A microecological preservative composition suitable for sensitive skin

The microecological preservative composition, which combines Artemisia annua fermentation broth powder with gluconolactone, solves the problems of phenoxyethanol in cosmetics disturbing the resident skin flora and inhibiting the HSP20 gene, and achieves skin microecological repair and anti-aging effects.

CN120549786BActive Publication Date: 2026-07-21SHANDONG FREDA BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510876513.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-27
Publication Date
2026-07-21
Estimated Expiration
2045-06-27

AI Technical Summary

Technical Problem

Existing cosmetic preservatives disturb and damage the skin's resident flora, affecting the skin's microecological environment. This poses a potential hazard, especially to sensitive skin. Furthermore, the commonly used preservative phenoxyethanol may inhibit the expression of the HSP20 gene, thus affecting skin health.

Method used

Artemisia annua fermentation broth powder was compounded with gluconolactone to form a microecological preservative composition, reducing the amount of phenoxyethanol used. Artemisia annua fermentation broth powder was prepared through fermentation process, which reduced disturbance to the resident flora of the skin and promoted the expression of HSP20 gene.

Benefits of technology

It achieves the repair of the skin's microecology, reduces the risk of phenoxyethanol irritation, promotes HSP20 gene expression, has good anti-aging effects, and is suitable for sensitive skin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120549786B_ABST
    Figure CN120549786B_ABST
Patent Text Reader

Abstract

The present application provides a kind of micro-ecological preservative composition suitable for sensitive skin.The present application first extracts artemisia by 60% ethanol reflux, then adds lactobacillus plantarum and saccharomyces cerevisiae to ferment to obtain artemisia fermentation liquor powder, and then compounding phenoxyethanol and gluconolactone to obtain a micro-ecological preservative composition.The experiment verifies that the micro-ecological preservative composition does not excessively inhibit / accelerate the proliferation of propionibacterium acnes, reduces the disturbance and damage to the skin resident flora, and has a certain repair effect on the micro-ecological barrier.Phenoxyl ethanol and natural preservatives (artemisia fermentation liquor powder and gluconolactone) have a certain synergistic preservative effect, which can reduce the dosage of phenoxyethanol, reduce the risk of irritation and burning of high concentration of phenoxyethanol on sensitive skin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of cosmetic technology, specifically relating to a microecological preservative composition suitable for sensitive skin. Background Technology

[0002] Because cosmetics are rich in water and nutrients, they are highly susceptible to microbial contamination. Preservatives are often added to prevent microbial contamination (especially pathogenic bacteria) and ensure the stability and safety of the cosmetics. The most common method for evaluating the effectiveness of preservatives in the final formulation of cosmetics is the preservative challenge experiment, in which selected test strains include Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus niger, and Candida albicans. While preservatives in cosmetics inhibit and kill pathogenic bacteria, they inevitably disturb and disrupt the resident flora of the skin, thus affecting the microecological environment of the skin surface. In severe cases, this may even cause skin infections or various skin diseases. Researching and developing skin-microecologically friendly cosmetics, which are used to protect and beautify the skin, should not kill or significantly inhibit the resident flora of the skin during short-term or long-term use. This presents a new challenge to the use of preservatives in cosmetics.

[0003] HSP20 belongs to the small heat shock protein family (sHSPs, molecular weight approximately 12-43 kDa) and plays a unique role in skin stress response, barrier function, and the aging process, especially in the regulation of inflammation and cell protection in sensitive skin. HSP20 has antioxidant effects in skin cells, mitigating oxidative stress damage by activating the Nrf2-NQO-1 pathway and protecting airway epithelial cells and skin cells from free radical damage. Simultaneously, HSP20 expression and activity can regulate inflammatory responses, reducing the release of inflammatory mediators and thus alleviating skin inflammation and damage. As an "endogenous protective factor" for sensitive skin, promoting HSP20 production can improve sensitivity symptoms and signs of aging. The key is to activate it gently (e.g., with low concentrations of plant polyphenols, non-invasive physical stimulation) rather than forcibly inducing it, avoiding excessive stress that could cause secondary damage to sensitive skin. In the future, with the development of targeted delivery technologies, precisely enhancing HSP20 activity is expected to become one of the core directions for anti-aging of sensitive skin.

