Saccharomyces cerevisiae for producing rare ginsenosides by using seaweed biomass and construction method and application thereof
By overexpressing a specific enzyme system in Saccharomyces cerevisiae, the direct utilization of seaweed biomass was achieved, solving the problem that Saccharomyces cerevisiae cannot utilize seaweed polysaccharides, and improving the production efficiency and resource utilization efficiency of rare ginsenosides.
Patent Information
- Application Number
- CN202510743869.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2045-06-05
AI Technical Summary
In existing technologies, brewer's yeast cannot effectively utilize seaweed biomass to produce rare ginsenosides. It suffers from resource competition and energy metabolism imbalance caused by carbon source dependence on terrestrial plants, and lacks an enzyme system for degrading seaweed polysaccharides.
By overexpressing genes such as agarase, neoagarbiose hydrolase, hydroxymethylglutaryl-CoA reductase, and isopentenyl diphosphate δ isomerase, a brewing yeast was constructed, enabling it to directly utilize seaweed biomass and simultaneously carry out enzymatic hydrolysis of red algae polysaccharides and fermentation of rare ginsenosides.
It simplifies production steps, reduces costs, increases the yield and energy balance of rare ginsenosides, expands the utilization scope of marine biomass, solves the problem of resource competition, and promotes a multi-raw material and multi-product biorefining system.
Smart Images

Figure CN120574697B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a Saccharomyces cerevisiae for producing rare ginsenosides by using seaweed biomass and a construction method and application thereof. BACKGROUND
[0002] In recent years, with the breakthrough development of gene editing technology, the research on constructing microbial cell factories based on metabolic engineering strategies to synthesize high-value bio-chemicals has attracted much attention. Ginsenosides, as the main active components of ginseng, are a class of tetracyclic triterpene saponins with significant pharmacological activities, and their anticancer, antioxidant, anti-inflammatory effects have been widely proven. According to the difference in aglycone structure, dammarane-type ginsenosides can be divided into two major categories: protopanaxadiol (PPD) type and protopanaxatriol (PPT) type. PPD type is glycosylated through C3-OH and / or C20-OH sites, and PPT type is glycosylated through C6-OH and / or C20-OH sites. However, the content of ginsenosides in natural Panax plants is extremely low, and dammarenediol (DM) glycoside is almost impossible to isolate from Panax plants. To solve the above limitations, constructing microbial cell factories to synthesize rare ginsenosides based on metabolic engineering strategies is considered as the most promising solution. Compared with plant extraction, chemical synthesis and enzyme catalysis, synthetic biology is a more environmentally friendly and efficient method to obtain active compounds. Saccharomyces cerevisiae is an ideal biosynthesis chassis due to its GRAS safety certification, mature genetic manipulation system and large-scale fermentation advantages.
[0003] Current research generally uses glucose as the main carbon source for the chassis cell, but there are significant limitations. First, the glucose generation mode based on starch hydrolysis is unsustainable, involving the competition problem of arable land resources and food safety. In addition, Saccharomyces cerevisiae as a Crabtree-positive strain is prone to trigger the "overflow effect" during glucose metabolism, leading to the accumulation of ethanol by-products and energy metabolism imbalance. The central carbon metabolism has a strict and complex regulation mechanism, which makes it extremely challenging to eliminate the Crabtree effect through metabolic engineering means. Under this background, the development of new alternative carbon sources provides a new perspective to solve the above problems.
