Genetically modified cell and application thereof in synthesis of human milk oligosaccharide

Abstract

The invention relates to a genetically modified cell, and belongs to the technical field of biological genetic engineering. The invention provides a genetically modified cell, which contains a heterologous nucleic acid sequence of an alpha-1, 3-fucosyltransferase polypeptide. The alpha-1, 3-fucosyltransferase polypeptide further comprises but is not limited to derived polypeptides M1-M21 of the polypeptide with the amino acid sequence as shown in SEQ ID NO: 1, and compared with the polypeptide as shown in SEQ ID NO: 1, the 3-FL catalytic synthesis capability of the derived polypeptides and the specificity of a catalytic substrate are both improved.

Description

Technical Field

[0001] The present invention relates to a gene-modified cell containing a fucosyltransferase polypeptide gene, which can be applied to the synthesis of human milk oligosaccharides (HMOs) and belongs to the technical field of biological genetic engineering. Background Art

[0002] Human milk oligosaccharides (HMOs) are a unique and diverse mixture of oligosaccharides found in human milk. 3-fucosyllactose (3-FL) is a representative example of fucosylated HMOs and one of the most abundant HMOs in human breast milk. 3-FL is the only HMO whose concentration increases during lactation, suggesting a broader application in areas such as follow-on formula.

[0003] 3-FL has been approved for marketing by the U.S. FDA, the European Union, Australia, Singapore and other countries and regions. Its intended uses include infant formula and follow-on formula, infant food, food for special medical purposes and food supplements.

[0004] Research into the synthesis of 3-FL is crucial for the commercial application of HMOs, particularly identifying efficient, low-cost, and environmentally friendly synthetic routes. In recent years, research into the bioproduction of 3-FL has rapidly advanced, demonstrating numerous advantages over chemical synthesis routes. Therefore, the development of efficient methods for the production of 3-FL is urgently needed to lay a crucial foundation for the generation of more valuable human milk oligosaccharides.

[0005] Chinese patent 202111404385.4 discloses a recombinant Escherichia coli that expresses α-1,3-fucosyltransferase from Bacteroides gallinaceum, and simultaneously expresses genes for phosphomannose mutase, mannose-6-phosphate isomerase, GDP-L-fucose synthase, and GDP-D-mannose dehydrogenase from Escherichia coli; and knocks out the UDP-glucose lipid carrier transferase and β-galactosidase genes. Patent 202011223864.1 discloses a recombinant Bacillus subtilis for producing 3-FL. The recombinant Bacillus subtilis 1643FL is obtained by integrating a fusion gene fragment encoding fructose 6-phosphate isomerase, phosphomannose mutase, and mannose-1-phosphate guanyltransferase at the manA site of Bacillus subtilis, and integrating a fusion gene fragment encoding GDP-mannose dehydratase, GDP-L-fucose synthase, and α-1,3 fucosyltransferase at the xylA-xylB site. The 3-FL concentration detected in the fermentation broth of the obtained recombinant Bacillus subtilis was 6.2 g / L.

[0006] As the importance of HMOs to the human body is gradually recognized, the social demand for them will gradually increase. In order to meet social needs, it is necessary to improve the fucosyllactose synthesis technology to increase the efficiency of fucose synthesis and meet social needs. Summary of the Invention

[0007] Purpose of the invention: To provide a genetically modified cell and its use in synthesizing fucosyllactose, wherein the cell has the activity of synthesizing fucosyllactose de novo using lactose and glucose, or glycerol, or sucrose as carbon sources. The fucosyllactose includes but is not limited to 3-fucosyllactose (3-FL).

[0008] The technical solution of the present invention:

[0009] A genetically modified cell contains a heterologous nucleic acid sequence for an α-1,3-fucosyltransferase polypeptide.

[0010] Preferably, the genetically modified cell further comprises a heterologous nucleic acid sequence of GDP-L-fucose synthase polypeptide (GMER) and / or GDP-mannose dehydratase polypeptide (GMD).

[0011] The gene cell can synthesize fucosyllactose from scratch using lactose and glucose, or glycerol, or sucrose as carbon sources.

[0012] Preferably, the fucosyllactose includes 3-fucosyllactose (3-FL).

[0013] Preferably, the genetically modified cells include, but are not limited to, genetically modified cells of yeast sp., Bacillus sp., and Escherichia sp.

[0014] Preferably, the genetically modified cells include but are not limited to genetically modified cells of Escherichia coli, Bacucilius cereus, Kluyveromyces lactis, Kluyveromyces marxianus, Yarrowia lipolytica, Saccharomyces paradoxus, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cariocas, Saccharomyces mikatae, Saccharomyces kudriavzevii and Escherichia coli.

[0015] Preferably, the genetically modified cells include but are not limited to Kluyveromyces lactis genetically modified cells and Maxim Kluyveromyces gene modified cells.

[0016] Preferably, the genetically modified cell further comprises a nucleic acid sequence of a marker gene.

[0017] The α-1,3-fucosyltransferase polypeptide described herein refers to a polypeptide that can catalyze the transfer of a fucose residue from a donor substrate to an acceptor molecule. The donor substrate for transferring the fucose residue to the acceptor molecule is typically guanosine diphosphate-L-fucose (GDP-L-fucose). Suitable acceptor molecules for fucose residues include oligosaccharides, glycopeptides, glycoproteins, and glycolipids. Typically, the fucose residue is transferred to, for example, an N-acetylglucosamine residue, an N-acetylgalactosamine residue, a galactose residue, a fucose residue, a sialic acid residue, or a glucose residue of an oligosaccharide, or a sugar portion of a glycoprotein or glycolipid.

[0018] Preferably, the α-1,3-fucosyltransferase polypeptide (α-1,3-fucosyltransferase) is derived from Bacillus smithii in nature and is named BSFut3t-wt. Its amino acid sequence is shown in SEQ ID NO: 1 and its nucleotide sequence is shown in SEQ ID NO: 6. It has low catalytic synthesis of 3-FL activity, accompanied by an undesirable side activity of synthesizing difucosyllactose (DFL). It has an amino acid sequence similarity of 33.96% with the α-1,3-fucosyltransferase (α-1,3-fucosyltransferase) derived from Helicobacter pylori, named HPFutA-wt, whose amino acid sequence is shown in SEQ ID NO: 2.

[0019] In some embodiments, the α-1,3-fucosyltransferase polypeptide also includes but is not limited to a derivative polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, wherein the derivative polypeptide has improved ability to catalyze the synthesis of 3-FL and catalytic substrate specificity compared to BSFut3t-wt.

[0020] Preferably, the derivative polypeptide includes but is not limited to the polypeptide with an amino acid sequence as shown in SEQ ID NO: 1, obtained by modification or substitution of at least one of positions 2, 17, 21-22, 27, 45-48, 69-72, 97-103, 118, 125-127, 133-135, 138-139, 141, 156, 162-165, 223, 227-229, 243, 247-248, 255, 260-263, and 268.

[0021] Preferably, the modification or substitution is a mutation.