[0004] Phenoxyethanol, a common preservative in skincare products, has a certain inhibitory effect on Propionibacterium acnes on the face. Besides inhibiting its proliferation and disrupting the balance of the skin's microbiota, it also affects the metabolism of Propionibacterium acnes, thereby significantly reducing the expression of the heat shock protein HSP20 gene. Therefore, developing a microecologically friendly preservative composition suitable for sensitive skin is a problem that needs to be solved. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a microecological preservative composition suitable for sensitive skin. The invention first extracts Artemisia annua by reflux extraction with 60% ethanol, then adds Lactobacillus plantarum and Saccharomyces cerevisiae for fermentation to obtain Artemisia annua fermentation broth powder. This powder is then compounded with phenoxyethanol and gluconolactone to obtain the microecological preservative composition. Experimental verification shows that this microecological preservative composition does not excessively inhibit / promote the proliferation of Propionibacterium acnes, reducing disturbance and damage to the skin's resident flora, and has a certain repairing effect on the microecological barrier. Phenoxyethanol and the natural preservatives (Artemisia annua fermentation broth powder and gluconolactone) have a certain synergistic preservative effect, which can reduce the dosage of phenoxyethanol and reduce the risk of irritation and burning sensation to sensitive skin caused by high concentrations of phenoxyethanol. The natural preservative composition can improve the inhibition of HSP20 gene expression by phenoxyethanol, and simultaneously synergistically promotes HSP20 gene expression, achieving good anti-aging effects.

[0006] The first objective of this invention is to provide a microecological preservative composition suitable for sensitive skin, characterized in that it is composed of phenoxyethanol, artemisia annua fermentation broth powder and gluconolactone; wherein, by mass ratio, phenoxyethanol: artemisia annua fermentation broth powder: gluconolactone = 1:0.5~2:1~2, and the total amount added in cosmetics is ≤0.5%.

[0007] The preparation method of Artemisia annua fermentation broth powder is as follows: Artemisia annua is first pulverized and then extracted by reflux with 55-65% ethanol. After concentration, the ethanol is removed to obtain Artemisia annua extract. The Artemisia annua extract is added to TSB medium (the weight ratio of TSB medium to Artemisia annua extract (dry matter) is 5:1), and 2-5% of a mixed culture of Lactobacillus plantarum and Saccharomyces cerevisiae is inoculated. After aerobic fermentation at 28-32℃ for 10-15 hours, the mixture is transferred to anaerobic fermentation at 22-28℃ for 40-55 hours, during which the pH is monitored to decrease to 4.2-4.5. After fermentation, the mixture is centrifuged, vacuum concentrated at low temperature, and freeze-dried to obtain Artemisia annua fermentation broth powder. The OD values ​​of the two strains in the mixed culture of Lactobacillus plantarum and Saccharomyces cerevisiae are... 600 All were 0.45–0.55, and the volume ratio of Lactobacillus plantarum to Saccharomyces cerevisiae was 1.8–2.2:1.

[0008] A second objective of this invention is to provide the above composition as a preservative for use in the preparation of cosmetics for sensitive skin.

[0009] In this invention, the term "cosmetics" should be interpreted broadly, including but not limited to cleansing creams (ointments), facial cleansers, bath gels, face creams, toners, and face masks.

[0010] This invention utilizes a microecological preservative composition formulated with phenoxyethanol, artemisia annua fermentation broth powder, and gluconolactone. The fermentation process of artemisia annua extract helps to mitigate the irritation of phenoxyethanol, reducing disturbance and damage to the skin's resident flora, and thus promoting the repair of the skin's microecology. The addition of gluconolactone has a synergistic anti-aging effect with the artemisia annua fermentation broth powder. Furthermore, the synergistic preservative effect of phenoxyethanol, artemisia annua fermentation broth powder, and gluconolactone reduces the dosage of phenoxyethanol, minimizing the risk of irritation and burning to sensitive skin caused by high concentrations of phenoxyethanol, and reducing disturbance and damage to the skin's resident flora, thereby achieving the repair of the skin's microecology.

