Function and application of small protein PoxTMA7

By screening and verifying the small protein PoxTMA7 and its encoding genes, the synthesis of Penicillium oxalate cellulase and xylanase was regulated, and the problem of low yield of plant polysaccharide degradation enzymes was solved, and efficient improvement in cellulase and xylanase yields were achieved, supporting the high-value utilization of plant biomass.

CN120535595APending Publication Date: 2025-08-26GUANGXI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510669943.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

In the prior art, the yield of filamentous fungal plant polysaccharide degradation enzymes is low and the cost is high, which limits the large-scale application of plant biomass biological refining, especially in translation regulation.

Method used

By screening and verifying the small protein PoxTMA7 and its encoding genes, the synthesis of Penicillium oxalate cellulase and xylanase was regulated, and the PoxTMA7 encoding gene was knocked out in the Penicillium oxalate ΔPoxKu70 strain was used to construct a recombinant strain, which affected the translation efficiency of cellulase and xylanase.

Benefits of technology

The production of cellulase and xylanase under crystalline cellulose-induced conditions has been significantly improved, providing an efficient genetically engineered strain construction scheme for plant polysaccharide degradation enzymes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005416083530000011
    Figure HDA0005416083530000011
  • Figure HDA0005416083530000012
    Figure HDA0005416083530000012
  • Figure HDA0005416083530000013
    Figure HDA0005416083530000013
Patent Text Reader

Abstract

The invention discloses a small protein PoxTMA7, which has an amino acid sequence as shown in SEQ. ID. NO.1. The invention also discloses a preparation method of the small protein PoxTMA7. In addition, an encoding gene of the small protein PoxTMA7 is also obtained, and the encoding gene has a base sequence of SEQ. ID. Researches show that the PoxTMA7 plays an important role in the translation stage of biosynthesis of the Penicillium oxalicum plant polysaccharide degrading enzyme, and under the condition of induced culture of crystalline cellulose, the PoxTMA7 influences the production of cellulase and xylanase by regulating the translation efficiency of key cellulase and xylanase genes cbh1, cbh2, eg1 and xyn11A. Therefore, the small protein PoxTMA7 or the coding gene thereof has application potential in influencing the generation of plant polysaccharide degrading enzymes or regulating the translation of related genes, and can be used for regulating the yield of cellulase and xylanase of microorganisms. In addition, identification and excavation of the regulatory factor for the translation efficiency of the Penicillium oxalicum plant polysaccharide degrading enzyme have theoretical guiding significance for constructing an engineering strain for high-yield plant polysaccharide degrading enzyme.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial genetic engineering, and in particular relates to the function and application of a small protein PoxTMA7. Background Art

[0002] Agricultural waste, such as corn stover, rice straw, and sugarcane bagasse, is rich in plant biomass, and its high-value utilization in biorefining is of great significance for the green and sustainable development of agriculture. Plant-polysaccharide-degrading enzymes (PPDEs), such as cellulases and xylanases, secreted by filamentous fungi, can hydrolyze plant biomass into fermentable monosaccharides such as glucose and xylose, which are then converted into high-value-added products. However, the low production and high cost of filamentous fungal PPDEs limit the large-scale application of plant biorefining. Penicillium oxalicum secretes a complete plant polysaccharide-degrading enzyme system and exhibits higher β-glucosidase activity than Trichoderma reesei, thus showing great potential for industrial application.

[0003] The production of polysaccharide-degrading enzymes in filamentous fungi is tightly regulated at multiple levels, including transcription, translation, protein folding, and processing. To date, most research, both domestically and internationally, has focused on the transcriptional regulation of polysaccharide-degrading enzyme genes. However, little research has been conducted on the translational regulation of polysaccharide-degrading enzyme mRNAs. Therefore, identifying key regulatory factors that control the biosynthesis of polysaccharide-degrading enzymes in filamentous fungi at the translational level could provide new targets for constructing genetically engineered strains that produce high-yield polysaccharide-degrading enzymes. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide the function and application of a small protein PoxTMA7.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0006] The small protein PoxTMA7 has the amino acid sequence of SEQ.ID.NO.1.

[0007] The above-mentioned small protein PoxTMA7 is derived from Penicillium oxalicum.

[0008] The gene encoding the small protein PoxTMA7 has the base sequence of SEQ.ID.NO.3.

