Application of MdRLK2 in apple comprehensive resistance breeding

Abstract

The application relates to application of a receptor-like kinase MdRLK2 in apple comprehensive resistance breeding. After transient overexpression of the receptor-like kinase MdRLK2 in apple tissue culture seedlings 'Gala-3' and apple 'Gala' branches respectively, it is found that the increase of the expression amount of the receptor-like kinase MdRLK2 effectively enhances the apple resistance to apple spot and leaf fall disease, apple leaf and stem bacterial leaf spot disease, apple brown spot disease, apple rot disease and apple ring rot disease, so that the application develops a molecular method for improving the comprehensive disease resistance of apples by overexpressing the apple receptor-like kinase MdRLK2, and provides a theoretical basis for apple molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular disease resistance technology, specifically the application of apple receptor kinase MdRLK2 in apple comprehensive resistance breeding. Background Technology

[0002] Fungal diseases in apples cause huge economic losses to the apple industry every year. Early leaf drop is the most important fungal disease of apples, including apple spot leaf drop (…). Alternaria alternata sp. mali Apple brown spot disease ( Diplocarpon coronariae ) and apple anthracnose leaf blight ( Colletotrichum fructicola This disease, which infects apple leaves, causes early leaf drop and significantly impacts apple yield. In addition to the aforementioned leaf diseases, ring rot (…) is currently… Botryosphaeria dothidea ) and rot disease ( Valsa mali Two branch diseases are also extremely serious. Currently, the main method for controlling apple fungal diseases is chemical control. However, chemical control relies on chemical pesticides, which has certain drawbacks. For example, long-term use can easily lead to pesticide resistance in pathogens, adversely affecting the environment and fruit safety. Furthermore, chemical residues can also affect human health. Therefore, screening and identifying proteins in apple plants that play an important role in resisting fungal diseases is extremely important for the breeding of disease-resistant apple varieties. Summary of the Invention

[0003] To address the shortcomings of existing technologies, the present invention aims to provide a molecular basis and gene reserve for the receptor kinase MdRLK2, which is beneficial for comprehensive resistance breeding of apples.

[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0005] The application of a receptor-like kinase gene MdRLK2 in antifungal infection, characterized in that the application improves the antifungal infection performance of apples by overexpressing the receptor-like kinase MdRLK2 in apple plants;

[0006] The nucleotide sequence of the receptor-like kinase gene MdRLK2 is shown in SEQ ID NO.1.

[0007] The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.

[0008] Primers for detecting the expression of the receptor kinase gene MdRLK2, characterized in that the sequences of the primers are shown in SEQ ID NO.2-3.

[0009] A method for enhancing apple plant resistance to fungal diseases using the MdRLK2 gene, characterized by:

[0010] The method describes the introduction of the apple receptor kinase gene MdRLK2 into apple leaves or branches via Agrobacterium-mediated transformation, thereby overexpressing it in apples. The overexpression of the MdRLK2 gene can significantly improve the resistance of apples to fungal pathogens.

[0011] The method includes the following steps:

[0012] Step 1: Insert the receptor kinase gene MdRLK2 into the BamHI and NcoI restriction sites on the pFGC5941 vector, and transform it into E. coli DH5α to obtain a vector overexpressing the MdRLK2 gene.

[0013] Step 2: Extract plasmids from the overexpression vector of the MdRLK2 gene obtained in Step 1;

[0014] Step 3: Transfer the plasmid obtained in Step 2 into Agrobacterium to prepare a transgenic Agrobacterium bacterial solution;

[0015] Step 4: Transfer the transgenic Agrobacterium tumefaciens solution obtained in Step 3 into apple leaves and branches.

[0016] The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.

[0017] The specific operation process of the above method is as follows:

[0018] S1: Total RNA was extracted from infected apples using the CTAB method;

[0019] S2: Reverse transcribe the total RNA extracted in S1 into cDNA;

[0020] S3: Using the reverse transcription template obtained in S2 and RT-PCR primers, clone the receptor kinase gene MdRLK2;

[0021] S4: Insert the gene obtained in S3 into the two restriction sites of BamHI and NcoI on the pFGC5941 vector and transform it into E. coli DH5α.