[0022] Preferably, the α-1,3-fucosyltransferase polypeptide is selected from the polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 and its derivative polypeptides M1-M21, and the derivative polypeptides M1-M21 are specifically as follows:

[0023] 1) In the amino acid sequence shown in SEQ ID NO: 1, the amino acid at position 2 is substituted from K to T, thereby obtaining polypeptide M1;

[0024] 2) In the amino acid sequence of M1, the amino acid at position 17 is replaced by K to R, thereby obtaining polypeptide M2;

[0025] 3) In the amino acid sequence of M2, the amino acid segment at positions 21-22 is replaced by KN to NS, thereby obtaining polypeptide M3;

[0026] 4) In the amino acid sequence of M3, the amino acid at position 27 is replaced by K to N, thereby obtaining polypeptide M4;

[0027] 5) In the amino acid sequence of M4, the amino acid fragment at positions 45-48 is replaced by FFSD to IYSC, thereby obtaining polypeptide M5;

[0028] 6) In the amino acid sequence of M5, the amino acid fragment at positions 69-72 is replaced by EPDF with QPNL, thereby obtaining polypeptide M6;

[0029] 7) In the amino acid sequence of M6, the amino acid segment at positions 97-103 is replaced by YKYKEAL to FLYTQDY, thereby obtaining polypeptide M7;

[0030] 8) In the amino acid sequence of M7, the amino acid at position 118 is replaced by E to K, thereby obtaining polypeptide M8;

[0031] 9) In the amino acid sequence of M8, the amino acid fragment at positions 125-127 is replaced by CFN to NFI, thereby obtaining polypeptide M9;

[0032] 10) In the amino acid sequence of M9, the amino acid fragment at positions 133-135 is replaced by YDE to AHR, thereby obtaining polypeptide M10;

[0033] 11) In the amino acid sequence of M10, the amino acid fragment at positions 138-139 is replaced by IK to FE, thereby obtaining polypeptide M11;

[0034] 12) In the amino acid sequence of M11, the amino acid at position 141 is substituted from Y to I, thereby obtaining polypeptide M12;

[0035] 13) In the amino acid sequence of M12, the amino acid at position 156 is replaced by T to I, thereby obtaining polypeptide M13.

[0036] 14) In the amino acid sequence of M13, the amino acid fragment at positions 162-165 is replaced by FLIE with YRVD, thereby obtaining polypeptide M14;

[0037] 15) In the amino acid sequence of M14, the amino acid at position 223 is replaced by T to C, thereby obtaining polypeptide M15;

[0038] 16) In the amino acid sequence of M15, the amino acid segment at positions 227-229 is replaced by SSY to KSK, thereby obtaining polypeptide M16;

[0039] 17) In the amino acid sequence of M16, the amino acid at position 243 is substituted from K to D, thereby obtaining polypeptide M17;

[0040] 18) In the amino acid sequence of M17, the amino acid segment at positions 247-248 is replaced by TE to SQ, thereby obtaining polypeptide M18;

[0041] 19) In the amino acid sequence of M18, the amino acid at position 255 is substituted from F to L, thereby obtaining polypeptide M19;

[0042] 20) In the amino acid sequence of M19, the amino acid fragment at positions 260-263 is replaced by NPEE with DPEK, thereby obtaining polypeptide M20;

[0043] 21) In the amino acid sequence of M20, the amino acid at position 268 is substituted from A to E, thereby obtaining polypeptide M21.

[0044] Peptides M1-M21 reduce or eliminate the production of the byproduct difucosyllactose (DFL).

[0045] In certain embodiments, the α-1,3-fucosyltransferase polypeptides include, but are not limited to, polypeptides having an amino acid sequence that is at least 60% identical to the polypeptide set forth in SEQ ID NO: 1 or derivative polypeptides M1-M21. In certain embodiments, the substitution mutation comprises a mutation to a charged residue; in certain embodiments, the substitution mutation comprises a mutation to a basic residue. In certain embodiments, the substitution mutation comprises a mutation homologous to the amino acid sequence described in 1)-21) above.

[0046] The method for producing the polypeptide as described above in the present application comprises:

[0047] (1) culturing a transformed host cell under conditions suitable for expressing the derivative polypeptide; the transformed host cell is as described in the fifth aspect above; and

[0048] (2) Recovering the polypeptide.

[0049] In a specific embodiment, the step (1) comprises: firstly introducing a nucleic acid construct or a recombinant expression vector encoding the polypeptide as described in the first aspect above into a host cell to construct an engineered host cell expressing the polypeptide; then, culturing the engineered host cell and inducing it to express the polypeptide.

[0050] In a specific embodiment, the step (2) includes the steps of isolating and purifying the polypeptide from the culture.

[0051] The host cells include but are not limited to natural strains or genetically modified strains of bacteria, yeast, mold, etc.;

[0052] Further preferably, the host cell includes but is not limited to natural strains or genetically modified strains of Escherichia sp., Bacillus sp., Kluyveromyces sp., etc.;

[0053] Further preferably, the host cell includes but is not limited to natural strains or genetically modified strains such as Kluyveromyces marxianus, Kluyveromyces lactis, and Yarrowia lipolytica.

[0054] More preferably, the host cell is the genetically engineered Escherichia coli BL21 (DE3).

[0055] Can use methods known in the art, in the nutrient medium that is suitable for producing polypeptide, cultivate host cell.For example, can pass through shake flask culture, or in applicable substratum and under the condition of allowing polypeptide expression and / or separation, carry out small-scale or large-scale fermentation (comprising continuous fermentation, batch fermentation, batch-fed fermentation or solid-state fermentation) to cultivate cell in laboratory or industrial fermentor tank.Cultivation is to use program known in the art, occurs in applicable substratum, and described substratum comprises carbon and nitrogen source and inorganic salt.Applicable substratum can be purchased through commercial channels, or according to disclosed composition preparation.

[0056] The polypeptide may be recovered from the culture using methods known in the art. For example, the variant may be recovered from the nutrient medium by a variety of conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0057] In addition, the polypeptide can be purified by various procedures known in the art to obtain substantially pure polypeptides, including but not limited to chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography), electrophoresis procedures (e.g., preparative isoelectric focusing), differential solubility methods (e.g., ammonium sulfate precipitation), SDS-PAGE, salting out, etc. or a combination thereof; further preferably, purification can be performed by Ni column affinity chromatography.

[0058] Preferably, the GDP-fucose synthase polypeptide gene is derived from, but not limited to, Escherichia coli, Mus musculus, Musmusculus), Homo sapiens, Marinobacter salarius, Sinorhizobium fredii, citrobacter, Pongo abelii, Caenorhabditis elegans, Candidatus Staskawiczbacteria, Azorhizobium caulinodans or Candictus Nitrospira nitrificans, etc., natural strains or genetically modified strains.

[0059] Preferably, the GDP-mannose dehydratase polypeptide gene sources include but are not limited to: Escherichia coli, Caenorhabditis elegans, Homo sapiens, Arabidopsis thaliana, Dictyostelium discoideum, Mus musculus, Drosophila melanogaster, Sinorhizobium fredii, Pandoraea vervacti, Bacterial nematode

[0060] Natural strains or genetically modified strains of Caenorhabditis briggsae, Candidatus Curtissbacteria, Pseudomonas sp., Clostridium sp., Cricetulus griseus, Arthrobacter siccitolerans, Paraburkholderia piptadeniae, Bacillus smithii and Bacillus smithii, etc.

[0061] In one embodiment, the genetically modified cell is a yeast genetically modified cell.

[0062] Preferably, the yeast genetically modified cells, including but not limited to Kluyveromyces genetically modified cells, have been genetically engineered to contain increased intracellular GDP-fucose and fucosyllactose production capacity compared to the starting strain.

[0063] Preferably, the yeast genetically modified cell has been genetically engineered to have the following characteristics:

[0064] 1) Expressing at least one of genes encoding GDP-mannose dehydratase and GDP-fucose synthase.

[0065] 2) Expressing a gene encoding an α-1,3-fucosyltransferase polypeptide.

[0066] Optionally, the Kluyveromyces genetically modified cell further comprises: 3) disruption of the galactosidase gene lac4.