[0011] The beneficial technical effects of this invention are:

[0012] 1. The microecological preservative composition for anti-aging of sensitive skin provided by the present invention will not excessively inhibit / promote the proliferation of Propionibacterium acnes, reduce disturbance and damage to the skin's resident flora, and has a certain repair effect on the microecological barrier.

[0013] 2. Phenoxyethanol, Artemisia annua fermentation broth powder, and gluconolactone have a certain synergistic preservative effect, which can reduce the dosage of phenoxyethanol and reduce the risk of irritation and burning to sensitive skin caused by high concentrations of phenoxyethanol.

[0014] 3. The combination of Artemisia annua fermentation broth powder and gluconolactone can improve the inhibition of HSP20 gene expression by phenoxyethanol. At the same time, Artemisia annua fermentation broth powder and gluconolactone can synergistically promote the expression of HSP20 gene, thus achieving good anti-aging effects. Attached Figure Description

[0015] Figure 1 Growth curves of Propionibacterium acnes CCSM0331 in each treatment group;

[0016] Figure 2 For RT-qPCR analysis, the expression level of the heat shock protein gene HSP20 in the treated group compared with the untreated group was determined.

[0017] Figure 3 This is a gradient dilution plot for bacteria and fungi. Detailed Implementation

[0018] The present invention will be further described below with reference to embodiments and accompanying drawings, but this does not limit the invention to the scope of the embodiments described. Based on the embodiments of the present invention, any changes to the present invention made by those skilled in the art without inventive step are within the scope of protection of the present invention. Furthermore, in the embodiments of the present invention, unless otherwise specified, all raw materials used in the preparation are commercially available products well known to those skilled in the art.

[0019] The preparation method of the Artemisia annua fermentation broth powder used in this embodiment is as follows:

[0020] (1) Artemisia annua was pulverized and then extracted by reflux with 60% ethanol for 3 times, each time for 40 min; the material-liquid mass ratio was 1:5; the extracts were combined and the ethanol was removed by rotary evaporation to obtain Artemisia annua extract;

[0021] (2) Artemisia annua extract was added to TSB medium (the weight ratio of TSB medium to Artemisia annua extract (dry matter) was 5:1) and 3% of a mixed culture of Lactobacillus plantarum and Saccharomyces cerevisiae (Lactobacillus plantarum OD) was inoculated. 600 =0.5, OD of brewer's yeast 600 =0.5 (volume ratio 2:1); after aerobic fermentation at 30℃ for 12 hours, it was transferred to anaerobic fermentation at 25℃ for 48 hours, during which the pH was monitored to drop to 4.2-4.5;

[0022] (3) After fermentation, the fermentation liquid was centrifuged at 8000 rpm for 15 minutes, filtered through a 0.22 μm membrane for sterilization, concentrated under vacuum at 40℃, and freeze-dried to obtain Artemisia annua fermentation liquid powder.

[0023] The Artemisia annua extract powder used in this embodiment is obtained by reflux extraction with 60% ethanol, concentration and drying according to the above step (1).

[0024] Examples 1-3: Anticorrosive Compositions

[0025] The formulations (by weight) of the preservative compositions for Examples 1-3 and Comparative Examples 1-10 are shown in Table 1. All raw materials were mixed thoroughly to obtain the preservative compositions.

[0026] Table 1. Formulations of Examples 1-3 and Comparative Examples 1-10

[0027]

[0028] Application Examples 1-3: Emulsion Preparation

[0029] Emulsions were prepared from the preservative compositions of Examples 1-3 and Comparative Examples 1-10 to obtain Application Examples 1-3 and Comparative Application Examples 1-10. The formulations of the emulsions are as follows:

[0030] Phase A: A165 (emulsifier) ​​1%, GTCC (caprylic / capric triglyceride) 3%, white oil 3%, cetearyl alcohol 0.5%, silicone oil 5%;

[0031] Phase B: Glycerin 4%, Butylene Glycol 4%, EMT-10 (emulsifier) ​​0.4%, Xanthan Gum 0.1%, Soy Lecithin 0.2%, Deionized Water TO 100%;

[0032] Phase C: The anti-corrosion composition provided by this invention (added according to the percentages provided in Table 1).