[0004] Marine biomass resources have attracted attention from the academic community due to their ecological advantages. Marine ecosystems cover 71% of the Earth's surface, and the biomass reserves account for more than 85% of the global reserves. Compared with the first generation (starch, wheat) and the second generation (wood cellulose) biomass, the third generation marine biomass (macroalgae) has the advantage of "not competing with people for food and not competing with food for land". It has a fast growth rate, high photosynthetic efficiency, no need for fertilization, and low lignin content. Red algae generally have a high carbohydrate content (61-67 wt%), mainly composed of polysaccharide complexes of agar. Agar is a linear polysaccharide composed of alternating galactose and 3,6-deoxygalactose connected by β-1,4- and α-1,3-glycosidic bonds. Compared with the adverse factors of the metabolism of fermentable carbon sources such as glucose on the synthesis of terpenoids and the complexity of the restructured central carbon metabolism, galactose as a carbon source can effectively maintain the integrity of cell mitochondria, thereby maximizing the rigid flux of ethanol and ensuring the high energy consumption and cofactor balance required for the biosynthesis of the rare ginsenoside Rh1. Marine biomass is cheap and abundant, and if the utilization of algal biomass can be increased, it will open up a new way for its high-value utilization. However, Saccharomyces cerevisiae lacks an enzyme system for degrading seaweed polysaccharides and cannot directly utilize red algal biomass. SUMMARY
[0005] The main purpose of the present application is to overcome the shortcomings and deficiencies of the prior art and provide a Saccharomyces cerevisiae for producing rare ginsenosides by utilizing seaweed biomass.
[0006] Another purpose of the present application is to provide a construction method of the above-mentioned Saccharomyces cerevisiae for producing rare ginsenosides by utilizing seaweed biomass.
[0007] Still another purpose of the present application is to provide the application of the above-mentioned Saccharomyces cerevisiae for producing rare ginsenosides by utilizing seaweed biomass.
[0008] The purpose of the present application is achieved by the following technical scheme: a Saccharomyces cerevisiae for producing rare ginsenosides by utilizing seaweed biomass, which has the following characteristics:
[0009] (1) Overexpression of agarase and neojaponicin dihydrolyase;
[0010] (2) Overexpression of hydroxymethylglutaryl coenzyme A reductase and isopentenyl diphosphate delta isomerase;
[0011] (3) Overexpression of dammarenediol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxatriol synthase and glycosyltransferase.
[0012] The agarase derived from Pseudoalteromonas is preferably at least one of agarase derived from Pseudoalteromonas sp., agarase derived from Aquimarina agarilytica, and agarase derived from Persicobacter; and is preferably agarase derived from Aquimarina agarilytica.
[0013] The nucleotide sequence of the coding gene of the agarase derived from Pseudoalteromonas is preferably shown in SEQ ID NO. 2.
[0014] The nucleotide sequence of the coding gene of the agarase derived from Aquimarina agarilytica is preferably shown in SEQ ID NO. 3.
[0015] The nucleotide sequence of the coding gene of the agarase derived from Persicobacter is preferably shown in SEQ ID NO. 4.
[0016] The neoaarose hydrolase is preferably at least one of neoaarose hydrolase derived from Aquimarina agarilytica and neoaarose hydrolase derived from Cellvibrio; and is preferably neoaarose hydrolase derived from Cellvibrio.
[0017] The nucleotide sequence of the coding gene of the neoaarose hydrolase derived from Aquimarina agarilytica is preferably shown in SEQ ID NO. 5.
[0018] The nucleotide sequence of the coding gene of the neoaarose hydrolase derived from Cellvibrio is preferably shown in SEQ ID NO. 6.
[0019] The amino acid sequence of the hydroxymethylglutaryl-CoA reductase is shown in SEQ ID NO. 7.
[0020] The nucleotide sequence of the coding gene of the hydroxymethylglutaryl-CoA reductase is preferably shown in SEQ ID NO. 8.
[0021] The amino acid sequence of the isopentenyl-diphosphate delta isomerase is shown in SEQ ID NO. 9.
[0022] The nucleotide sequence of the coding gene of the isopentenyl-diphosphate delta isomerase is preferably shown in SEQ ID NO. 10.
[0023] The hydroxymethylglutaryl-CoA reductase and the isopentenyl-diphosphate delta isomerase are preferably integrated into the GAL80 site of the genome.
[0024] The amino acid sequence of the dammarenediol synthase is preferably as shown in GenBank AB265170.1.