[0067] The present invention also provides a genetically modified cell containing a molecular marker, wherein the amino acid sequence of the molecular marker is shown in SEQ ID NO:5.

[0068] Preferably, the nucleotide sequence of the molecular marker of the genetically modified cell containing the molecular marker is shown as SEQ ID NO: 7.

[0069] The present invention also provides a method for preparing genetically modified cells. The method uses yeast cells as a starting strain and integrates a heterologous α-1,3-fucosyltransferase gene, a heterologous GDP-fucose synthase gene, and a heterologous GDP-mannose dehydratase gene into the Kluyveromyces genome, respectively.

[0070] Preferably, the genetically modified cells in the preparation method are genetically modified cells of Kluyveromyces; further preferably, they are genetically modified cells of Kluyveromyces lactis or Kluyveromyces marxianus.

[0071] More preferably, the starting strain of Kluyveromyces lactis is K. lactis DSM 70799, and the starting strain of Kluyveromyces marxianus is K. marxianus DMKU 3-1042.

[0072] Preferably, the method for preparing the genetically modified yeast cells comprises the following steps:

[0073] (1) Cultivate the starting strain;

[0074] Preferably, the starting strain includes but is not limited to natural cells or genetically modified cells of Kluyveromyces cells;

[0075] Preferably, the Kluyveromyces cell is selected from natural cells or genetically modified cells of Kluyveromyces lactis cells K. lactis or Kluyveromyces marxianus cells K. marxianus.

[0076] Preferably, the starting strain is selected from Kluyveromyces lactis cells K. lactis DSM 70799;

[0077] Preferably, the starting strain is selected from Kluyveromyces marxianus DMKU3-1042.

[0078] (2) constructing an expression cassette and introducing heterologous GDP-mannose dehydratase gene and heterologous GDP-fucose synthase gene into yeast cells;

[0079] (3) Constructing an expression cassette and introducing the α-1,3-fucosyltransferase polypeptide gene described in the present application into yeast cells.

[0080] (4) destroying the β-galactosidase gene lac4 in the strain obtained in step (1);

[0081] Optionally, the genetically modified cell further comprises:

[0082] (5) Construct a molecular marker expression cassette and introduce the marker gene into Kluyveromyces cells.

[0083] Preferably, the method further comprises the step of (6) recovering the genetically modified yeast cells.

[0084] Optionally, in the method for preparing genetically modified yeast cells as described above, the steps are not ordered in any particular order.

[0085] In some embodiments of the present invention, a method for preparing fucosyllactose is provided, wherein the preparation method synthesizes fucosyllactose by fermentation using the genetically modified cells described in the present application.

[0086] Preferably, the fucosyllactose in the preparation method includes but is not limited to 3-fucosyllactose.

[0087] Preferably, the genetically modified cells in the preparation method include but are not limited to genetically modified yeast cells.

[0088] Further preferably, the yeast gene-modified cells in the preparation method include but are not limited to Kluyveromyces gene-modified cells.

[0089] Further preferably, the Kluyveromyces genetically modified cells in the preparation method include but are not limited to Kluyveromyces lactis genetically modified cells or Kluyveromyces marxianus genetically modified cells.

[0090] In some embodiments, the fermentation in the preparation method requires the use of a culture medium, which can be any culture medium that can maintain the growth and vitality of the genetically modified cells that produce fucosyllactose. In some embodiments, the culture medium can also include appropriate salts, minerals, metals or other nutrients. In some embodiments, a carbon source and nutrients necessary for each cell growth are added to the culture medium in an incremental or continuous manner.

[0091] The preparation method uses lactose and sucrose, or glycerol, or glucose as carbon sources to synthesize fucosyllactose from scratch.

[0092] In some embodiments, the culture medium does not contain fucose.

[0093] In some embodiments, the method further comprises adjusting the mass ratio of the carbon source (such as sucrose) to lactose to adjust the yield of fucosyllactose.

[0094] Preferably, the fermentation product of the genetically modified yeast cells can be purified by centrifugation, filtration, decolorization, nanofiltration, chromatography, crystallization, recrystallization, etc. to obtain pure fucosyllactose.

[0095] The present application also provides a method for preparing fucosyllactose, which utilizes the genetically modified cells described in the present application to synthesize fucosyllactose from scratch by fermentation using lactose and sucrose, or glycerol, or glucose as carbon sources.

[0096] Preferably, the fucosyllactose includes but is not limited to 3-fucosyllactose (3-FL).

[0097] In this step, the mixture containing 3-FL can be separated and purified in a conventional manner. Preferably, the mixture containing 3-FL is clarified by centrifugation, flocculation, decantation and / or filtration.

[0098] Preferably, substantially all proteins, as well as amino acids, RNA and DNA, etc., are removed from the mixture containing 3-FL (preferably after clarification). In this step, proteins and related impurities can be removed from the mixture containing 3-FL in a conventional manner. Optionally, purification can be performed by ultrafiltration, nanofiltration, reverse osmosis, microfiltration, activated carbon or carbon treatment, chromatography, ion exchange chromatography (such as but not limited to cation exchange, anion exchange, mixed bed ion exchange), hydrophobic interaction chromatography and / or gel filtration (i.e., size exclusion chromatography), in particular by chromatography, more particularly by ion exchange chromatography or hydrophobic interaction chromatography or ligand exchange chromatography.

[0099] 3-FL is further isolated from the reaction mixture and subjected to further purification steps using techniques well known in the art such as evaporation, lyophilization, crystallization, precipitation and / or drying, spray drying.

[0100] The term "identity" refers to amino acid sequence identity and refers to the percentage of two or more sequences or subsequences that are identical, or that have identical amino acid residues or nucleotides, when compared and aligned for maximum correspondence. An example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[0101] The term "polypeptide" refers to any peptide or protein comprising two or more amino acids linked to each other by peptide bonds or modified peptide bonds. "Polypeptide" refers to short chains (commonly referred to as peptides, oligopeptides, and oligomers) as well as long chains (commonly referred to as proteins). "Polypeptides" include those modified by natural processes (such as processing and other post-translational modifications) and by chemical modification techniques. These modifications are fully documented in basic textbooks and in more detail in monographs, as well as in a large body of research literature, and are well known to those skilled in the art.

[0102] The term "a nucleic acid sequence encoding an enzyme for 3-FL synthesis" relates to a nucleic acid sequence encoding an enzyme essential for the synthesis pathway of 3-FL, for example, an enzyme capable of transferring the fucose moiety of a GDP-fucose donor substrate to the 2'-hydroxyl group of the galactose moiety of lactose, thereby producing 3-FL.

[0103] Beneficial effects:

[0104] The present application provides a genetically modified cell containing the polypeptide shown in SEQ ID NO: 1 and the M1-M21 polypeptide, wherein the genetically modified cell has a high ability to synthesize 3-FL; wherein the genetically modified cell containing the polypeptide gene of M1-M21 reduces the DFL-producing side activity of the polypeptide shown in SEQ ID NO: 1.

[0105] The technical solution of the present application has positive significance for the industrial production of human milk oligosaccharides. The method is green, efficient, and sustainable, is conducive to the application of industrial large-scale production, and has important practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] Figure 1 HPLC chromatograms of lactose, a 3-FL standard, a DFL standard, a reaction solution containing the polypeptide of SEQ ID NO: 1, and a reaction solution containing genetically modified KL-M13-J cells. The RT of lactose was 9.98 min, that of the 3-FL standard was 11.43 min, and that of the DFL standard was 13.00 min.

