a breeding method for hypoxia-resistant grouper. Background Art

[0002] Grouper, a general term for fish of the genus Epinephelus in the family Serranidae, is a Perciformes species. Its delicious and nutritious meat is highly valued by consumers, and it occupies a vital position in the marine aquaculture industry. With the rapid development of grouper aquaculture, the scale of aquaculture has continued to expand, and high-density cage culture has become the mainstream. This has led to a growing concern about hypoxia during the aquaculture process. Hypoxia not only affects grouper growth, immunity, and reproductive performance, but in severe cases can also lead to mass mortality, resulting in significant economic losses for aquaculture operators. Hypoxia can cause a series of physiological changes in grouper. For example, respiratory rate increases significantly, increasing energy consumption and thus impacting growth and development. Hypoxia also weakens grouper's immune function, making them more susceptible to pathogens and various diseases. Furthermore, prolonged exposure to hypoxia can affect the texture and quality of grouper's meat, reducing its market value.

[0003] Currently, common methods for addressing hypoxia in aquaculture water include physical oxygenation and chemical oxygenation. Physical oxygenation involves injecting air or oxygen into the water using an aerator to increase the dissolved oxygen content. However, the use of aerators not only consumes a large amount of electricity, increasing aquaculture costs, but also, in some large aquaculture ponds or high-density aquaculture areas, the oxygenation effect is often difficult to achieve uniformly, resulting in localized areas of hypoxia. In addition, aerators may generate considerable noise during operation, disrupting the grouper's growth environment. Chemical oxygenation involves adding chemicals (such as sodium percarbonate and calcium peroxide) to the water. These chemicals decompose in the water to produce oxygen, thereby increasing the dissolved oxygen content. However, excessive use of chemical oxygenators may damage the aquatic ecosystem and affect the health of grouper. Long-term use may also result in residual chemical substances in the water, adversely affecting subsequent aquaculture.

[0004] Breeding hypoxia-tolerant grouper varieties is an effective way to address the root cause of hypoxia stress. However, traditional grouper breeding efforts have primarily focused on growth rate and disease resistance, with relatively little research on breeding for hypoxia resistance. Most existing farmed grouper varieties have not undergone systematic hypoxia resistance breeding, resulting in a lack of adequate resilience to low oxygen environments.

[0005] In summary, developing a method that can effectively breed hypoxia-resistant grouper has urgent practical significance for improving the economic benefits of the grouper farming industry, reducing losses caused by hypoxia, and promoting sustainable development. Summary of the Invention

[0006] In view of the shortcomings of the existing technology, the present invention aims to provide a method for breeding grouper that is resistant to hypoxia. Through a scientific and systematic breeding process, a grouper variety with strong resistance to hypoxia is cultivated, the survival ability, growth performance and reproductive performance of grouper in a hypoxic environment are improved, the breeding cost is reduced, and the economic losses caused by hypoxia are reduced.

[0007] The technical solutions of the present invention are as follows:

[0008] A method for breeding hypoxia-resistant grouper comprises the following steps:

[0009] S1, broodstock selection;

[0010] S2. Hypoxia acclimation: Place the broodstock in a hypoxia acclimation tank, reduce the dissolved oxygen concentration in the water to 3.0-3.5 mg / L, maintain hypoxia for at least 7 days, and select the broodstock that survive and have a small change in respiratory rate compared to before acclimation;

[0011] S3, fertilization and hatching: artificial insemination of male and female broodstock that have been acclimated to hypoxia, hatching of fertilized eggs and raising of seedlings;

[0012] S4. Juvenile screening: transfer the juveniles to a low-oxygen screening tank with a dissolved oxygen concentration of 3.5-4.0 mg / L, and select the juveniles that survive and swim normally;

[0013] S4. Molecular marker-assisted breeding: By detecting molecular markers related to grouper hypoxia resistance, grouper with hypoxia resistance advantages can be obtained;

[0014] The molecular markers are located at positions 66 and 248 of the sequence shown in SEQ ID NO. 1, and the genotypes of the two sites are homozygous TT and GG, respectively.

[0015] SEQ ID NO.1:

[0016] TGCCAGACATCGGGTCAGACAGATAACAGCGTCCCTGCAACACCACCCAGCAGTGTGTGGTCTT T ACGTCCAGAGGCGCTGAACTGTCGAAATGGCTGACAACAGAGATAAAGCCACCGATCAAATGAAGATATGGAAGGAGAGCAGGGTCTCCCAGAGGTCAGACACACTGACCACAGGGGCTGGCCATCCAGTGGGAGACAAGCTGAACCTGCAGACTGCAGGACCCAGGGGCCCTCTGCTGGT G

[0017] Preferably, in step S2, before hypoxia acclimation, the initial dissolved oxygen concentration in the water is 5.0-5.5 mg / L.