[0009] The application of the above-mentioned small protein PoxTMA7 or the encoding gene in regulating the synthesis process of Penicillium oxalicum cellulase and xylanase.

[0010] The regulation is to regulate the production of cellulase and xylanase under the conditions of crystal cellulose induction culture of Penicillium oxalicum.

[0011] Regulation is achieved by regulating the expression of related genes; the related genes include: cellulase genes cbh1, cbh2, eg1, and xylanase gene xyn11A.

[0012] The recombinant microorganism is prepared by introducing a biological element that inhibits the expression of the gene encoding the small protein PoxTMA7 into the microorganism.

[0013] The biological element for inhibiting the expression of the gene encoding the small protein PoxTMA7 is a gene knockout cassette, which has the base sequence of SEQ.ID.NO.4.

[0014] The above-mentioned recombinant microorganism is a recombinant strain obtained by knocking out the gene encoding the small inhibitory protein PoxTMA7 of Penicillium oxalicum ΔPoxKu70 as the starting strain.

[0015] Through multi-omics combined analysis, construction of deletion mutants and complementation strains, and determination of cellulase and xylanase production, the inventors obtained a small protein, PoxTMA7, with the amino acid sequence of SEQ.ID.NO.1. Furthermore, the gene encoding the small protein PoxTMA7 was also obtained, with the base sequence of SEQ.ID.NO.3. Studies have shown that PoxTMA7 plays an important role in the translation phase of the biosynthesis of plant polysaccharide-degrading enzymes from Penicillium oxalicum. Under crystalline cellulose-induced culture conditions, PoxTMA7 influences the production of cellulase and xylanase by regulating the translation efficiency of key cellulase and xylanase genes, cbh1, cbh2, eg1, and xyn11A. Therefore, the small protein PoxTMA7 or its encoding gene of the present invention has application potential in influencing the production of plant polysaccharide-degrading enzymes or regulating the translation of related genes, and can be used to regulate the production of cellulase and xylanase in microorganisms. Furthermore, the identification and discovery of regulatory factors for the translation efficiency of plant polysaccharide-degrading enzymes from Penicillium oxalicum provides theoretical guidance for the construction of engineered strains that produce high-yield plant polysaccharide-degrading enzymes. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a graph showing the PCR verification results of the mutant strain ΔPoxTMA7 of Penicillium oxalicum. In the figure: a is the PCR verification of PoxTMA7, b is the left crossover, and c is the right crossover verification; lane M is a 1kb DNA ladder, lanes 1-3 are three transformants of the mutant strain ΔPoxTMA7, lane 4 is ΔPoxKu70, and lane 5 is ddH2O.

[0017] Figure 2This is a graph showing the PCR verification results of the complementation strain CPoxTMA7 of Penicillium oxalicum. In the figure: a is the PCR verification of the target gene POX_4g05775 at the insertion site, b is the left cross-validation, c is the right cross-validation, and d is the verification of PoxTMA7; lane M is a 1kb DNA ladder, lanes 1-3 are three transformants of the complementation strain CPoxTMA7, lane 4 is ΔPoxTMA7, and lane 5 is ddH2O.

[0018] Figure 3 This is a graph showing the production of filter paper cellulase (FPase) on the second and fourth days of culture of the starting strain ΔPoxKu70, the mutant strain ΔPoxTMA7 and the complemented strain of Penicillium oxalicum under crystalline cellulose induction conditions.

[0019] Figure 4 This is a graph showing the carboxymethyl cellulase (CMCase) production results of the starting strain ΔPoxKu70, the mutant strain ΔPoxTMA7 and the complemented strain of Penicillium oxalicum on the second and fourth days of culture under crystalline cellulose induction conditions.

[0020] Figure 5 This is a graph showing the β-glucosidase (pNPGase) production results of the starting strain ΔPoxKu70, the mutant strain ΔPoxTMA7 and the complemented strain of Penicillium oxalicum on the second and fourth days of culture under crystalline cellulose induction conditions.

[0021] Figure 6 This is a graph showing the xylanase production results of the starting strain ΔPoxKu70, the mutant strain ΔPoxTMA7 and the complemented strain of Penicillium oxalicum on the second and fourth days of culture under crystalline cellulose induction conditions.