[0107] Figure 2.Mass spectrometry analysis of 3-FL standard. The results show that the sodium addition mode of 3-FL standard is 511.17 and the molecular weight of 3-FL is 488.2, which is within the allowable error range with the theoretical molecular weight of 488.4.

[0108] Figure 3 . Figure 1 The LC-MS analysis of the substance with an RT of about 11.43 min in the HPLC spectrum of the reaction liquid of the gene-modified cell KL-M13-J showed that it was consistent with the mass spectrum of the 3-FL standard, thus proving that 3-FL was successfully synthesized.

[0109] Figure 4 .Comparison of amino acid sequences of SEQ ID NO:1 and SEQ ID NO:2. DETAILED DESCRIPTION

[0110] The present invention is further described in detail below through examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Modifications or replacements to the details and forms of the technical solution without departing from the structural ideas and scope of use of the present invention fall within the scope of protection of the present invention.

[0111] It should be noted that the terms used are only for the purpose of describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention. In the following specific embodiments, if the experimental methods for specific conditions are not specified, they are generally in accordance with the conventional methods and conditions of molecular biology within the technology of the art, and such techniques and conditions are fully explained in the literature. See, for example, Sambrook et al., the techniques and conditions described in "Molecular Cloning: A Laboratory Manual", or in accordance with the conditions recommended by the manufacturer.

[0112] In the following specific embodiments, if the experimental methods for specific conditions are not specified, they are generally based on conventional methods and conditions of molecular biology within the art, and such techniques and conditions are fully explained in the literature; all materials, reagents, etc., unless otherwise specified, can be obtained from commercial channels.

[0113] In the following examples, the alpha-1,3-fucosyltransferase involved is derived from Bacillus smithii, with an amino acid sequence as shown in SEQ ID NO: 1 and a nucleotide sequence as shown in SEQ ID NO: 6; or is derived from Helicobacter pylori, with an amino acid sequence as shown in SEQ ID NO: 2.

[0114] Abbreviations in the following examples: GDP-L-fucose synthase, abbreviated as GMER, derived from Escherichia coli, with an amino acid sequence as shown in SEQ ID NO: 3. GDP-mannose dehydratase, abbreviated as GMD, derived from Escherichia coli, with an amino acid sequence as shown in SEQ ID NO: 4. Molecular marker, abbreviated as tag, artificial sequence, with an amino acid sequence as shown in SEQ ID NO: 5 and a nucleotide sequence as shown in SEQ ID NO: 7.

[0115] 3-FL and DFL standards are produced by ELICITYL, France.

[0116] Example 1. Expression of the polypeptide shown in SEQ ID NO: 1 and polypeptides M1-M21 in Escherichia coli.

[0117] 1. Using the amino acid sequences of the polypeptides shown in SEQ ID NO: 1 and SEQ ID NO: 2 as templates, their nucleotide sequences were synthesized respectively and finally constructed into the PET32a vector to obtain PET32a-wt and PET32a-HPFutA plasmids.

[0118] 2. According to the method of Molecular Cloning Experiment Guide, the sequence of PET32a-wt shown in SEQ ID NO: 3 was used by Primer-BLAST ( Primer designing tool (nih.gov) ) mutant primers were designed, and a recombinant plasmid series (pET32a-M1 to pET32a-M21) were constructed using a point mutagenesis kit (Fast Mutagenesis Kit).

[0119] 3. Transform the above recombinant plasmids into Escherichia coli BL21 (DE3) according to the following steps:

[0120] Take the prepared Escherichia coli BL21 (DE3) competent cells, place them on ice for 30 minutes to thaw, take 100 μL of competent cells and 10 μL of pET32a-M1 to pET32a-M21 recombinant plasmids (concentration 50 ng / μL), respectively, mix them, place them in a 42°C water bath for 45 seconds, then immediately cool them in an ice bath for 2 minutes, add 1 mL of fresh LB medium (LB medium: 1.0% peptone, 0.5% yeast extract, 1.0% NaCl, and 1.5% agar powder on the plate), and resuscitate and culture at 37°C and 100 rpm for 1 hour. Then, take 100 μL of the bacterial solution and spread it on an LB plate containing ampicillin (100 μg / mL). After culturing in a 37°C constant temperature incubator for 12 hours, pick a single colony for colony PCR to screen positive transformants.

[0121] 4. Culture positive transformants, extract their plasmids, and use double enzyme digestion and gene sequencing to verify whether the recombinant plasmids pET32a-M1 to pET32a-M21 are successfully introduced into E. coli.

[0122] 5. Inoculate the correct transformant into LB liquid medium and culture it on a shaker at 37°C and 200 rpm for 12 hours to obtain seed solution. Then, inoculate the seed solution into fresh LB medium at a 1% (v / v) inoculum and culture it at 37°C with shaking until the OD 600 The expression of the culture medium was 0.8, and then induced with isopropyl-β-D-thiogalactopyranoside (IPTG) with a final IPTG concentration of 0.1 mmol / L, and induced at 16°C for 12 h at a speed of 200 rpm; after induction of expression, the fermentation broth was centrifuged at 5000 r / min for 30 min at 4°C to collect the bacteria; the bacteria were resuspended in 20 mM pH 7.4 PBS buffer and ultrasonicated at a frequency of plus on 5s / off 5s for 30 min to break the bacteria; the broken liquid was centrifuged at 13000×g and 4°C for 30 min to remove cell debris, and the supernatant was collected.

[0123] 6. The soluble polypeptide sequence was purified using nickel column affinity chromatography. The process was as follows: deionized water was added to the top of the nickel column. After natural elution, it was eluted with 5 volumes of Binding buffer. The crude enzyme solution filtered through a 0.45 μm filter membrane was then loaded onto the column. The sample was fully bound to the nickel column at a flow rate of 1.5 mL / min. After the sample was dried, it was continuously eluted with 5 column volumes of Washing buffer to remove impurities. Finally, the target protein was eluted with 5 times the volume of Elution buffer and the eluate was collected. Then, the expression of the target protein was analyzed by SDS-PAGE.

[0124] The SDS-PAGE results showed that the genetically engineered bacteria had obvious specific expression bands after induction, and the molecular weight of the bands was basically consistent with the expected molecular weight of 35.3 kDa. Therefore, it can be seen that the polypeptides shown in SEQ ID NO: 1 and SEQ ID NO: 2, as well as M1-M21 polypeptides were obtained. The relevant information is shown in Table 1.

[0125] Table 1. Corresponding numbers of α-1,3-fucosyltransferase polypeptides and their amino acid sequences

[0126]

[0127]

[0128] Example 2. Determination of the ability of the polypeptides obtained in Example 1 (polypeptides represented by SEQ ID NO: 1 and SEQ ID NO: 2, and polypeptides M1-M21) to serve as catalysts for the synthesis of 3-FL.

[0129] 3-FL was synthesized using the purified polypeptide represented by SEQ ID NO: 1 or SEQ ID NO: 2 or one of the M1-M21 polypeptides obtained in Example 1 as a catalyst, and lactose and GDP-L-fucose as reaction substrates, respectively. The specific procedures are as follows:

[0130] 0.2 mg / mL of the purified polypeptide represented by SEQ ID NO: 1 or SEQ ID NO: 2 or one of the M1-M21 polypeptides obtained in Example 1 was added to 40 mM lactose, 15 mM GDP-L-fucose, 10 mM MnCl2, and 25 mM Tris-HCl, pH 7.5, respectively. The mixture was mixed and reacted at 37° C. for 6 hours. The reaction was terminated and the product was purified by gel column method.