[0022] S5: Extract plasmids from the overexpression target gene vector constructed in S4;

[0023] S6: The plasmid extracted in S5 was transferred into Agrobacterium and plated on solid YEP medium containing antibiotics. The plates were incubated upside down at 28°C for 24-48 hours. The antibiotics contained 50 mg / L Kana and 20 mg / L Rif.

[0024] S7: Select a single spot from the Agrobacterium cultured in S6, add 2 ml of YEP liquid medium containing 50 mg / L Kana and 20 mg / L Rif, and incubate overnight at 28 ℃ and 180 rpm.

[0025] S8: Take 80 μL of Agrobacterium cultured in S7, add 4 ml of YEP liquid medium containing 50 mg / L Kana, 20 mg / L Rif and 10 μM acetylsyl syringone, and incubate at 28 ℃ and 180 rpm for 12-16 h.

[0026] S9: Centrifuge the Agrobacterium cultured in S8 at 10,000 rpm for 1 min at room temperature to remove the culture medium; suspend the above bacterial culture in 1-2 ml of suspension by vortexing; take 10 μL of the vortexed bacterial culture and add it to 990 μL of suspension to obtain a bacterial cell suspension, measure its OD600 using a spectrophotometer, adjust the bacterial cell suspension to OD600 = 1.0, and let it stand at room temperature for 2-5 h; the above suspension includes: 10 mM MES-KOH adjusted to pH 5.2, 10 mM MgCl2, and 100 μM acetylsylgenone;

[0027] S10: Before using the bacterial solution obtained in S9, vortex or pipette the suspended bacterial cells. Then, use a 1mL syringe without a needle to draw up the bacterial solution, avoiding the leaf veins. After making a small hole in the apple leaf with the needle of the 1mL syringe, inject the bacterial solution into the leaf. Inject 1-2 holes in each leaf.

[0028] S11: Before use, the bacterial solution obtained from S9 is vortexed or pipetteed to suspend the bacterial cells, mixed 1:1, and then vacuumed to transfer the bacterial solution into the branches.

[0029] S12: Observe the leaves and branches 4 days after injecting Agrobacterium.

[0030] Application of the MdRLK2 gene in the preparation of transgenic apple plants with resistance to fungal diseases.

[0031] The beneficial effects of applying the receptor-like kinase MdRLK2 described in this invention in apple integrated resistance breeding are as follows:

[0032] By transiently overexpressing receptor kinase MdRLK2 using the pFGC5941 vector on apple tissue culture seedlings 'Gala-3' and 'Gala' apple branches, it was found that overexpression of receptor kinase MdRLK2 can enhance the disease resistance of apples, which is beneficial for the prevention and control of various apple diseases and for the molecular breeding of apples. Attached Figure Description

[0033] The present invention includes the following figures:

[0034] Figure 1Figure 1. Experimental results showing the effect of overexpressing the receptor kinase MdRLK2 to enhance the resistance of the susceptible apple variety 'Gala-3' to apple spot leaf drop, apple brown spot, and apple anthracnose leaf blight.

[0035] Figure 2 Figure 1 shows the experimental results of overexpressing the receptor kinase MdRLK2 to enhance the resistance of susceptible apple cultivar 'Gala' to ring rot and apple rot. Detailed Implementation

[0036] The present invention will be further described in detail below with reference to the accompanying drawings.

[0037] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, all reagents and materials mentioned in this invention are used in accordance with the conditions recommended in the manufacturer's instructions.

[0038] 1. Extraction of total RNA from plants:

[0039] (1) The tissue samples of apple 'Gala-3' were rapidly ground in liquid nitrogen;

[0040] (2) Add 990 μL of preheated CTAB solution and 10 μL of β-mercaptoethanol to the plant tissue, vortex for 30 s and then incubate in a 65°C water bath for 10 min.

[0041] (3) Add 1000 μL CI (chloroform / isoamyl alcohol volume ratio = 24:1) and mix by inverting the container.

[0042] (4) 4℃, 12000rpm, 10min;

[0043] (5) Take 800 μL of supernatant, add an equal volume of CI, and mix by inverting the container.