[0022] Figure 7 This is a graph showing the test results of the translation efficiency of key cellulase and xylanase genes of the starting strain ΔPoxKu70 and the mutant strain ΔPoxTMA7 of Penicillium oxalicum after being cultured under crystalline cellulose induction conditions for 48 hours. In the figure: a.cbh1, b.cbh2, c.eg1, d.xyn11A. DETAILED DESCRIPTION

[0023] The following examples illustrate how to implement the present invention. Unless otherwise specified, all experimental methods used are conventional methods, all test materials used are purchased from conventional biochemical reagent companies, and all test data are obtained by setting three biological replicates and taking the average of the results.

[0024] Main experimental materials:

[0025] Penicillium oxalicum strain HP7-1: Reference: Zhao S, Yan YS, He QP, et al. Comparative genomic, transcriptomic, and secretomic profiling of Penicillium oxalicum HP7-1 and its cellulase and xylanase hyper-producing mutant EU2106, and identification of two novel regulatory genes of cellulase and xylanase gene expression [J]. Biotechnol Biofuels 2016, 9: 203. Penicillium oxalicum HP7-1 is referred to in the literature as "Penicillium oxalicum strain HP7-1" and is also available from Guangxi University. Penicillium oxalicum strain HP7-1 is deposited in the China General Microorganism Collection Center with the deposit number CGMCC NO:10781; application literature: Li CX, Liu L, Zhang T, Luo XM, Feng JX, Zhao S. Three-Dimensional Genome Map of the Filamentous Fungus Penicillium oxalicum[J]. Microbiol Spectr 2022, 10(3):e0212121.

[0026] To construct an efficient genetic manipulation system for Penicillium oxalicum, we knocked out the PoxKu70 gene in the wild-type strain HP7-1 to generate the highly efficient genetic manipulation strain ΔPoxKu70. ΔPoxKu70 was used as the starting strain in subsequent studies. This mutant strain, designated ΔPoxKu70, and the detailed steps for knocking out the PoxKu70 gene are described in the following literature: Zhao S, Yan YS, He QP, et al. Comparative genomic, transcriptomic, and secretomic profiling of Penicillium oxalicum HP7-1 and its cellulase and xylanase hyper-producing mutant EU2106, and identification of two novel regulatory genes of cellulase and xylanase gene expression [J]. Biotechnol Biofuels 2016, 9:203. The ΔPoxKu70 mutant strain is referred to as "mutant ΔPoxKu70" in the literature. The mutant ΔPoxKu70 of Penicillium oxalicum was deposited in the China General Microbiological Collection with the accession number CGMCC NO: 3.15650. The application literature: Ning YN, Liang X, Shen X, Tian D, Li WT, Luo XM, Feng JX, Zhao SA RsrC-RsrA-RsrB transcriptional circuit positively regulates polysaccharide-degrading enzyme biosynthesis and development in Penicilliumoxalicum[J]. Commun Biol. 7(1): 848., which is also available to the public from Guangxi University.

[0027] Plasmid pTi-Flp / frt: The literature that records the pTi-Flp / frt sequence and its use for gene knockout in Penicillium oxalicum is: LinYY, Zhao S, Lin X, et al. Improvement of cellulase and xylanase production in Penicillium oxalicum under solid-state fermentation by flippase recombination enzyme / recognition target-mediated genetic engineering of transcription repressors[J]. Bioresource Technol. 2021 337: 125366; Flp - G418-frt is referred to in the literature as “FLP / FRT” and is publicly available from Guangxi University.

[0028] Plasmid pCPXG418: Reference: Chen MM, Jiang MG, Shang JJ, et al. CYP1, ahypovirus-regulated cyclophilin, is required for virulence in the chestnutblight fungus[J]. Mol Plant Pathol. 2011, 12(3): 239-246; plasmid pCPXG418 is referred to in the literature as “transformation vector pCPXG418” and is available to the public from Guangxi University.

[0029] PDA medium: Weigh 7.8 g of commercial PDA powder and dissolve it in 200 mL of deionized water. Sterilize at 121°C for 20 minutes and set aside.

[0030] Complete medium (CM): Weigh 10 g glucose, 2 g peptone, 1 g yeast extract, and 1 g acid-hydrolyzed casein, add deionized water and mix thoroughly. Add 50 mL 20-nitrogen nitrate and 1 mL trace elements, adjust the pH to 6.5, and make up to 1 L. Sterilize at 115°C for 20 minutes before use.