[0131] Identification of catalytic synthesis products:

[0132] HPLC detection conditions: chromatographic column model: Shodex Asahipak NH2P-50 4E, mobile phase: 65% acetonitrile in water, flow rate: 0.5 mL / min, column temperature: 35°C, injection volume: 10 μL, evaporative light detector, evaporation temperature 75°C, and nebulization temperature 45°C.

[0133] LC-MS analysis conditions are as follows:

[0134] Chromatographic column model: Shodex Asahipak NH2P-50 4E, detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 0.5 mL / min, column temperature: 35 °C, mobile phase: acetonitrile: water

[0135] =65:35; ESI-MS mode, molecular weight scanning range 100~800.

[0136] The standard and reaction solution were tested using the aforementioned analytical method. HPLC analysis revealed that the peak elution time (RT) of the 3-FL standard was 11.43 min. The reaction solutions of the polypeptide described in Example 1 all exhibited a strong absorption peak around 11.43 min, consistent with the peak elution time of the 3-FL standard, indicating that the polypeptide-catalyzed reaction in Example 1 produced 3-FL.

[0137] In addition: HPLC analysis of DFL standard (attached Figure 1 )rt is 13.00min, the reaction solutions of the polypeptide shown in SEQ ID NO: 1 and polypeptides M1 and M3 have a weak peak at rt of 13.00min; the reaction solutions of polypeptide M2 ​​and polypeptides M4-M21 have no peak at this position, among which the HPLC spectrum of the reaction solution of polypeptide M18 (attached) Figure 1 ).

[0138] HPLC analysis results showed that the reaction solution of the polypeptide represented by SEQ ID NO: 2 also had a weak peak at rt of 13.00 min, indicating that the reaction products of the polypeptide represented by SEQ ID NO: 1 and SEQ ID NO: 2 both contained undesirable DFL.

[0139] The LC-MS analysis conditions are shown above, and the analysis results show:

[0140] The product of the HPLC chromatographic peak of the reaction solution at rt = 11.43 min was analyzed by LC-MS. Figure 2 The M+Na value in the fermentation broth was 511.17, which was consistent with the Figure 2 The mass spectrometry results of the 3-FL standard are consistent with the theoretical molecular weight of 3-FL, 488.4, within the allowable error range. This demonstrates that the polypeptides represented by SEQ ID NO:1 and M1-M21 were successfully synthesized from 3-FL. This suggests that the polypeptides represented by SEQ ID NO:1 and M1-M21, derived from Bacillus smithii, can replace the previously reported polypeptide represented by SEQ ID NO:2, derived from Helicobacter pylori, for the synthesis of 3-FL.

[0141] The yields of 3-FL and DFL in the fermentation broth were detected by the above-mentioned HPLC analysis method, and the results are recorded in Table 2.

[0142] Table 2. Studies on the synthesis of 3-FL catalyzed by various peptides

[0143]

[0144]

[0145] Table 2 Data Description:

[0146] (1) The catalytic reaction liquid of α-1,3-fucosyltransferase from Helicobacter pylori showed a 3-FL yield of 0.2 mg / mL and a DFL yield of 0.1 mg / mL, which proved that the α-1,3-fucosyltransferase from Bacillus smithii had a higher yield of 3-FL (0.5 mg / mL) than that from Helicobacter pylori.

[0147] (2) In the catalytic reaction liquids of the α-1,3-fucosyltransferase polypeptide having the amino acid sequence shown in SEQ ID NO: 1, DFL was detected as a byproduct in addition to 3-FL. In the catalytic reaction liquids of M2, M4-M21, only 3-FL was detected, and no byproduct DFL was detected.

[0148] The above results demonstrate that the peptides M2, M4-M21 derived from α-1,3-fucosyltransferase of Bacillus smithii have improved specificity in catalyzing the synthesis of 3-FL and eliminated the side activity of synthesizing DFL.

[0149] (3) Peptides M2-M5 and M7-M21 increased the activity of the polypeptide shown in SEQ ID NO:1 in synthesizing 3-FL.

[0150] Example 3. Preparation of genetically modified Kluyveromyces lactis cells.

[0151] (1) Construct a Kluyveromycin-modified cell expression cassette.

[0152] 1) Construction of the KL-ΔLAC4 knockout cassette.

[0153] Referring to the applicant's prior patent: 202211453172.5, invention name: Recombinant yeast and its application, a KL-ΔLAC4 knockout cassette was constructed.

[0154] 2) Construction of KL-ΔLAC4::GMD expression cassette.

[0155] Using the Kluyveromyces lactis genome as a template, the upstream and downstream homology arm sequences lac4 up and lac4-do, the promoter sequence tef1, and the terminator sequence adh1 were amplified; the synthesized gmd sequence was used as a template to amplify the gmd target gene sequence; using the expression cassette KL-ΔLAC4 as a template, the G418+loxp sequence was amplified, and lac4 up, tef1, gmd, adh1, G418+loxp, and lac4-do were fused by successive fusion PCR of two fragments. Finally, the expression cassette KL-ΔLAC4::GMD was amplified by PCR using primers lac4-upF and lac4-doR (Table 3) and the fusion PCR system as a template.

[0156] Table 3

[0157] plasmids Primers lac4-upF TTCGGACTGCGATTATTCGTGA lac4-doR TCTGCCGTATCTTTTAACGTCACA

[0158] 3) Construction of KL-ΔXK::GMER expression cassette.

[0159] Using the Kluyveromyces lactis genome as a template, the upstream and downstream homology arm sequences xk-up and xk-do of the xylulose kinase XKb coding region, the promoter sequence pgk1, and the terminator sequence tdh3 were amplified; using the synthetic gmer sequence as a template, the GMER target gene sequence was amplified; using the existing plasmid in the laboratory as a template, the G418+loxp sequence was amplified, and by sequential fusion PCR of two fragments, xyl1 up, pgk1, gmer, tdh3, G418+loxp, and xyl1-do were fused. Finally, using primers xK-upF and xK-doR as primers (Table 4), the fusion PCR system was used as a template to amplify the gmer expression cassette KL-ΔXK::GMER.

[0160] Table 4

[0161] plasmids Primers xK-upF GCACTAATAATTACCGAACTATAGAC xK-doR GATGATGGCTTCGTTCTTTGATG

[0162] 4) Construction of KL-ΔGK::BSFut3t-WT, KL-ΔGK::BSFut3t-M1 to KL-ΔGK::BSFut3t-M21, KL-ΔGK::HPFutA-WT expression cassettes.

[0163] Using the genomic DNA of Kluyveromyces lactis DSM 70799 as a template, PCR amplification was performed with primers galk up-F and galk up-R as well as galk down-F and galk down-R to obtain the upstream and downstream homology arms, respectively; using loxp-F and loxp-R as primers and the G418 resistance plasmid as a template, a resistance screening marker containing G418 resistance and loxp sites was amplified; using PET32a-BSFut3t-WT, PET32a-M1 to PET32a-M21 and PET32a-HPFutA-WT as templates, the original sequence and mutant sequence of the Fut3t gene were amplified by PCR; using the Kluyveromyces lactis genome as a template, the promoter tdh3 and terminator sequence tef of the transferase were amplified by PCR; using KL-PF and KL-PR as primers and the PUC19 plasmid as a template, the plasmid vector sequence was amplified by PCR. The upstream homology arm, promoter, target gene (original sequence and mutant sequence), terminator, G418+loxp and downstream homology arm were fused PCR to obtain ΔGK::BSFut3t-WT, ΔGK::BSFut3t-M1 to ΔGK::BSFut3t-M21 expression cassettes, and ΔGK::HPFutA-WT; the expression cassettes were connected to the plasmid vector sequence by ABclonal to obtain plasmids PUC-KL-WT, PUC-KL-M1 to PUC-KL-M21, and PUC-KL-HPFutA-WT carrying the ΔGK::BsFut3t-WT, ΔGK::HPFutA-WT, ΔGK::BSFut3t-M1 to ΔGK::BSFut3t-M21 expression cassettes, respectively.