[0044] (6) 4℃, 12000rpm, 10min;

[0045] (7) Take about 650 μL of the supernatant and add 1000 μL of isopropanol;

[0046] (8) Precipitate at -20℃ for 30 min;

[0047] (9) 4℃, 12000rpm, 10min;

[0048] (10) Discard the supernatant and add 1 ml of 75% ethanol to wash the precipitate;

[0049] (11) 4℃, 12000rpm, 10min;

[0050] (12) Discard the supernatant, 4℃, 12000rpm, 2min;

[0051] (13) Aspirate the supernatant and add 40 μL of RNase-free H2O to dissolve the precipitate;

[0052] (14) Integrity was detected by 1% agarose gel electrophoresis, and RNA concentration was calculated by measuring the absorbance at 260 nm using a UV spectrophotometer.

[0053] 2. Cloning MdRLK2:

[0054] (1) Total RNA was extracted from 'Gala-3' using CTAB;

[0055] (2) Reverse transcription into cDNA;

[0056] (3) Design RT-PCR primers: F: AGCATCAAAGTTTAGAGGCATTGTT; R: TTCTTTTCTCTATGCACGTTTAACG.

[0057] (4) After PCR, the PCR product fragment size was detected by 1% agarose gel electrophoresis, 0.1% TAE electrophoresis buffer, 70-110 V voltage electrophoresis for about 15 min, ethidium bromide staining, and UV light detection.

[0058] 3. Constructing an MdRLK2 overexpression vector

[0059] MdRLK2 was inserted into the BamHI and NcoI restriction sites on the pFGC5941 vector, transformed into E. coli DH5α, and subjected to plasmid picking and sequencing. After confirming the sequence was correct, the plasmid was extracted and transiently expressed.

[0060] The specific steps are as follows:

[0061] Enzyme digestion reaction system:

[0062] Green Buffer (Thermo) 4 μL

[0063] 2 μL each of BamHI and NcoI

[0064] 20 μL of recovered product

[0065] DEPC water level to 40μL

[0066] The above reaction system was placed in a 37°C water bath for 24 hours. The recovered products were then analyzed by agarose gel electrophoresis. Fragments of the correct size were selected and recovered using a Novizan recovery kit.

[0067] T4 ligase ligation system:

[0068] T4 Buffer (Takara) 10 μL

[0069] T4 ligase (Takara) 1 μL

[0070] 8 μL of recovered product

[0071] 1 μL of carrier

[0072] The above reaction system was placed in a metal bath at 16°C, and after 24 hours, 20 μL of the above ligation system was transferred to Escherichia coli DH5α.

[0073] 4. Agarose gel recovery of the target fragment

[0074] Use the recovery kit, following the instructions in the kit's manual.

[0075] (1) Cut out agarose containing the target sequence fragment, remove as much excess gel as possible, add 3 gel volumes of Buffer B2, and mix intermittently until the gel block is completely melted.

[0076] (2) Add 200 μL of isopropanol and mix well.

[0077] (3) Transfer the mixture to a column separation and purification column, centrifuge at 12,000 × g for 60 s, and discard the waste liquid in the collection tube.

[0078] (4) Add 300 μl of Buffer B2 to the purification column, centrifuge at 12,000× g for 30 s, and discard the waste liquid in the collection tube.

[0079] (5) Add 500 μl Wash Buffer to the purification column, centrifuge at 12,000× g for 30 s, and discard the waste liquid in the collection tube.

[0080] (6) Repeat once.

[0081] (7) After being air-conditioned for 2 minutes, place it in a fume hood and blow it for 5 minutes.

[0082] (8) Take a new 1.5 ml centrifuge tube, place the purification column in the new 1.5 ml centrifuge tube, add 30 μL of TE Buffer preheated at 55 ℃, place at room temperature for 2 min, and centrifuge at 12,000× g for 60 s.

[0083] (9) Discard the adsorption column and store the recovered product in a -20 ℃ refrigerator.