[0031] OCM medium: Weigh 1 g of acid-hydrolyzed casein and 1 g of yeast extract and dissolve them in 1 L of deionized water. Aliquot and add 1 g of agar and 17.1 g of sucrose to every 50 mL of the stock solution. Sterilize at 115°C for 20 minutes before use.

[0032] Glucose medium: Weigh 4 g potassium dihydrogen phosphate, 4 g ammonium sulfate, 0.6 g calcium chloride, 0.6 g magnesium sulfate heptahydrate, and 10 g glucose, add deionized water, pipette 100 μL of trace elements, mix well, adjust the pH to 5.5, dispense into 100 mL bottles, and sterilize at 115°C for 20 minutes before use.

[0033] Crystalline cellulose medium: Weigh 4 g potassium dihydrogen phosphate, 4 g ammonium sulfate, 0.6 g calcium chloride, and 0.6 g magnesium sulfate heptahydrate, add deionized water, and pipette 100 μL of trace elements, mix thoroughly, adjust the pH to 5.5, dispense into 100 mL bottles, add 1 g Avicel, and sterilize at 121°C for 20 minutes before use.

[0034] 0.2% (v / v) Tween-80 solution: Dissolve 2 mL of Tween-80 in 1 L of deionized water and sterilize at 121°C for 20 minutes.

[0035] Trace element solution: Weigh 2.5 g of ferrous sulfate heptahydrate, 0.8 g of manganese sulfate monohydrate, 0.9 g of zinc chloride, and 1 g of cobalt chloride, and add deionized water to make up to 1 L.

[0036] Fungal DNA extraction solution: Weigh 4.8 g of tris (hydroxymethyl)aminomethane (Tris), 2.8 g of sodium acetate trihydrate, 3.8 g of disodium ethylenediaminetetraacetate, and 10 g of sodium dodecylsulfonate (SDS), add deionized water, stir, adjust the pH to 8.0, and adjust the volume to 1 L.

[0037] 0.6M magnesium sulfate heptahydrate: Weigh 147.9 g of magnesium sulfate heptahydrate and add deionized water to 1 L.

[0038] 1M disodium hydrogen phosphate: Weigh 141.9 g of disodium hydrogen phosphate and dilute to 1 L with deionized water.

[0039] OM buffer: Weigh 296.2 g of magnesium sulfate heptahydrate and 1.2 g of sodium dihydrogen phosphate, add deionized water, mix well, adjust the pH to 5.8 with 1 M sodium dihydrogen phosphate solution, make up to 1 L, and sterilize at 121°C for 20 minutes.

[0040] Fungal cell wall enzymatic hydrolysate: Weigh 0.3 g of snail enzyme, 0.2 g of lysozyme, and 0.5 g of VinoTaste Pro, respectively, and dissolve in 50 mL of OM buffer. Mix thoroughly at 180 rpm and 28°C for 30 minutes. Centrifuge at 4°C and 4800 rpm for 10 minutes, remove the supernatant, and filter-sterilize for later use.

[0041] Trapping buffer: Weigh 72.9 g sorbitol and 12.2 g Tris, add deionized water to 1 L, and sterilize at 121°C for 20 minutes.

[0042] 1M sorbitol: Weigh 182.2 g of sorbitol and dilute to 1 L with deionized water. Sterilize at 121°C for 20 minutes.

[0043] STC: Weigh 182.2 g sorbitol, 12.2 g Tris, and 11.2 g calcium chloride, add deionized water, mix well, adjust the pH to 8.0, dilute to 1 L, and sterilize at 121°C for 20 minutes.

[0044] PTC: Weigh 400.0 g polyethylene glycol 3350, 12.0 g Tris, and 15.2 g calcium chloride, add deionized water, mix well, adjust the pH to 8.0, dilute to 1 L, and sterilize at 121°C for 20 minutes.

[0045] 0.2M disodium hydrogen phosphate solution: Weigh 28.4g disodium hydrogen phosphate and dissolve it in 1L deionized water. Mix well and set aside.

[0046] Citric acid-disodium hydrogen phosphate buffer (pH 5.0): Measure 450 mL of 0.1 M citric acid solution and 450 mL of 0.2 M disodium hydrogen phosphate solution, adjust the pH to 5.0, and sterilize at 121°C for 20 minutes before use.