[0033] The emulsion preparation steps are as follows:

[0034] 1) Preparation of phase B: EMT-10, xanthan gum and soybean lecithin were first dispersed in glycerol and butylene glycol, then deionized water was added, and the mixture was heated and stirred in an 80°C water bath to fully dissolve the substances, thus obtaining phase B;

[0035] 2) Preparation of Phase A: A165, GTCC, white oil, cetearyl alcohol and silicone oil were heated and melted in a water bath at 83°C to obtain Phase A;

[0036] 3) Heat phase A and phase B in a water bath at 83°C. When the two phases are at the same temperature, slowly add phase A to phase B while stirring phase B at 500 r / min. After phase B and phase A are mixed, cool down at a stirring rate of 430 r / min to obtain an emulsion.

[0037] 4) Add the anti-corrosion composition provided by the present invention to deionized water and stir until it is fully dissolved to obtain phase C;

[0038] 5) When the emulsion temperature drops to 40-45℃, add phase C and stir at 60r / min to cool down; when the temperature drops to 35℃, let it stand and cool to obtain each emulsion product.

[0039] The blank example is an emulsion without active ingredients.

[0040] Experimental Example 1: Growth Curve Measurement

[0041] The bacterial suspension of Propionibacterium acnes CCSM0331 (Propionibacterium acnes CCSM0331 was isolated from healthy facial skin, see CN116904332A A strain of Propionibacterium acnes with good antioxidant effect and its application, preservation number: CCTCC No: M 2022781) was diluted to 1×10⁻⁶ using freshly prepared TSB medium. 8 CFU / mL, for later use. The experimental group consisted of 100 mL TSB medium containing the preservative compositions of Examples 1-3, Comparative Examples 1 and 7 (added according to the percentages provided in Table 1), while the control group consisted of 100 mL TSB medium. Diluted bacterial suspensions were inoculated into the experimental and control groups at a concentration of 1% (v / v), with 100 mL TSB medium serving as a blank control. Anaerobic culture was performed at 37°C, and OD was measured every 4 hours using a microplate reader. 600 The growth curves of Propionibacterium acnes CCSM0331 in each treatment group are shown below. Figure 1 As shown.

[0042] Depend on Figure 1It is known that phenoxyethanol treatment (Comparative Example 1) inhibits the growth of Propionibacterium acnes CCSM0331, suppressing its proliferation and affecting the natural balance of facial flora. However, the preservative compositions (Examples 1-3) provided by this invention for anti-aging of sensitive skin do not excessively inhibit / promote the proliferation of Propionibacterium acnes, reducing disturbance and damage to the resident skin flora. Furthermore, replacing the Artemisia annua ferment broth with Artemisia annua extract powder inhibits the proliferation of Propionibacterium acnes and affects the natural balance of facial flora. This indicates that the Artemisia annua ferment broth provided by this invention has a greater advantage, as it does not excessively inhibit / promote the proliferation of Propionibacterium acnes, reducing disturbance and damage to the resident skin flora.

[0043] Experimental Example 2: Real-time quantitative PCR (RT-qPCR)

[0044] The expression of Propionibacterium acnes CCSM0331 (HSP20) DEGs was analyzed. The primer sequences used for RT-qPCR analysis of the genes are shown below.

[0045] O2A76_RS03905 (gene) HSP20 primers (5'→3'):

[0046] Forward: TGGACCTTCCAGGAGTTGAT;

[0047] Reverse: GGTGTACTCGGCGGTGAT.