[0084] 5. Escherichia coli DH5α transformation process:

[0085] Add 10 μL of the ligated vector to 30 μL of *E. coli* DH5α, incubate on ice for 30 min, heat shock at 42 ℃ for 30 s, incubate on ice for 2 min, then add 200 μL of liquid LB medium, place on a shaker at 37 ℃ and shake at 200 rpm for 40-60 min, then centrifuge at 10,000 rpm for 1 min at room temperature. Aspirate 200 μL of the supernatant, resuspend the bacterial cells in the remaining liquid, spread on LB+Amp solid medium, and incubate overnight at 37 ℃.

[0086] 6. Spot removal:

[0087] Single colonies after overnight culture were picked and placed in 200 μL of LB+Amp liquid medium and placed on a shaker at 37 ℃ and shaken at 200 rpm for 3 h.

[0088] Bacterial PCR:

[0089] 2 × PCR Mix 5 μL

[0090] 0.5 μL each of F / R (10 μM)

[0091] 1 μL of bacterial solution

[0092] Top up the DEPC water to 10 μL

[0093] The above system was subjected to 35 cycles: 95 °C for 3 min; 95 °C for 1 min; 60 °C for 30 s; 72 °C for 30 s; 72 °C for 10 min; 16 °C for 1 min.

[0094] PCR was performed using 1% agarose gel electrophoresis with 0.1% TAE buffer at 70-110 V for approximately 15 min. Ethidium bromide staining was followed by UV staining to determine the size of PCR product fragments. Bacterial cultures with correctly sized bands were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. Sequencing results were compared using DNAMAN.

[0095] 7. Plasmid extraction (Vazyme, FastPure Plasmid Mini Kit, DC201)

[0096] (1) Take 1-5 ml of overnight culture (12-16 h), add it to a 2 ml centrifuge tube, and centrifuge at 10000 rpm for 1 min. Discard the culture medium and aspirate the remaining liquid.

[0097] (2) Add 250 μl of Buffer P1 (RNase A has been added) to the centrifuge tube and vortex to mix.

[0098] (3) Add 250 μl of Buffer P2 to step 2 and gently mix by inverting the container 8-10 times;

[0099] (4) Add 350 μl of Buffer P3 to step 3, immediately and gently invert the container 8-10 times, and centrifuge at 12000 rpm for 10 min;

[0100] (5) Place the FastPure DNA Mini Columns adsorption column into a 2 ml collection tube. Carefully transfer the supernatant from step 4 into the adsorption column using a pipette, and centrifuge at 12000 rpm for 30 seconds. Discard the waste liquid in the collection tube and return the adsorption column to the collection tube;

[0101] (6) Add 600 μl of Buffer PW2 (diluted with anhydrous ethanol) to the adsorption column. Centrifuge at 12000 rpm for 30 seconds. Discard the waste liquid and return the adsorption column to the collection tube;

[0102] (7) Repeat step 6;

[0103] (8) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 1 min to dry the adsorption column;

[0104] (9) Place the adsorption column into a new sterile 1.5 ml centrifuge tube. Add 30-100 μl of Elution Buffer to the center of the membrane on the adsorption column. Incubate at room temperature for 2 min, then centrifuge at 12000 rpm for 1 min to elute the DNA;

[0105] (10) Discard the adsorption column and store the DNA product at -20°C.

[0106] 8. Agrobacterium-mediated transformation:

[0107] (1) Take a tube of prepared competent cells, thaw them completely on ice, and then gently suspend the cells.

[0108] (2) Add 5-10 μL of plasmid overexpressing MdRLK2 transgenic fungus, mix gently, and place on ice for 30 min.

[0109] (3) Cold shock in liquid nitrogen for 1 min.

[0110] (4) Heat shock at 37 ℃ for 5 min, then place on ice for 2 min.

[0111] (5) Add 500 μL of YEP liquid medium and incubate at 28 ℃ and 140 rpm for 4-6 h with shaking.

[0112] (6) Centrifuge at 4000 rpm for 3 min at room temperature, remove about 400 μL of supernatant, and suspend the cells in the remaining culture medium.

[0113] (7) Spread the bacteria on solid YEP medium containing antibiotics (50 mg / L Kana, 20 mg / L Rif).

[0114] (8) Invert the plate at 28℃ for 24-48h.