[0025] The nucleotide sequence of the coding gene of the dammarenediol synthase is preferably as shown in SEQ ID NO. 11.
[0026] The dammarenediol synthase and the protopanaxadiol synthase are preferably integrated at the genomic XI-3 locus.
[0027] The amino acid sequence of the protopanaxadiol synthase is preferably as shown in GenBank JN604537.1.
[0028] The nucleotide sequence of the coding gene of the protopanaxadiol synthase is preferably as shown in SEQ ID NO. 12.
[0029] The amino acid sequence of the cytochrome P450 reductase is preferably as shown in GenBank AIC73829.1.
[0030] The nucleotide sequence of the coding gene of the cytochrome P450 reductase is preferably as shown in SEQ ID NO. 13.
[0031] The protopanaxadiol synthase and the protopanaxatriol synthase are preferably integrated at the genomic LPP1 locus.
[0032] The amino acid sequence of the protopanaxatriol synthase is preferably as shown in GenBank JX036031.1.
[0033] The nucleotide sequence of the coding gene of the protopanaxatriol synthase is preferably as shown in SEQ ID NO. 14.
[0034] The amino acid sequence of the glycosyltransferase is preferably as shown in GenBank A0A0K0PVW1.1.
[0035] The nucleotide sequence of the coding gene of the glycosyltransferase is preferably as shown in SEQ ID NO. 15.
[0036] The protopanaxatriol synthase and the glycosyltransferase are preferably integrated at the genomic LPP1 locus.
[0037] The Saccharomyces cerevisiae strain for producing rare ginsenosides by using seaweed biomass is preferably a Saccharomyces cerevisiae CEN.PK series strain; more preferably a Saccharomyces cerevisiae CEN.PK2-1D strain.
[0038] The algal biomass is algal polysaccharide, including red algal polysaccharide, green algal polysaccharide, brown algal polysaccharide and blue algal polysaccharide; more preferably, the algal polysaccharide is red algal polysaccharide.
[0039] The construction method of the Saccharomyces cerevisiae for producing rare ginsenosides by using algal biomass comprises the following steps:
[0040] 1) Constructing a recombinant vector for expressing agarase and neojuncose hydrolase;
[0041] 2) Constructing Cas9-sgRNA plasmids: specifically, constructing a Cas9-sgRNA plasmid targeting a GAL80 site, a Cas9-sgRNA plasmid targeting an X-3 site, a Cas9-sgRNA plasmid targeting an XI-3 site, and a Cas9-sgRNA plasmid targeting an LPP1 site;
[0042] 3) Constructing donor fragments: specifically, a hydroxymethylglutaryl coenzyme A reductase and isopentenyl diphosphate delta isomerase gene donor fragment, a dammarenediol synthase gene donor fragment, a protopanaxadiol synthase and cytochrome P450 reductase gene donor fragment, and a protopanaxatriol synthase and glycosyltransferase gene donor fragment;
[0043] 4) Gene editing: transforming the Cas9-sgRNA plasmid obtained in step 2) and the donor fragment obtained in step 3) into the Saccharomyces cerevisiae starting strain, and screening to obtain a recombinant strain overexpressing hydroxymethylglutaryl coenzyme A reductase, isopentenyl diphosphate delta isomerase, dammarenediol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxatriol synthase and glycosyltransferase;
[0044] 5) Construction of Saccharomyces cerevisiae for producing rare ginsenosides by using algal biomass: transforming the recombinant vector obtained in step 1) into the recombinant strain obtained in step 4) to obtain Saccharomyces cerevisiae for producing rare ginsenosides by using algal biomass.
[0045] The vector framework of the recombinant vector is preferably a p426 Gal plasmid.
[0046] The recombinant vector further contains a secretion peptide gene.
[0047] The secretion peptide gene is derived from an alpha-mating factor of Saccharomyces cerevisiae, and the nucleotide sequence thereof is preferably as shown in SEQ ID NO. 1.