[0018] Preferably, in step S1, the broodstock selected are groupers with a healthy body, no obvious diseases and deformities, aged 3-5 years, and a weight above the average weight of fish of the same age of the species.

[0019] Preferably, in step S2, the rate of reduction of dissolved oxygen is 0.1 to 0.2 mg / L per day.

[0020] Preferably, the time for performing the hypoxia screening in step S4 is 48 to 72 hours.

[0021] Preferably, the hypoxia-dominant grouper obtained in step S4 is cultured to sexual maturity and then fertilized, hatched and raised to obtain a new generation of hypoxia-resistant grouper.

[0022] Preferably, the juvenile fish has a body length of not less than 2 cm when entering the hypoxia screening tank.

[0023] Preferably, in step S2, after the dissolved oxygen concentration drops to 3.0-3.5 mg / L, hypoxia is maintained for 7-10 days.

[0024] Preferably, the broodstock selected after the hypoxic acclimation in step S2 are: broodstock that survive and whose respiratory rate changes by less than 30% compared to that before acclimation.

[0025] Preferably, the grouper is grouper.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] The present invention provides a systematic method for breeding hypoxia-resistant grouper. The resulting grouper has a stronger tolerance to hypoxia, allowing it to survive and grow normally in water with lower dissolved oxygen concentrations, reducing the risk of mortality due to hypoxia. This method reduces reliance on physical and chemical oxygenation, lowers electricity consumption and chemical agent costs, and mitigates the environmental hazards associated with physical and chemical oxygenation, thereby improving the economic and social benefits of aquaculture. DETAILED DESCRIPTION

[0028] In order to enable those skilled in the art to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments.

[0029] Example 1: Breeding of hypoxia-tolerant grouper

[0030] Broodstock selection: 500 groupers (Plectropomus leopardus) were collected and preliminarily screened for candidate broodstock based on their robust build, absence of disease or deformity, age of 3-5 years, and above-average weight.

[0031] Hypoxia acclimation: Place candidate broodstock in a hypoxia acclimation tank with an initial dissolved oxygen concentration of 5.0-5.5 mg / L. Reduce the dissolved oxygen concentration by 0.2 mg / L daily until it reaches 3.0-3.5 mg / L and maintain for 7 days. Select broodstock that survive and whose respiratory rate changes by less than 30%.

[0032] Fertilization and hatching: artificial insemination of male and female broodstock that have been acclimated to low oxygen, hatching and raising seedlings.

[0033] Juvenile screening: When the juveniles reach 2 cm in length, they are transferred to a low-oxygen screening pool with a dissolved oxygen concentration of 3.5-4.0 mg / L. After 48 hours, the juveniles that survive and swim normally are selected.

[0034] Molecular assisted breeding: By detecting molecular markers related to the grouper's resistance to hypoxia, grouper with hypoxia resistance advantages can be obtained.

[0035] The molecular markers are located at positions 66 and 248 of the sequence shown in SEQ ID NO. 1, and the genotypes of the two sites are TT and GG respectively.

[0036] Example 2: Breeding of hypoxia-tolerant grouper

[0037] Broodstock selection: 500 groupers (Plectropomus leopardus) were collected and preliminarily screened for candidate broodstock based on their robust build, absence of disease or deformity, age of 3-5 years, and above-average weight.

[0038] Hypoxia acclimation: Place candidate broodstock in a hypoxia acclimation tank with an initial dissolved oxygen concentration of 5.0-5.5 mg / L. Reduce the dissolved oxygen concentration by 0.1 mg / L daily until it reaches 3.0-3.5 mg / L and maintain for 10 days. Select broodstock that survive and whose respiratory rate changes by less than 30%.

[0039] Fertilization and hatching: artificial insemination of male and female broodstock that have been acclimated to low oxygen conditions, and the fertilized eggs are hatched and raised as seedlings.

[0040] Juvenile screening: When the juveniles reach 2 cm in length, they are transferred to a low-oxygen screening pool with a dissolved oxygen concentration of 3.5-4.0 mg / L. After 48 hours, the juveniles that survive and swim normally are selected.

[0041] Molecular assisted breeding: By detecting molecular markers related to the grouper's resistance to hypoxia, grouper with hypoxia resistance advantages can be obtained.