[0164] Using primers galk up-F and galk down-R as templates, and PUC-KL-WT, PUC-KL-M1 to PUC-KL-M21, and PUC-KL-HPFutA-WT as templates, KL-ΔGK::BSFut3t-WT, KL-ΔGK::BSFut3t-M1 to KL-ΔGK::BSFut3t-M21 expression cassettes, and KL-ΔGK::HPFutA-WT were amplified for the next step of constructing recombinant strains.

[0165] Table 5. Primers for constructing KL-ΔGK::BSFut3t-WT, KL-ΔGK::BSFut3t-M1 to KL-ΔGK::BSFut3t-M21 expression cassettes, and KL-ΔGK::HPFutA-WT expression cassette

[0166]

[0167] (2) Transformation of the recombinant expression cassette and verification of the recombinant strain.

[0168] The expression cassettes constructed in (1) above were respectively transferred into the starting strain Kluyveromyces lactis DSM70799 cells. The specific method is:

[0169] 1) Prepare competent yeast cells: Take a small amount of frozen yeast strain and streak it on a solid culture medium plate, invert and culture at 30℃ for 2 days. Pick a single yeast colony in 50mL liquid culture medium and culture at 30℃, 220rpm until OD 600 The nitric oxide concentration (DNA saturation) should be between 0.8 and 1.5. Collect the cells, wash with 25 mL of sterile water, centrifuge at 1500 × g for 10 min at room temperature, and discard the supernatant. Add 1 mL of 100 mM lithium chloride buffer, resuspend the pellet, centrifuge at 12,000 rpm for 30 s, and discard the supernatant. Add 400 μL of 100 mM lithium chloride buffer again, resuspend the pellet, and obtain competent yeast cells. Aliquot 50 μL / tube for transformation.

[0170] Meanwhile, boil 1 mL of salmon sperm DNA for 5 min and quickly place on ice to prepare single-stranded DNA.

[0171] 2) Transformation: Centrifuge the competent yeast prepared above and remove any residual lithium chloride solution with a tip. For each transformation, add the following solution in the following order: 50% PEG3350 (240 μL); 1 M LiCl (36 μL); 2 mg / mL single-stranded Salmon sperm DNA (25 μL); and 50 μL of 5-10 μg / 50 μL plasmid DNA in water. Vortex vigorously until the precipitated yeast cells are completely distributed. Incubate in a 30°C waterbath for 30 min. Heat shock the cells in a 42°C waterbath for 20-25 min. Centrifuge at 8000 rpm for 10 min and harvest the yeast cells. Resuspend the yeast in 500 μL of liquid culture medium and incubate on a shaker at 30°C. After 1-4 h, spread 25-100 μL of the culture medium onto selective culture plates and incubate them upside down at 30°C.

[0172] 3) Verification: The correspondence between the recombinant strains and their genotypes is shown in Table 6. To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strains and performed PCR amplification using primers corresponding to the knockout or expression cassette. If a single band was obtained after PCR amplification and the size was consistent with the knockout or expression cassette, the strain was considered correct; otherwise, the strain was considered a false positive.

[0173] 4) Resistance Removal: Using the same transformation method, a plasmid carrying Cre recombinase was transferred into the strain and plated on a YPD plate containing 0.4 mg / mL culture medium. After culturing for 48 h, a single colony was picked and added to 2 mL of YPD liquid medium. After overnight culture, the collected bacteria were centrifuged and transferred to 2 mL of YPD liquid medium. 2% galactose was added and induced for 4-6 hours. The bacteria were streaked onto a YPD plate. After 2 days, the strain was picked for verification. A single colony that did not grow on plates containing G418 or hygromycin but grew on YPD plates was selected as the target strain for resistance removal.

[0174] Table 6. Genetically modified Kluyveromyces lactis cells and their genotypes

[0175] microbial cells genotype K.lacticDSM70799 WT KL-1 K.lacticDSM70799;ΔLAC4::GMD KL-2 KL-1;KL-ΔXK::GMER KL-3 KL-2;KL-ΔGK::BSFut3t-wt KL-4 KL-2;KL-ΔGK::HPFutA-WT KL-M1 KL-2;KL-ΔGK::BSFut3t-M1 KL-M2 KL-2;KL-ΔGK::BSFut3t-M2 KL-M3 KL-2;KL-ΔGK::BSFut3t-M3 KL-M4 KL-2;KL-ΔGK::BSFut3t-M4 KL-M5 KL-2;KL-ΔGK::BSFut3t-M5 KL-M6 KL-2;KL-ΔGK::BSFut3t-M6 KL-M7 KL-2;KL-ΔGK::BSFut3t-M7 KL-M8 KL-2;KL-ΔGK::BSFut3t-M8 KL-M9 KL-2;KL-ΔGK::BSFut3t-M9 KL-M10 KL-2;KL-ΔGK::BSFut3t-M10 KL-M11 KL-2;KL-ΔGK::BSFut3t-M11 KL-M12 KL-2;KL-ΔGK::BSFut3t-M12 KL-M13 KL-2;KL-ΔGK::BSFut3t-M13 KL-M14 KL-2;KL-ΔGK::BSFut3t-M14 KL-M15 KL-2;KL-ΔGK::BSFut3t-M15 KL-M16 KL-2;KL-ΔGK::BSFut3t-M16 KL-M17 KL-2;KL-ΔGK::BSFut3t-M17 KL-M18 KL-2;KL-ΔGK::BSFut3t-M18 KL-M19 KL-2;KL-ΔGK::BSFut3t-M19 KL-M20 KL-2;KL-ΔGK::BSFut3t-M20 KL-M21 KL-2;KL-ΔGK::BSFut3t-M21

[0176] The recombinant strains described in Table 6 were each introduced with an encryption tag (amino acid sequence such as SEQ ID NO: 5, nucleotide sequence such as SEQ ID NO: 7) to obtain strains KL-1-J to KL-4-J, and KL-M1-J to KL-M21-J, respectively. Among them, strain KL-M17-J was deposited with the China Center for Type Culture Collection (Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province) on June 26, 2024, with the strain name: Kluyveromyces lactis KL-3FL-6 (Kluyveromyces lactis KL-3FL-6), and the deposit number is CCTCC M 20241375.

[0177] Example 4. Construction of genetically modified Kluyveromyces marxianus cells.

[0178] (1) Construct a Max-Kluyveromycin-modified cell expression cassette.

[0179] 1) Construction of the KM-ΔLAC4 knockout cassette.

[0180] Refer to the applicant's prior patent: 202211453172.5, invention name: Recombinant yeast and its application to construct KM-ΔLAC4 knockout cassette.

[0181] 2) Construction of KM-ΔLAC4::GMD expression cassette.

[0182] Using the Kluyveromyces marxianus genome as a template, the upstream and downstream homology arm sequences km-lac4 up and km-lac4-do were amplified. Using the KL-ΔLAC4::GMD expression cassette as a template, the gmd expression cassette and G418+loxp site were amplified. By three-fragment fusion PCR, km-lac4 up, gmd expression cassette+G418+loxp and km-lac4-do were fused. Finally, primers lac4-upF1 and lac4-doR1 were used as primers (Table 7) and the fusion PCR system was used as a template to obtain the gmd expression cassette KM-ΔLAC4::GMD by PCR amplification.