[0048] Total RNA was extracted from Propionibacterium acnes cells using TRIzol reagent and cDNA was synthesized via reverse transcriptase. Gene expression was performed using the comparative threshold cycling (Ct) method (2... -ΔΔCt Quantitative analysis was performed. Expression levels were normalized using 16S rRNA as an internal control. The expression levels of the heat shock protein gene HSP20 in the treated group (Example 1) relative to the untreated groups (Comparative Examples 1, 4, 5, 7, and 9) were calculated and compared. The results are as follows: Figure 2 As shown.

[0049] Depend on Figure 2It was found that the expression level of the heat shock protein gene HSP20 was significantly reduced after treatment with phenoxyethanol. When phenoxyethanol was combined with a single component (Artemisia annua fermentation broth powder or gluconolactone) (Comparative Examples 4 and 5), the expression level of the heat shock protein gene HSP20 was significantly reduced. However, when phenoxyethanol was combined with two components (Artemisia annua fermentation broth powder + gluconolactone), it not only significantly reduced the reduction of the heat shock protein gene HSP20, but also promoted the expression of this gene. This indicates that there is a certain synergistic effect between the two substrates, which has a certain anti-aging effect and is suitable for anti-aging products for sensitive skin. Comparing Comparative Examples 4 and 9, and comparing Examples 1, 5, and 7, it was found that the addition of Artemisia annua extract powder did not promote the expression level of HSP20, while the fermented Artemisia annua fermentation broth powder had a certain increasing effect on the expression level of HSP20. This indicates that the Artemisia annua fermentation broth of the present invention is superior to conventional Artemisia annua extract.

[0050] Experiment Example 3: Stimulus Evaluation Experiment

[0051] Thirty participants with sensitive skin, regardless of gender, aged 23–50 years, were recruited for the experiment. Examples 1–3 and comparative examples 4, 5, 7, and 9 were used as test subjects, with a blank serving as a negative control. The testing method involved selecting an area no larger than 50 mm². 2 A suitable spot tester with a depth of approximately 1 mm was used. Approximately 0.020–0.025 g of the test substance was added to the spot tester using a closed patch test method. Hypoallergenic adhesive tape was applied to the back of the subject. Eight samples were tested: a blank group, application examples 1–3, and comparative application examples 4, 5, 7, and 9. The test substance was removed after 24 hours, and skin reactions were observed at 0.5, 24, and 48 hours after removal. The results were recorded according to the skin reaction grading standards in the "Cosmetic Safety Technical Specifications 2015" (Table 2). The irritation evaluation results are shown in Table 3.

[0052] Table 2 Skin Reaction Grading Standards

[0053]

[0054] Table 3 Results of the Stimulus Evaluation Experiment

[0055]

[0056] Table 3 shows that phenoxyethanol (Comparative Application Example 1) is a relatively irritating preservative for people with sensitive skin and is not suitable for their use. When phenoxyethanol is used in combination with a certain ingredient (Comparative Application Examples 4 and 5), the irritation of phenoxyethanol is somewhat reduced, but some people with sensitive skin still experience irritation. When phenoxyethanol is used in combination with two ingredients (Application Examples 1-3), 30 individuals with sensitive skin did not experience irritation, indicating that the soothing ability of the two fermentation substrates is significantly improved after combined fermentation, possibly with a certain synergistic effect, solving the problem of phenoxyethanol's irritation for people with sensitive skin. Comparing Application Example 1 and Comparative Application Example 7, it was found that the Artemisia annua extract powder is less effective in alleviating the irritation caused by phenoxyethanol than the fermented Artemisia annua broth powder, making the Artemisia annua broth of this invention superior.

[0057] Experiment Example 4: Evaluation of Corrosion Resistance

[0058] 1. Experimental strain:

[0059] 1) Bacteria: Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa, all of which were third-generation cultures;

[0060] 2) Fungi: Aspergillus niger and Candida albicans, both of which are third-generation cultures.