[0048] The nucleotide sequence of sgRNA of the Cas9-sgRNA plasmid targeting the GAL80 site is as follows: ACGATAGTTGCAGTATGGCG.
[0049] The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the X-3 site is as follows: GACACATTAGTCTCGTATGT.
[0050] The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the XI-3 site is as follows: GTAGAAATCAGACGCACGCT.
[0051] The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the LPP1 site is as follows: ATGAAACTTGAATGTCCGCT.
[0052] The vector framework of the Cas9-sgRNA plasmid is preferably a gene editing vector containing a Cas9 expression gene; more preferably, it is p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 .
[0053] The p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 is obtained by inserting the Cas9 protein gene into p426-SNR52p-gRNA.csr-1.Y-SUP4t.
[0054] The hydroxymethylglutaryl coenzyme A reductase and isopentenyl diphosphate delta isomerase in the hydroxymethylglutaryl coenzyme A reductase and isopentenyl diphosphate delta isomerase gene donor fragment are independently expressed; the structure is preferably terminator-hydroxymethylglutaryl coenzyme A reductase gene-promoter-isopentenyl diphosphate delta isomerase gene-terminator.
[0055] The terminator is the same or different terminator; preferably, it is a different terminator; more preferably, it is T ADH1 terminator and T CYC1 terminator.
[0056] The promoter is a bidirectional promoter, preferably P gal1,10 promoter.
[0057] The structure of the dammarenediol synthase gene donor fragment is terminator-dammarenediol synthase gene-promoter.
[0058] The terminator is preferably T ADH1 terminator.
[0059] The promoter is preferably P gal1,10 promoter.
[0060] The protopanaxadiol synthase and cytochrome P450 reductase in the protopanaxadiol synthase and cytochrome P450 reductase gene donor fragment are independently expressed; the structure is preferably promoter-protopanaxadiol synthase gene-terminator-promoter-cytochrome P450 reductase gene-terminator.
[0061] The terminators are the same or different terminators; preferably different terminators; more preferably T ALT1 Terminators and T CYC1 Terminators.
[0062] The promoters are the same or different promoters; preferably P gal1,10 Promoters and P gal7 Promoters.
[0063] The protopanaxatriol synthase and glycosyltransferase in the protopanaxatriol synthase and glycosyltransferase gene donor fragment are independently expressed; the structure is preferably terminator-protopanaxatriol synthase gene-promoter-glycosyltransferase gene-terminator.
[0064] The terminators are the same or different terminators; preferably different terminators; more preferably T ADH1 Terminators and T ALT1 Terminators.
[0065] The promoters are bidirectional promoters, preferably P gal1,10 Promoters.
[0066] The Cas9-sgRNA plasmid in step 4) and the donor fragment are matched at a mass ratio of 1:2.
[0067] The gene editing in step 4) can be one-time editing or step-by-step editing.
[0068] The step-by-step editing is editing with the donor fragments alone or in combination.
[0069] The screening step in step 4) includes culturing the transformants using uracil YNB auxotrophic screening plate medium, colony PCR, and negative screening using solid YPD plate containing 5-fluorouracil, colony PCR.
[0070] The above-mentioned Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass is used in the production of squalene and / or rare ginsenosides; preferably including the following steps: fermenting the above-mentioned Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass in a culture medium containing seaweed biomass to obtain squalene and / or rare ginsenosides.
[0071] The composition of the culture medium is preferably as follows: glucose 10 g / L, seaweed biomass 20-40 g / L, hydrochloric acid 0.001-0.01 M, pH 5.5-6.5; more preferably as follows: glucose 10 g / L, seaweed biomass 25 g / L, hydrochloric acid 0.005 M, pH 6.0.
[0072] The fermentation culture conditions are preferably at 28-32 DEG C for at least 48 h; more preferably at 30 DEG C for at least 96-144 h.