[0047] 1% CMC solution: Weigh 1g of medium-viscosity CMC and dissolve it in 100mL of citric acid-disodium hydrogen phosphate buffer (pH 5.0), mix well, and place in a refrigerator at 4℃ until used;

[0048] 1% xylan solution: Weigh 1 g of Beechwood xylan and dissolve it in 100 mL of citric acid-sodium hydrogen phosphate buffer (pH 5.0). Mix well and store in a refrigerator at 4°C until ready to use.

[0049] 25 mM p-NPG solution: Weigh 150.6 g p-NPG and dissolve it in 20 μL deionized water. After filtration and sterilization, aliquot and store in a -20°C refrigerator until use.

[0050] 0.4M sodium carbonate solution: Weigh 42.4g of sodium carbonate, add deionized water, mix well, and dilute to 1L;

[0051] Fungal protein extract: Weigh 8.5g sodium chloride, 2.2g disodium hydrogen phosphate, and 0.2g sodium dihydrogen phosphate, add deionized water, mix well, and dilute to 1L for later use;

[0052] DNS: Weigh 0.5 g of anhydrous sodium sulfite, 10 g of 3,5-dinitrosalicylic acid, 200 g of potassium sodium tartrate tetrahydrate, 20 g of sodium hydroxide, and 2 g of redistilled phenol, add 1 L of deionized water, mix well, filter, protect from light, and let stand for one week before use;

[0053] 1M Tris-HCl (pH 8.0): Weigh 121.16 g Tris, add deionized water, mix well, adjust the pH to 8.0, and dilute to 1 L.

[0054] 1M KCl: Weigh 74.55 g KCl and dilute to 1 L with deionized water. Mix thoroughly and set aside.

[0055] 1M MgCl2: Weigh 95.21 g MgCl2 and dilute to 1 L with deionized water. Mix thoroughly and set aside.

[0056] 10% sodium deoxycholate solution: Weigh 1g of sodium deoxycholate and dissolve it in 10mL of deionized water. Mix well and set aside.

[0057] 1M DTT: Dissolve 1.54 g of DTT in 10 mL of deionized water, mix well, and store at -20°C until use.

[0058] 100 mg / mL CHX: Weigh 0.1 g CHX and dissolve it in 1 mL water. Mix well and store at -20°C until use.

[0059] Polysome extraction buffer (PEB): Pipette 2 mL of 1M Tris-HCl (pH 8.0), 300 μL of 1M KCl, 150 μL of 1M MgCl2, 1 mL of 10% sodium deoxycholate solution, 10 μL of 1M DTT, and 10 μL of 100 mg / mL CHX, mix well, add deionized water to make up to 10 mL, and place on ice until used;

[0060] Gradient Buffer: Pipette 40 μL of 1 M Tris-HCl (pH 8.0), 200 μL of 1 M KCl, 100 μL of 1 M MgCl2, 10 μL of 1 M DTT, and 10 μL of 100 mg / mL CHX, mix well, add deionized water to make up to 10 mL, and place on ice until used;

[0061] 15% sucrose solution: Weigh 15 g of sucrose, add 10 mL of Gradient Buffer, and dilute to 100 mL with deionized water. Mix well and place on ice until ready to use.

[0062] 55% sucrose solution: Weigh 55 g of sucrose, add 10 mL of Gradient Buffer, and dilute to 100 mL with deionized water. Mix well and place on ice until ready to use.

[0063] Example 1. Screening of the small protein PoxTMA7 and its encoding gene

[0064] Multi-omics analysis of Penicillium oxalicum HP7-1 identified a small protein, PoxTMA7. PoxTMA7 consists of 69 amino acids, and its sequence is shown in SEQ ID NO. 1. The open reading frame of the gene encoding the small protein, PoxTMA7, is shown in SEQ ID NO. 2, and the coding sequence is shown in SEQ ID NO. 3.

[0065] Example 2. Construction of Penicillium oxalicum deletion mutant strain ΔPoxTMA7 and complementation strain CPoxTMA7

[0066] 1. Construction and PCR verification of the ΔPoxTMA7 deletion mutant of Penicillium oxalicum

[0067] 1. Using the starting strain ΔPoxKu70 as a template, primers TMA7-LF and TMA7-LR were used to amplify the left homology arm of PoxTMA7, and primers TMA7-RF and TMA7-RR were used to amplify the right homology arm of PoxTMA7; using the plasmid pTi-Flp / frt stored in the laboratory as a template, primers Flp - F and Flp - R amplified Flp - G418-frt sequence.