[0061] 2. Experimental steps:

[0062] 1) Preparation of bacterial suspension: The standard stock strains of Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa were inoculated into tryptic soy broth (TSB) and incubated at 30–35°C for 24–48 h. The suspensions were then serially diluted with 0.85% physiological saline. Six petri dishes were prepared, and 10 μL of each suspension was drawn from each dish. -6 10 -7 10 -8 Three serial dilutions were prepared, with 2 ml of each dilution injected into two sterile Petri dishes, 1 ml per dish. Approximately 15 ml of melted and cooled tryptic soy agar medium (45–50°C) was then poured into each dish. The dishes were immediately rotated to thoroughly mix the bacterial culture with the medium. After the agar solidified, the dishes were inverted and incubated at 30–35°C for 48 ± 2 hours. The bacterial counts were then performed. Based on the count results, the original bacterial culture was diluted to a 10-1 concentration. 8 The prepared bacterial suspensions were mixed in equal volumes and then set aside for use.

[0063] 2) Preparation of Candida albicans suspension: The cryopreserved strain of Candida albicans was inoculated into Sabouraud dextrose liquid medium (SDB medium) and incubated at 20–25°C for 2–3 days. It was then serially diluted with 0.85% physiological saline. Six petri dishes were prepared, and 10 μL of each solution was poured into each dish. -510 -6 10 -7 Three serial dilutions were prepared, with 2 ml of each dilution injected into two sterile Petri dishes, 1 ml per dish. Approximately 15 ml of melted and cooled Sabouraud dextrose agar medium (45–50°C) was then poured into each dish. The dishes were immediately rotated to thoroughly mix the bacterial culture with the medium. After the agar solidified, the dishes were inverted and incubated at 20–25°C for 5 days. The bacterial counts were then performed. Based on the count results, the original bacterial culture was diluted to a 10-1 concentration. 6 A bacterial suspension of CFU / ml was prepared and is ready for use.

[0064] 3) Preparation of Aspergillus niger spore suspension: The above-mentioned frozen Aspergillus niger spore suspension was inoculated onto Sabouraud dextrose agar slants and incubated at 20–25°C for 5–7 days or until abundant spores were obtained. The mycelial growth was rinsed with an appropriate amount of 0.85% physiological saline containing 0.05% (ml / ml) polysorbate 80 to prepare a spore suspension. This suspension was then serially diluted with 0.85% physiological saline containing 0.05% (ml / ml) polysorbate 80. Six petri dishes were prepared, and 10 μL of each was drawn from each dish. -5 10 -6 10 -7 Three gradient dilutions were prepared, with 2 ml of each dilution injected into two sterile Petri dishes, 1 ml per dish. Approximately 15 ml of melted and cooled Sabouraud dextrose agar medium (45–50°C) was then poured into each dish. The dishes were immediately rotated to thoroughly mix the bacterial culture with the medium. After the agar solidified, the dishes were inverted and incubated at 20–25°C for 5 days. Counting was then performed. If Aspergillus niger spread and grew, to avoid affecting the counting results, the plates should be removed and counted daily starting at 48±2 hours, with the count on the 5th day being the final count. Based on the above counting results, the protospore solution was diluted to 10⁻⁶ ml using 0.85% physiological saline containing 0.05% (ml / ml) polysorbate 80. 6 The prepared bacterial suspension, containing CFU / ml spores, is ready for use.

[0065] Gradient dilution diagrams of bacteria and fungi are shown below. Figure 3 As shown.

[0066] 4. Sample preparation: Take 3 portions of each sample, weigh 120g or measure 120ml of each portion into a sterile conical flask, and set aside.

[0067] 5. Sample inoculation: Take the above 3 samples and inoculate them with 1.2ml of bacterial mixed suspension, 1.2ml of Candida albicans suspension and 1.2ml of Aspergillus niger spore suspension respectively. Label them, mix them evenly, and store the samples at room temperature.

[0068] 6. Sample testing: The prepared samples were taken on days 0, 1, 3, 7, 14, 21, and 28, and tested according to the cosmetic microbiology testing procedures. The number of colonies in the samples was recorded to determine the preservative efficacy of the cosmetics.

[0069] 7. Experimental Results:

[0070] 1) Bacterial suspension counting results:

[0071] The counting results of bacterial suspensions, Candida albicans suspensions, and Aspergillus niger spore suspensions are shown in Tables 4, 5, and 6, respectively.