[0042] The molecular markers are located at positions 66 and 248 of the sequence shown in SEQ ID NO. 1, and the genotypes of the two sites are TT and GG respectively.

[0043] Example 3: Breeding of hypoxia-tolerant grouper

[0044] Broodstock selection: 500 groupers (Plectropomus leopardus) were collected and preliminarily screened for candidate broodstock based on their robust build, absence of disease or deformity, age of 3-5 years, and above-average weight.

[0045] Hypoxia acclimation: Place candidate broodstock in a hypoxia acclimation tank with an initial dissolved oxygen concentration of 5.0-5.5 mg / L. Reduce the dissolved oxygen concentration by 0.2 mg / L daily until it reaches 3.0-3.5 mg / L and maintain for 7 days. Select broodstock that survive and whose respiratory rate changes by less than 30%.

[0046] Fertilization and hatching: artificial insemination of male and female broodstock that have been acclimated to low oxygen conditions, and the fertilized eggs are hatched and raised as seedlings.

[0047] Juvenile screening: When the juveniles reach 2 cm in length, they are transferred to a low-oxygen screening pool with a dissolved oxygen concentration of 3.5-4.0 mg / L. After 72 hours, the juveniles that survive and swim normally are selected.

[0048] Molecular assisted breeding: By detecting molecular markers related to the grouper's resistance to hypoxia, grouper with hypoxia resistance advantages can be obtained.

[0049] The molecular markers are located at positions 66 and 248 of the sequence shown in SEQ ID NO. 1, and the genotypes of the two sites are TT and GG respectively.

[0050] Comparative Example 1:

[0051] In this comparative example, SNP molecular marker-assisted breeding was not performed.

[0052] Broodstock selection: 500 groupers (Plectropomus leopardus) were collected and preliminarily screened for candidate broodstock based on their robust build, absence of disease or deformity, age of 3-5 years, and above-average weight.

[0053] Hypoxia acclimation: Place candidate broodstock in a hypoxia acclimation tank with an initial dissolved oxygen concentration of 5.0-5.5 mg / L. Reduce the dissolved oxygen concentration by 0.2 mg / L daily until it reaches 3.0-3.5 mg / L and maintain for 7 days. Select broodstock that survive and whose respiratory rate changes by less than 30%.

[0054] Fertilization and hatching: artificial insemination of male and female broodstock that have been acclimated to low oxygen conditions, and the fertilized eggs are hatched and raised as seedlings.

[0055] Juvenile screening: When the juveniles reach 2 cm in length, they are transferred to a low-oxygen screening pool with a dissolved oxygen concentration of 3.5-4.0 mg / L. After 48 hours, the juveniles that survive and swim normally are selected.

[0056] Comparative Example 2:

[0057] In this comparative example, the genotypes of the molecular markers are AA and CC.

[0058] Broodstock selection: 500 groupers (Plectropomus leopardus) were collected and preliminarily screened for candidate broodstock based on their robust build, absence of disease or deformity, age of 3-5 years, and above-average weight.

[0059] Hypoxia acclimation: Place candidate broodstock in a hypoxia acclimation tank with an initial dissolved oxygen concentration of 5.0-5.5 mg / L. Reduce the dissolved oxygen concentration by 0.2 mg / L daily until it reaches 3.0-3.5 mg / L and maintain for 7 days. Select broodstock that survive and whose respiratory rate changes by less than 30%.

[0060] Fertilization and hatching: artificial insemination of male and female broodstock that have been acclimated to low oxygen conditions, and the fertilized eggs are hatched and raised as seedlings.

[0061] Juvenile screening: When the juveniles reach 2 cm in length, they are transferred to a low-oxygen screening pool with a dissolved oxygen concentration of 3.5-4.0 mg / L. After 48 hours, the juveniles that survive and swim normally are selected.

[0062] Molecular assisted breeding: By detecting molecular markers related to the grouper's resistance to hypoxia, grouper with hypoxia resistance advantages can be obtained.

[0063] The molecular markers are located at positions 66 and 248 of the sequence shown in SEQ ID NO. 1, and the genotypes of the two sites are AA and CC respectively.

[0064] Comparative Example 3

[0065] In this comparative example, hypoxia acclimation was not performed.

[0066] Broodstock selection: 500 groupers (Plectropomus leopardus) were collected and preliminarily screened for candidate broodstock based on their robust build, absence of disease or deformity, age of 3-5 years, and above-average weight.

[0067] Fertilization and hatching: Artificial insemination of male and female broodstock is performed, and the fertilized eggs are hatched and raised into seedlings.