[0068] 2. The purified PoxTMA7 left and right homology arms were stained with Flp - G418-frt was used for fusion PCR at a molar ratio of 1:1:1, and the PoxTMA7 knockout cassette was amplified using primers TMA7-NF and TMA7-NR.

[0069] 3. The PoxTMA7 knockout cassette is shown in SEQ.ID.NO.4. From the 5' position, the 1st to 2268th nucleotides are the left homology arm sequence of PoxTMA7, and the 2269th to 7373rd nucleotides are Flp - G418-frt sequence, nucleotides 7374-9156 are the right homology arm sequence of PoxTMA7.

[0070] 4. Prepare protoplasts of Penicillium oxalicum strain ΔPoxKu70 and transform the protoplasts. After transformation, collect spores cultured for 4 days using 0.2% Tween-80 for dilution and plating. After 2-3 days of culture, single colonies are picked for PCR verification.

[0071] 5. Extract genomic DNA from a single colony for PCR verification. Use primers TMA7-F and TMA7-R to perform PCR verification of the target gene PoxTMA7. The results are as follows: Figure 1As shown in a, PoxTMA7 was amplified normally using ΔPoxKu70 genomic DNA as a template, while PoxTMA7 could not be amplified using genomic DNA of three transformants of the mutant strain ΔPoxTMA7 as templates and the negative control. Figure 1 b Using primers TMA7-LF and Flp - R performs left cross validation, Figure 1 c primer Flp - Right cross validation was performed with F and TMA7-RR. All three transformants of the mutant ΔPoxTMA7 were able to amplify DNA products that met the theoretical size, while neither ΔPoxKu70 nor the negative control amplified PCR products. PCR verification indicated that the mutant ΔPoxTMA7 was successfully constructed.

[0072] The primer sequences used are as follows (5'-3'):

[0073] TMA7-LF:TGACGCTTGTCCGAGGGA

[0074] TMA7-LR: GGAAGAAAGACCTCTACAACATTCGAAGATTCGAGTGCC

[0075] TMA7-RF:CCCGTAGGTGGCAAGCTAGCGCAGTCAGCTTGGACATCACAC

[0076] TMA7-RR: CGCCACATCGTCCACAGA

[0077] TMA7-NF:CACGCCACTTTCAGATGT

[0078] TMA7-NR:GGGCTTCTGCTCCTCATC

[0079] Flp - F:TGTTGTAGAGGTCTTTCTTCC

[0080] Flp - R:GCTAGCTTGCCACCTAC

[0081] TMA7-F:AGCAGAGAAGGTCAGTGG

[0082] TMA7-R:GCCCGACTTCTTGATACC

[0083] 6. The resistance gene G418 was removed using the Flp / frt system using the method described in the reference. The resulting mutant strain ΔPoxTMA7 does not contain the resistance gene G418. The reference is: Lin YY, Zhao S, Lin X, et al. Improvement of cellulase and xylanase production in Penicillium oxalicum under solid-state fermentation by flippase recombination enzyme / recognition target-mediated genetic engineering of transcription repressors[J]. Bioresource Technol. 2021 337:125366.

[0084] 2. Construction and PCR Verification of the Complementation Strain CPoxTMA7 of Penicillium oxalicum

[0085] 1. The mutant ΔPoxTMA7 was used as the starting strain to construct the complementation strain CPoxTMA7. Using ΔPoxKu70 genomic DNA as a template, primers POX_4g05775_LF and POX_4g05775_LR were used to amplify the left homology arm of the gene POX_4g05775, primers POX_4g05775_RF and POX_4g05775_RR were used to amplify the right homology arm of the gene POX_4g05775, and primers TMA7_P-TF and TMA7_P-TR were used to amplify the DNA fragment encompassing the promoter and terminator regions of the gene PoxTMA7. The resistance gene G418 was amplified using plasmid pCPXG418 as a template and primers G418-F / G418-R.

[0086] 2. The purified POX_4g05775 left homology arm, POX_4g05775 left homology arm, G418, and TMA7_P-T were mixed at a molar ratio of 1:1:1:1 and subjected to fusion PCR to amplify the complementary cassette using primers POX_4g05775_NF and POX_4g05775_NR.