[0072] Table 4 Results of bacterial suspension counting

[0073]

[0074] The initial inoculation concentration of the sample was 1.5 × 10⁻⁶. 6 CFU / g (ml) (Initial logarithmic value 6.18)

[0075] Table 5. Results of Candida albicans suspension counting

[0076]

[0077] The initial inoculation concentration of the sample was 1.5 × 10⁻⁶. 4 CFU / g (ml) (Initial logarithm 4.18)

[0078] Table 6. Results of Aspergillus niger spore suspension count

[0079]

[0080] The initial inoculation concentration of the sample was 1.6 × 10⁻⁶. 4 CFU / g (ml) (Initial logarithmic value 4.20)

[0081] 2) Determine the colony count of different samples at different times.

[0082] Evaluation criteria: The preservative effect of cosmetics is evaluated using the logarithmic reduction value. The formula for calculating this indicator is shown below.

[0083] R X =lgN0-lgN X

[0084] In the formula:

[0085] N0: Initial concentration of bacterial culture in the sample;

[0086] N X : The number of bacterial colonies in the sample at different testing times.

[0087] The evaluation criteria for the preservative effect of cosmetics are shown in Table 7-8. The calculated R... x The results are shown in Table 9.

[0088] Table 7 Evaluation Criteria for the Preservative Effect of Cosmetics

[0089]

[0090] Table 8 Additional Conditions for Evaluation Standards of Preservative Effect in Cosmetics

[0091] Table 9 Evaluation results of anti-corrosion effect (R) x )

[0092]

[0093] As shown in Table 9 above, the bacteria, Candida albicans, and Aspergillus niger in samples of Application Examples 1-3 showed a continuous decrease within 28 days, indicating that their preservative ability was qualified and met Standard A. However, phenoxyethanol, whether used in combination with a single component or individually (compared to Application Examples 1-6), failed to provide effective preservative protection on day 28 and did not meet any standard. Therefore, it can be concluded that the preservative composition of the present invention has considerable preservative ability. The combination of Artemisia annua fermentation broth powder and gluconolactone can replace a certain amount of phenoxyethanol and exhibits a certain synergistic preservative effect with phenoxyethanol. However, when Artemisia annua fermentation broth powder was replaced with Artemisia annua extract powder (compared to Application Examples 7-10), the preservative effect was not as good as that of the sample in Application Example 1. This indicates that the preservative effect of Artemisia annua extract powder is far inferior to that of Artemisia annua fermentation broth powder, and the Artemisia annua fermentation broth powder provided by the present invention is superior.

[0094] Experiment Example 5: Microbial Barrier Repair Effect Test

[0095] The effects of the samples provided in Example 1 and the samples provided in Comparative Examples 1-10 on the repair of the microbial barrier were tested through experiments on the restoration effect of the skin microecology and the inhibition effect of Staphylococcus aureus.

[0096] Experimental Principle: The method for determining the number of viable microorganisms commonly uses the plate culture counting method. This involves preparing a series of uniform dilutions of the sample, inoculating a specific amount of each dilution onto a petri dish containing a specific culture medium, and finally calculating the number of viable bacteria per gram (or milliliter) of sample based on the number of colonies that grow on the plates. In this test, inactivated cotton swabs are used to collect skin colonies from a fixed area of ​​the skin. After collection, the swabs are immersed in inactivated physiological saline, shaken to disperse the microorganisms, and then the number of viable microorganisms is determined.

[0097] Experimental methods:

[0098] (1) Mark the inner sides of the left and right arms with 3×3cm in the experiment. 2 The test area can be marked with multiple areas on the same arm, spaced 1 cm apart. The test product and the blank control are randomly distributed on both arms.

[0099] (2) Select 16 areas. Wipe each area 50 times with a sterile cotton swab dipped in a small amount of physiological saline. Then soak the cotton swab in the same volume of physiological saline and shake it with a vortex mixer. After shaking to disperse the microorganisms, determine the number of viable microorganisms. This sample is taken as the initial colony count of the skin and recorded as A0.