[0183] Table 7

[0184] plasmids Primers lac4-upF1 TGAGGAATCAAGGTAGGAATTTAGTCA lac4-doR1 AGAACCATTAGAACCTTTTTCAACAC

[0185] 3) Construction of KM-ΔXK::GMER expression cassette.

[0186] Using the Kluyveromyces marxianus genome as a template, the upstream and downstream homology arm sequences km-xk up and km-xk-do of Kluyveromyces marxianus xylulose kinase were amplified. Using the KM-ΔXK::GMER expression cassette as a template, the GMER expression cassette and G418+loxp site were amplified. By three-fragment fusion PCR, km-xk up, GMD expression cassette+G418+loxp and km-xk-do were fused. Finally, primers xk-upF1 and xk-doR1 were used as primers (Table 8) and the fusion PCR system was used as a template to obtain the gmer expression cassette KM-ΔXK::GMER.

[0187] Table 8

[0188] plasmids Primers xk-upF1 GCCCATTTAAATCGTATAAGCTT xk-doR1 AATGCCCATTTCCCATTCATTA

[0189] 4) Construction of KM-ΔGK::BSFut3t-WT, KM-ΔGK::BSFut3t-M1 to KM-ΔGK::BSFut3t-M21, KM-ΔGK::HPFutA-WT expression cassettes.

[0190] The genomic DNA of K. marxianus DMKU3-1042 was used as template and primers galk up-F1 and galk up-R1 and galk down-F1 and galk down-R1 (Table 9) were PCR amplified to obtain the upstream and downstream homology arms, respectively; KL-ΔGK::BSFut3t-wt, KL-ΔGK::BSFut3t-M1 to KL-ΔGK::BSFut3t-M21 expression cassettes, and KL-ΔGK::HPFutA-wt expression cassette were used as templates to PCR amplify the BSFut3t-wt / BSFut3t mutant expression cassette / HPFutA-wt expression cassette+G418+loxp sequence, and the upstream and downstream homology arms and BSFut3t-wt / BSFut3t mutant expression cassette / HPFutA-wt expression cassette+G418+loxp sequence were fused using the fusion PCR method, respectively, using the fusion system as a template with primers glk up-F1 and glk down-R1. Down-R1 was used as a template to amplify the KM-ΔGK::BSFut3t-WT, KM-ΔGK::BSFut3t-M1 to KM-ΔGK::BSFut3t-M21, and KM-ΔGK::HPFutA-wt expression cassettes for the next step of constructing recombinant strains.

[0191] Table 9. Primers for constructing KM-ΔGK::BSFut3t-WT, KM-ΔGK::BSFut3t-M1 to KM-ΔGK::BSFut3t-M21, KM-ΔGK::HPFutA-wt expression cassettes

[0192]

[0193] (2) Transformation of recombinant plasmid and verification of recombinant strain:

[0194] The expression cassette constructed in (1) above was transformed into the starting strain K. marxianus DMKU3-1042 cells. The specific method is as described in Example 2, Part (2), Transformation of the recombinant expression cassette and Verification of the recombinant strain.

[0195] The correspondence between the recombinant strains and their genotypes is shown in Table 10. To verify the correctness of the above strains, we extracted the genomes of the above transformants and the original strain and performed PCR amplification on the genome using primers corresponding to the knockout cassette or expression cassette. If the PCR amplification yielded a single band with a size consistent with the knockout cassette or expression cassette, the strain was considered correct. Otherwise, the strain was considered a false positive. Further, the resistance was removed according to Example 3 to obtain the target strain.

[0196] Table 10. Genetically modified Kluyveromyces marxianus cells and their genotypes

[0197]

[0198]

[0199] The recombinant strains described in Table 10 were respectively introduced with encryption markers (amino acid sequence as SEQ ID NO: 5, nucleotide sequence as

[0200] SEQ ID NO:7), and obtained strains KM-1-J to KM-4-J, and KM-M1-J to KM-M21-J, respectively.

[0201] Verification of marker genes: To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strain and performed PCR amplification using primers corresponding to the knockout or expression cassette. If a single band with the same size as the knockout or expression cassette was obtained after PCR amplification, the strain was considered correct; otherwise, the strain was considered a false positive. For tag verification, PCR amplification using primers was performed and further verified by sequencing; otherwise, the strain was considered a false positive.

[0202] Example 5. Synthesis of fucosyllactose by the strains of Example 3-4

[0203] Yeast was cultured with glucose as the carbon source. The genetically modified cells obtained in Examples 3-4 were taken respectively, and the genetically modified cells were allowed to grow rapidly until the growth entered the late logarithmic phase or the stable phase. The strains were streaked and cultured in YPD solid culture medium respectively. After culturing at 30°C for 2-3 days, single colonies were picked and inoculated into 1.5mL YPD liquid culture medium and cultured at 30°C and 200rpm overnight. Subsequently, 2% of the inoculum was inoculated into 50mL liquid culture medium shake flasks and cultured at 30°C and 200rpm until the OD 600 = 1, lactose and 3% (w / v) sucrose were added to a final concentration of 10 g / L, and the culture was shaken at 30°C and 200 rpm for a total fermentation time of 72 hours. After 72 hours of fermentation, samples were taken and boiled for 10 minutes. The final yeast fermentation product was obtained by centrifugation, and the 3-FL content in the supernatant was determined by HPLC. The results are recorded in Tables 11 and 12.

[0204] Table 11. Study on 3-FL synthesis by Kluyveromycin gene-modified cells

[0205]

[0206]

[0207] Table 12. Study on the synthesis of 3-FL by Kluyveromycin gene-modified cells

[0208]

[0209]

[0210] Example 6. Take Kluyveromyces KL-M9, KL-M17, KM-M9-J and KM-M17-J, respectively, and streak the strains on solid medium such as YPD. After culturing at 30°C for 2-3 days, pick a single colony and inoculate it into 1.5mL YPD liquid medium, and shake and culture it at 30°C and 200rpm overnight. Then, inoculate it into 50mL liquid medium shake flasks at a 2% inoculum size and culture it at 30°C and 200rpm until the OD 600 =1, and were inoculated at a 2% inoculum into 1 L of YPD medium (10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose) (3 L fermentor). After 6-7 h of culture, sucrose (mother liquor concentration of 50%) was added at a rate of 8 mL / h. Simultaneously, lactose (mother liquor concentration of 40%) was added to maintain a final lactose concentration of 15 g / L. The total fermentation time was 72 h. After 72 h of fermentation, the fermentation broth was centrifuged, and the supernatant and precipitate were collected separately. The precipitate was disrupted using a high-pressure homogenizer, boiled and centrifuged to remove protein, and the supernatants were combined to obtain the final yeast fermentation product. The 3-FL and DFL contents in the supernatant were determined by HPLC. The results are recorded in Table 13.

[0211] Table 13

[0212]

[0213]

[0214] The present invention discloses a series of α-1,3-fucosyltransferase-derived polypeptides, their preparation methods and applications, DNA molecules encoding the polypeptides, vectors, and host cells. Those skilled in the art can refer to the content of the present invention and appropriately improve the process parameters to achieve the desired results. It should be noted in particular that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0215] Although the present invention has been described in considerable detail by way of illustration and example for purposes of clarity of understanding, it will be apparent to those skilled in the art that any equivalent aspects or modifications may be implemented. Therefore, the present description and examples should not be construed as limiting the scope of the invention.