[0087] 3. Protoplasts of the mutant strain ΔPoxTMA7 were prepared according to the protoplast preparation method described above. Protoplasts of the mutant strain ΔPoxTMA7 were transformed according to the protoplast transformation method described above. After protoplast transformation, the transformed protoplasts were cultured for 4 days. Spores from the upper plate were collected and diluted and spread with 0.2% Tween-20. After 2-3 days of culture, individual colonies were selected for PCR verification.

[0088] 4. Extract genomic DNA from a single colony for PCR verification. Use primers POX_4g05775_F and POX_4g05775_R to verify the POX_4g05775 target gene: Figure 2 As shown, using the genomic DNA of the mutant strain ΔPoxTMA7 as a template, POX_4g05775 was amplified; however, the three transformants of the complementing strain CPoxTMA7 and the negative control were unable to amplify POX_4g05775. Left cross validation was performed using primers POX_4g05775_LF and G418-R, right cross validation was performed using primers G418-R and POX_4g05775_RR, and PoxTMA7 insertion verification was performed using primers TMA7_F and POX_4g05775_RR. The three transformants of the complementing strain CPoxTMA7 amplified PCR products consistent with the theoretical size, while the mutant strain ΔPoxTMA7 and the negative control were unable to amplify PCR products, indicating that the complementing strain CPoxTMA7 was successfully constructed.

[0089] The primer sequences used are as follows (5'-3'):

[0090] POX_4g05775_LF:ACCAAACACCGCTACACT

[0091] POX_4g05775_LR:AGGTAATCCTTCTTTCTAGAGATGGACGAGACGGTACG

[0092] TMA7_P-TF: CAATATCATCTTCTGTCGACTCGGGACGGCAAATCGGT

[0093] TMA7_P-TR: TGCAACTTGGTGATCTACATGTCTCTCAGCTTCCGCAC

[0094] POX_4g05775_RF:ATGTAGATCACCAAGTTTGCAC

[0095] POX_4g05775_RR:GATCATGCCTCCCCATCC

[0096] G418-F:TCTAGAAAGAAGGATTACCTC

[0097] G418-R:GTCGACAGAAGATGATATTG

[0098] POX_4g05775_NF:CTCCGTCGGTGTTAATGG

[0099] POX_4g05775_NR:AATAGAAGATAACCCACG

[0100] POX_4g05775-F:ATGGTTGTCTTCAGCAAGGTTA

[0101] POX_4g05775-R: CTATGCCTGAGCAGCGAAAC

[0102] Example 3: Effect of the small protein PoxTMA7 on the production of cellulase and xylanase from Penicillium oxalicum

[0103] Fresh spores of Penicillium oxalicum strains ΔPoxKu70, ΔPoxTMA7, and CPoxTMA7 were collected and inoculated into glucose medium and cultured at 28°C and 180 rpm for 24 hours. One gram of mycelium was then transferred to medium containing crystalline cellulose and cultured at 28°C and 180 rpm for 2 and 4 days, respectively. Crude enzyme solutions and mycelia of Penicillium oxalicum strains ΔPoxKu70, ΔPoxTMA7, and CPoxTMA7 were collected and used to determine cellulase and xylanase production. Crude enzyme solutions were used for cellulase and xylanase activity determination, while mycelia were used for intracellular protein determination. Cellulase and xylanase production was calculated as total enzyme activity (U) divided by total intracellular protein (g).

[0104] Compared with the original strain ΔPoxKu70, the filter paper enzyme (FPase) production of the mutant strain ΔPoxTMA7 on the fourth day of culture was significantly reduced by 74.3% ( Figure 3 ), the production of carboxymethyl cellulase (CMCase) decreased significantly by 72.6% ( Figure 4 ), the production of β-glucosidase (pNPGase) was significantly reduced by 90.0% ( Figure 5 ), and the production of xylanase was significantly reduced by 66.2% ( Figure 6 ), the production of filter paper enzyme, carboxymethyl cellulase, β-glucosidase and xylanase of the complementary strain CPoxTMA7 could partially recover to the level of the starting strain ΔPoxKu70, indicating that the small protein PoxTMA7 significantly affected the production of cellulase and xylanase of Penicillium oxalicum.

[0105] Example 4: Effect of the small protein PoxTMA7 on the translation efficiency of key cellulase and xylanase genes of Penicillium oxalicum

[0106] The translation of key cellulase and xylanase genes of Penicillium oxalicum was detected by combining ribosome profiling analysis and RT-qPCR.