[0115] 9. Overexpression of MdRLK2 in leaves of 'Gala-3' tissue culture seedlings

[0116] The constructed MdRLK2 plasmid was transformed into Agrobacterium and transiently expressed. After 4 days of culture, the results are shown in the figure. Figure 1 In case A: Four days after the transient expression of the susceptible variety 'Gala-3' by Agrobacterium-mediated translocation, the expression level of MdRLK2 was detected by real-time quantitative PCR, and the expression level of MdRLK2 was found to be significantly increased. Figure 1 China B and Figure 1 Figure C represents the statistical analysis of leaf phenotype and lesion area of ​​*Gala-3* cultivar 4 days after transient expression of the susceptible variety via Agrobacterium-mediated inoculation and 48 hours after inoculation; WT represents cultivar 'Gala-3' without transient expression; EV represents cultivar 'Gala-3' with transient expression using the pFGC5941 empty vector; OE-MdRLK2 represents 'Gala-3' cultivar 'Gala-3' with transient expression using the pFGC5941 vector overexpressing MdRLK2. As can be seen from the above figures, the lesion area of ​​*Gala* leaves significantly decreased after transient overexpression of the MdRLK2 gene and inoculation with fungi.

[0117] 10. Overexpression of MdRLK2 in 'Gala' branches

[0118] The constructed MdRLK2 plasmid was transformed into Agrobacterium and transiently expressed. After 4 days of culture, the results are shown in the figure. Figure 2 In the study A: Agrobacterium-mediated transient expression of MdRLK2 in branches of the susceptible cultivar 'Gala', the expression level of MdRLK2 was significantly increased after 4 days by quantitative real-time PCR. Figure 2 In Figures B and C, the phenotypic and lesion area of ​​branches of the susceptible cultivar 'Gala' were statistically analyzed 4 days after inoculation with Agrobacterium-mediated transient expression and 48 hours after inoculation. WT represents branches without transient expression of 'Gala'; EV represents branches with transient expression of 'Gala' using the pFGC5941 empty vector; and OE-MdRLK2 represents branches with transient expression of 'Gala' using the pFGC5941 vector overexpressing MdRLK2. The results showed that after transient overexpression of MdRLK2, the lesion area of ​​'Gala' branches significantly decreased after fungal inoculation.

[0119] The primers used for real-time PCR as described in items 9 and 10 above are as follows:

[0120] MdRLK2 quantitative PCR primers: F: TCCGAGGGCGATCTATTCCT (SEQ ID NO.2), R: ACAGTTACCACCTGCTCTGC (SEQ ID NO.3).

[0121] Internal control U6 fluorescence quantitative primers: F: 5'-TTGGGGACATCCGATAAAATTG-3', R: 5'-AAAAATTTGGACCATTTCTCG-3'.

[0122] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0123] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

Claims

1. The application of an apple receptor kinase gene, MdRLK2, in resistance to fungal diseases, characterized in that, The application improves the resistance of apples to fungal diseases by overexpressing the apple receptor kinase gene MdRLK2 in apple plants; The nucleotide sequence of the apple receptor kinase gene MdRLK2 is shown in SEQ ID NO.1; the fungal diseases are leaf spot, brown spot, anthracnose leaf blight, ring spot, or rot.

2. A method for enhancing the resistance of apple plants to fungal diseases using the apple receptor kinase gene MdRLK2, characterized in that: The method describes the introduction of the apple receptor kinase gene MdRLK2 into apple leaves or branches via Agrobacterium-mediated transformation, thereby overexpressing it in apples. Overexpression of the apple receptor kinase gene MdRLK2 can significantly improve the resistance of apples to fungal pathogens. The nucleotide sequence of the apple receptor kinase gene MdRLK2 is shown in SEQ ID NO.

1. The fungal diseases are leaf spot, brown spot, anthracnose leaf blight, ring spot, or rot.

3. Application of the apple receptor kinase gene MdRLK2 in the preparation of transgenic apple plants with resistance to fungal diseases; the nucleotide sequence of the apple receptor kinase gene MdRLK2 is shown in SEQ ID NO.1; the fungal diseases are leaf spot, brown spot, anthracnose leaf blight, ring spot, or rot.

Images