[0068] Juvenile screening: When the juveniles reach 2 cm in length, they are transferred to a low-oxygen screening pool with a dissolved oxygen concentration of 3.5-4.0 mg / L. After 48 hours, the juveniles that survive and swim normally are selected.

[0069] Molecular assisted breeding: By detecting molecular markers related to the grouper's resistance to hypoxia, grouper with hypoxia resistance advantages can be obtained.

[0070] The molecular markers are located at positions 66 and 248 of the sequence shown in SEQ ID NO. 1, and the genotypes of the two sites are TT and GG respectively.

[0071] Evaluation of grouper's hypoxia tolerance:

[0072] The grouper population selected in the embodiment or comparative example was evaluated for its anti-hypoxia performance after it grew to one year old. Test groups with dissolved oxygen concentrations of 3.5 mg / L, 4.0 mg / L and 4.5 mg / L, and a control group with a dissolved oxygen concentration of 5.0 mg / L were set respectively. The experimental temperature was 30±2°C, 3 replicates were set for each group, 100 groupers were placed in each replicate, the test period was 15 days, and the mortality rate of the grouper was recorded.

[0073] Table 1 Hypoxia mortality (mean ± sample standard deviation)

[0074]

[0075] The results showed that, compared with the control group, the groupers selected in each group of the embodiment had good resistance to hypoxia. When the dissolved oxygen concentration in water was as low as 3.5 mg / L, they could still survive well for a certain period of time, and the hypoxia mortality rate was as low as about 10%, which was significantly lower than the mortality rate of the control group.

[0076] Furthermore, the grouper varieties bred in each example were conventionally cultured until sexual maturity, after which male and female broodstock were removed for fertilization, hatching, and seedling rearing to obtain a new generation of grouper. The aforementioned hypoxia tolerance evaluation of this new generation of grouper showed that it still had a high hypoxia tolerance, as shown in Table 2.

[0077] Table 2

[0078]

[0079] The specific implementation methods described above are only some embodiments of the present invention and are not intended to limit the present invention. Any equivalent substitutions, improvements, etc. made by those skilled in the art within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for breeding hypoxia-resistant grouper, characterized in that: The following steps are involved: S1, broodstock selection; S2. Hypoxia acclimation: Place the broodstock in a hypoxia acclimation tank, reduce the dissolved oxygen concentration in the water to 3.0-3.5 mg / L, maintain hypoxia for at least 7 days, and select the broodstock that survive and have a small change in respiratory rate compared to before acclimation; S3, fertilization and hatching: artificial insemination of male and female broodstock that have been acclimated to hypoxia, hatching of fertilized eggs and raising of seedlings; S4. Juvenile screening: transfer the juveniles to a low-oxygen screening tank with a dissolved oxygen concentration of 3.5-4.0 mg / L, and select the juveniles that survive and swim normally; S4. Molecular marker-assisted breeding: By detecting molecular markers related to grouper hypoxia resistance, grouper with hypoxia resistance advantages can be obtained; The molecular markers are located at positions 66 and 248 of the sequence shown in SEQ ID NO. 1, and the genotypes of the two sites are TT and GG respectively.

2. The breeding method according to claim 1, characterized in that: In step S2, before hypoxia acclimation, the initial dissolved oxygen concentration in the water is 5.0-5.5 mg / L.

3. The breeding method according to claim 1, characterized in that: In step S1, the selected broodstock are groupers with a healthy body, no obvious diseases and deformities, aged 3-5 years, and a weight above the average weight of fish of the same age of the species.

4. The breeding method according to claim 1, characterized in that: In step S2, the rate of reduction of dissolved oxygen is 0.1 to 0.2 mg / L per day.

5. The breeding method according to claim 1, characterized in that: The time for the hypoxia screening in step S4 is 48 to 72 hours.

6. The breeding method according to claim 1, characterized in that: The hypoxia-dominant grouper obtained in step S4 is cultured until sexual maturity, and then fertilized, hatched and raised to obtain a new generation of hypoxia-resistant grouper.

7. The breeding method according to claim 1, characterized in that: The body length of juvenile fish should not be less than 2cm when they enter the hypoxia screening tank.

8. The breeding method according to claim 1, characterized in that: In step S2, after the dissolved oxygen concentration drops to 3.0-3.5 mg / L, hypoxia is maintained for 7-10 days.

9. The breeding method according to claim 1, characterized in that: The broodstock selected after the hypoxic acclimation in step S2 are: broodstock that survive and whose respiratory rate changes by less than 30% compared to that before acclimation.

10. The breeding method according to claim 1, characterized in that: The grouper is grouper.

Images