[0107] 1. Collect mycelia of the mutant strain ΔPoxTMA7 of Penicillium oxalicum and the starting strain ΔPoxKu70 cultured in crystalline cellulose for 48 h, grind them in liquid nitrogen, add pre-chilled ribosome extraction buffer, and place them on ice for 25 minutes to lyse.

[0108] 2. Transfer the mixture to a 1.5 mL EP tube, centrifuge at 4°C, 14,000 rpm for 20 min, and collect the supernatant.

[0109] 3. Slowly layer the supernatant on the 15%-50% sucrose density gradient prepared in advance, and centrifuge at 4°C and 38,000 rpm for 3 hours.

[0110] 4. Separate each sucrose density gradient sample, add 3 volumes of anhydrous ethanol, place in a -80℃ refrigerator for precipitation overnight, and then extract RNA from the sample using Trizol-chloroform.

[0111] 5. Reverse the extracted RNA and use corresponding primers to detect the relative expression levels of the cellobiohydrolase genes cbh1 and cbh2, the endo-β-1,4-glucanase gene eg1, and the xylanase gene xyn11A in each density gradient. The relative expression levels in each density gradient were used to calculate the proportion of mRNA bound to polysomes, thereby indicating the translation status of the genes.

[0112] The primer sequences used are as follows (5'-3'):

[0113] cbh1_RT-F:TCCTCCTCTCCTCCCTGCTG

[0114] cbh1_RT-R:CCGTTCTTTGTCGTGAACCCA

[0115] cbh2_RT-F:CAAACCACCAAGACCACCAT

[0116] cbh2_RT-R:CTCTGAACCTCGGAAGCGTA

[0117] eg1_RT-F:AACCTGGAAGAACGGCACC

[0118] eg1_RT-R:CCTTGTCACAGTCATCGGAGC

[0119] xyn11A_RT-F:TGAGCCCAGGACCATCAACTT

[0120] xyn11A_RT-R:CATGAGGTAGTCGGTCAAGTCAC

[0121] The results are as follows Figure 7As shown, the horizontal axis represents different sucrose density gradients, and the vertical axis represents the proportion of mRNA in the total mRNA at different density gradients. The fifth and sixth sucrose density gradients represent the density gradients where polysomes are located. Compared with the starting strain ΔPoxKu70, the mutant strain ΔPoxTMA7 showed a significantly reduced proportion of mRNA transcribed from the cellobiohydrolase genes cbh1 and cbh2, the endoβ-1,4-glucanase gene eg1, and the xylanase gene xyn11A that was bound to polysomes, indicating that the deletion of the small protein-encoding gene PoxTMA7 significantly affects the translation efficiency of key cellulase and xylanase genes in Penicillium oxalicum.

Claims

1. A small protein PoxTMA7, characterized in that It has the amino acid sequence of SEQ.ID.NO.

1.

2. The small protein PoxTMA7 according to claim 1, characterized in that Derived from Penicillium oxalicum.

3. The gene encoding the small protein PoxTMA7 according to claim 1, characterized in that It has the base sequence of SEQ.ID.NO.

3.

4. Use of the small protein PoxTMA7 according to claim 1 or the encoding gene according to claim 3 in regulating the synthesis of cellulase and xylanase from Penicillium oxalicum.

5. The use according to claim 4, characterized in that: The regulation is to regulate the production of cellulase and xylanase under the conditions of crystal cellulose induction culture of Penicillium oxalicum.

6. The use according to claim 5, characterized in that: The regulation is achieved by regulating the expression of relevant genes; The related genes include: cellulase genes cbh1, cbh2, eg1, and xylanase gene xyn11A.

7. A recombinant microorganism, characterized in that The method is prepared by introducing a biological element that inhibits the expression of the gene encoding the small protein PoxTMA7 into a microorganism.

8. The recombinant microorganism according to claim 7, characterized in that: The biological element for inhibiting the expression of the gene encoding the small protein PoxTMA7 is a gene knockout box, which has a base sequence of SEQ.ID.NO.

4.

9. The recombinant microorganism according to claim 7, characterized in that The recombinant strain was obtained by knocking out the gene encoding the small inhibitory protein PoxTMA7 from Penicillium oxalicum ΔPoxKu70 as the starting strain.