[0100] (3) Afterwards, at 6 hours and 12 hours, a sterile cotton swab dipped in a small amount of physiological saline was used to wipe the skin 50 times. Then, the cotton swab was soaked in the same volume of physiological saline and shaken with a vortex mixer. After shaking to disperse the microorganisms, the number of viable microorganisms was determined. This sample was used as the recovery value of skin colony count and was recorded as A1.

[0101] Skin colony recovery rate = [(A0-A1) / A0] × 100%

[0102] The recovery rates of bacterial colonies on skin treated with different methods are shown in Table 10.

[0103] Table 10. Colony recovery rate of skin under different treatments

[0104]

[0105] As shown in Table 10, the sample provided in Application Example 1 allowed the skin's bacterial count to recover to over 80% within 6 hours after the microecology was disrupted, and the bacterial count essentially returned to pre-disruption levels after 12 hours. Phenoxyethanol (comparative Application Example 1) has a certain destructive effect on the skin microbiota. Combining Application Example 1, Comparative Application Example 4, and Comparative Application Example 5, it was found that Artemisia annua fermentation powder and gluconolactone have a certain synergistic effect on the recovery rate of the skin microbiota, significantly improving the damage caused by phenoxyethanol. However, replacing the Artemisia annua fermentation powder with Artemisia annua extract powder showed that the Artemisia annua extract powder had virtually no effect on the recovery of the skin microbiota and did not have a synergistic effect with gluconolactone. This indicates that the Artemisia annua fermentation powder provided by this invention is the preferred choice. The preservative composition provided by this invention achieves the repair of the skin microecology, bringing the resident microbiota to a beneficial balance, allowing the skin to maintain healthy metabolism.

Claims

1. A microecological preservative composition suitable for sensitive skin, characterized in that it is... It is a compound made of phenoxyethanol, Artemisia annua fermentation broth powder and gluconolactone; wherein, by mass ratio, phenoxyethanol: Artemisia annua fermentation broth powder: gluconolactone = 1:0.5~2:1~2; The preparation method of Artemisia annua fermentation broth powder is as follows: Artemisia annua is first pulverized and extracted by reflux with 55-65% ethanol. The extract is concentrated and the ethanol is removed to obtain Artemisia annua extract. The Artemisia annua extract is added to TSB medium and inoculated with a mixed culture of 2-5% Lactobacillus plantarum and Saccharomyces cerevisiae. After aerobic fermentation at 28-32℃ for 10-15 hours, it is transferred to anaerobic fermentation at 22-28℃ for 40-55 hours, during which the pH is monitored to decrease to 4.2-4.

5. After fermentation, the mixture is centrifuged, vacuum concentrated at low temperature, and freeze-dried to obtain Artemisia annua fermentation broth powder. The OD values ​​of the two strains in the mixed culture of Lactobacillus plantarum and Saccharomyces cerevisiae are... 600 The concentrations were all 0.45–0.55, and the volume ratio of Lactobacillus plantarum to Saccharomyces cerevisiae was 1.8–2.2:1; the mass ratio of TSB medium to Artemisia annua extract was 4–6:

1.

2. The use of the microecological preservative composition according to claim 1 in the preparation of cosmetics for sensitive skin.

3. The application as described in claim 2, characterized in that, The aforementioned microecological preservative composition also has anti-aging effects.

4. The application as described in claim 2, characterized in that, The cosmetic product is any one of the following: cleansing cream, cleansing paste, facial cleanser, bath liquid, face cream, toner, and face mask.

5. The application as described in claim 4, characterized in that, The total amount of the microecological preservative composition added to cosmetics is ≤0.5%.

Citation Information

Patent Citations

  • Propionibacterium acnes with good antioxidant effect and application of propionibacterium acnes

    CN116904332A

  • Preparation method of artemisia apiacea fermentation product with soothing, oil-controlling and bacterium-inhibiting effects as well as product and application of artemisia apiacea fermentation product

    CN118697682A