Claims

1. A genetically modified cell comprising a heterologous nucleic acid sequence encoding an α-1,3-fucosyltransferase polypeptide, Preferably, the α-1,3-fucosyltransferase polypeptide is modified at least one of positions 2, 17, 21-22, 27, 45-48, 69-72, 97-103, 118, 125-127, 133-135, 138-139, 141, 156, 162-165, 223, 227-229, 243, 247-248, 255, 260-263, and 268 of the amino acid sequence shown in SEQ ID NO: 1; Preferably, the modification is a mutation, and the mutation is selected from any one of the following mutations: 1) In the amino acid sequence shown in SEQ ID NO: 1, the amino acid at position 2 is substituted from K to T, thereby obtaining polypeptide M1; 2) In the amino acid sequence of M1, the amino acid at position 17 is replaced by K to R, thereby obtaining polypeptide M2; 3) In the amino acid sequence of M2, the amino acid segment at positions 21-22 is replaced by KN to NS, thereby obtaining polypeptide M3; 4) In the amino acid sequence of M3, the amino acid at position 27 is replaced by K to N, thereby obtaining polypeptide M4; 5) In the amino acid sequence of M4, the amino acid fragment at positions 45-48 is replaced by FFSD to IYSC, thereby obtaining polypeptide M5; 6) In the amino acid sequence of M5, amino acid residues 69-72 are replaced by EPDF with QPNL, thereby obtaining polypeptide M6; 7) In the amino acid sequence of M6, the amino acid segment at positions 97-103 is replaced by YKYKEAL to FLYTQDY, thereby obtaining polypeptide M7; 8) In the amino acid sequence of M7, the amino acid at position 118 is replaced by E to K, thereby obtaining polypeptide M8; 9) In the amino acid sequence of M8, the amino acid fragment at positions 125-127 is replaced by CFN to NFI, thereby obtaining polypeptide M9; 10) In the amino acid sequence of M9, the amino acid fragment at positions 133-135 is replaced by YDE to AHR, thereby obtaining polypeptide M10; 11) In the amino acid sequence of M10, the amino acid fragment at positions 138-139 is replaced by IK to FE, thereby obtaining polypeptide M11; 12) In the amino acid sequence of M11, the amino acid at position 141 is substituted from Y to 1, thereby obtaining polypeptide M12; 13) In the amino acid sequence of M12, the amino acid at position 156 is replaced by T to I, thereby obtaining polypeptide M13. 14) In the amino acid sequence of M13, the amino acid fragment at positions 162-165 is replaced by FLIE with YRVD, thereby obtaining polypeptide M14; 15) In the amino acid sequence of M14, the amino acid at position 223 is replaced by T to C, thereby obtaining polypeptide M15; 16) In the amino acid sequence of M15, the amino acid segment at positions 227-229 is replaced by SSY to KSK, thereby obtaining polypeptide M16; 17) In the amino acid sequence of M16, the amino acid at position 243 is substituted from K to D, thereby obtaining polypeptide M17; 18) In the amino acid sequence of M17, the amino acid segment at positions 247-248 is replaced by TE to SQ, thereby obtaining polypeptide M18; 19) In the amino acid sequence of M18, the amino acid at position 255 is substituted from F to L, thereby obtaining polypeptide M19; 20) In the amino acid sequence of M19, the amino acid fragment at positions 260-263 is replaced by NPEE with DPEK, thereby obtaining polypeptide M20; 21) In the amino acid sequence of M20, the amino acid at position 268 is substituted from A to E, thereby obtaining polypeptide M21.

2. The gene-modified cell according to claim 1, wherein The genetically modified cells include, but are not limited to, yeast cells (yeast sp.), Bacillus sp., and genetically modified cells of the genus Escherichia sp.

3. The gene-modified cell according to claim 1, wherein The genetically modified cells include but are not limited to Escherichia coli, Bacucilius cereus, Saccharomyces cerevisiae, Kluyveromyces lactis, Kluyveromyces marxianus, Yarrowia lipolytica, Saccharomyces paradoxus), Saccharomyces bayanus, Saccharomyces pastorianus pastorianus), Rio yeast (Saccharomyces cariocas), McCarter yeast (Saccharomyces mikatae), Saccharomyces kudriavzevii, and genetically modified cells of Escherichia coli.

4. The gene-modified cell according to claim 1, wherein The genetically modified cell further comprises a heterologous nucleic acid sequence of GDP-L-fucose synthase polypeptide (GMER) and / or GDP-mannose dehydratase polypeptide (GMD).

5. The gene-modified cell according to claim 4, wherein The GDP-fucose synthase polypeptide The GDP-fucose synthase polypeptide is derived from, but not limited to, Escherichia coli, Mus musculus ( Mus musculus ), Homo sapiens, Marinobacter salarius, Sinorhizobium fredii, Citrobacter, Pongo abelii, Caenorhabditis elegans, Candidatus Staskawiczbacteria, Azorhizobium caulinodans or Candictus Nitrospiranitrificans, etc., natural strains or genetically modified strains.

6. The gene-modified cell according to claim 4, wherein The sources of the GDP-mannose dehydratase polypeptide include but are not limited to Escherichia coli, Caenorhabditis elegans, Homo sapiens, Arabidopsis thaliana, Dictyostelium discoidum, Mus musculus, Drosophila melanogaster, Sinorhizobium fredii, Pandoraea vervacti, Caenorhabditis briggsae, Curtissella and Candida albicans. Natural strains or genetically modified strains of Candidatus Curtissbacteria, Pseudomonas sp., Clostridium sp., Cricetulus griseus, Arthrobacter iccitolerans, Paraburkholderia piptadeniae, Bacillus smithii and Bacillus smithii, etc.

7. The gene-modified cell according to any one of claims 1 to 5, wherein The genetically modified cell further comprises a nucleic acid sequence of a marker gene, Preferably, the deposit number of the modified cell is: CCTCC M 20241375.

8. The method for preparing gene-modified cells according to any one of claims 1 to 7, wherein: The steps include: (1) Cultivate the starting strain; Preferably, the starting strain includes but is not limited to natural cells or genetically modified cells of Kluyveromyces cells; Preferably, the Kluyveromyces cell is selected from natural cells or genetically modified cells of Kluyveromyces lactis cells K. lactis or Kluyveromyces marxianus cells K. marxianus. Preferably, the starting strain is selected from Kluyveromyces lactis cells K. lactis DSM 70799; Preferably, the starting strain is selected from Kluyveromyces marxianus DMKU3-1042. (2) constructing an expression cassette and introducing heterologous GDP-mannose dehydratase gene and heterologous GDP-fucose synthase gene into yeast cells; (3) Constructing an expression cassette and introducing the α-1,3-fucosyltransferase polypeptide gene described in the present application into yeast cells. (4) destroying the β-galactosidase gene lac4 in the strain obtained in step (1); Optionally, the genetically modified cell further comprises: (5) Construct a molecular marker expression cassette and introduce the marker gene into Kluyveromyces cells. Preferably, the method further comprises the step of (6) recovering the genetically modified yeast cells. Optionally, in the method for preparing genetically modified yeast cells as described above, the steps are not ordered in any particular order.

9. A method for preparing 3-fucosyllactose, characterized in that: The gene cell according to any one of claims 1 to 5 is used to synthesize fucosyllactose de novo using lactose and glucose, or glycerol, or sucrose as carbon sources.

10. The method for preparing 3-fucosyllactose according to claim 9, wherein: Also includes: b) optionally, a step of purifying and / or recovering 3-fucosyllactose.

Images