[0073] The present application has the following advantages and effects relative to the prior art:
[0074] (1) The present application obtains better agarases and neoagarobiohydrolases for decomposing red algae polysaccharides through screening, which can convert red algae polysaccharides into galactose, and then be used for preparing triterpenoids.
[0075] (2) The present application provides a Saccharomyces cerevisiae engineering strain, which realizes the synchronous performance of enzymolysis and fermentation by combining the enzymolysis of red algae biomass with the fermentation of rare ginsenosides, not only endows the wild-type yeast with the ability of degrading red algae polysaccharides which the wild-type yeast originally does not have, but also solves the feedback inhibition effect in the enzymolysis process, greatly simplifies the steps and reduces the production cost, and the effect is obviously better than the physical mixing treatment of in-vitro enzymes. In addition, the present application also finds that the two enzymes tHMG1 and IDI1 can enhance the MVA pathway of the yeast chassis and balance IPP / DMAPP, thereby improving the yield of squalene and downstream terpenes (rare ginsenoside Rh1).
[0076] (3) The present application further improves the level of converting seaweed polysaccharides into triterpenoids by optimizing the fermentation system (fermentation medium), effectively solves the awkward situation of competing with people for food and land caused by the current fermentation carbon source which relies on land plants as raw materials for production, expands the development way of using abundant and cheap marine biomass to prepare energy raw materials, and the synthesis is not limited by the cost and supply source of raw materials, and is easier to industrialize.
[0077] (4) The metabolic platform constructed in the present application has substrate universal expansion potential, and by modularly replacing the hydrolytic enzyme element, it can be compatible with polysaccharide resources such as brown algae and green algae, and provides a standardized technical framework for developing a new generation of biorefining system. This breakthrough makes it possible to simultaneously utilize land and marine biomass with a single strain, and promotes the upgrading of the traditional "single raw material-single product" mode to the "multi-raw material-multi-product" paradigm. BRIEF DESCRIPTION OF DRAWINGS
[0078] Figure 1 is a flow chart of the present application.
[0079] Figure 2 is a structure diagram of p426-AqAga-agaNash plasmid.
[0080] Figure 3 These are the screening results of engineered strains that degrade red algal polysaccharides; where A is a plate hydrolysis photograph and B is the activity test results of agarase and neo-agarbiose hydrolase.
[0081] Figure 4 The images show the HPLC results of hydrolyzing the culture medium containing red algae polysaccharides with hydrochloric acid (A) and photographs of the culture medium state of the engineered strain Sq-Ag5 at different fermentation times in the culture medium containing red algae polysaccharides (B).
[0082] Figure 5 The results show the squalene yield obtained by fermenting the engineered strain Sq-Ag5 in a medium containing different concentrations of glucose and red algae polysaccharides.
[0083] Figure 6 This is a schematic diagram of the Rh1-Ag overexpression gene in the engineered strain.
[0084] Figure 7 The graph shows the results of fermentation of engineered strains Rh1-Ag and Rh1-con using a medium containing red algae polysaccharides; where A represents growth, B represents reducing sugar content, and C represents the yield of rare ginsenoside Rh1.
[0085] Figure 8 This is an HPLC chromatogram for detecting the yield of rare ginsenoside Rh1. Detailed Implementation
[0086] The present invention will be further described in detail below through specific embodiments.
[0087] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0088] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available.
[0089] The specific flowchart of the present invention is as follows: Figure 1 As shown.
[0090] The primers used in this invention are shown in Tables 1 to 3.
[0091] Table 1 Primers used to construct recombinant vectors expressing agarase and neo-agarbiose hydrolase
[0092] Primer Sequence (5'-3') Alpha-factor mutant-1 gaatattccctcaaaaAACAAAATGAGATTTCCATCTATTTTTACTGC Alpha-factor mutant-2 agaggtcaatttTTTTGGTTCACCTTCTTCTCTTTTATCC Alpha-factor mutant-3 aggagaaaaaactataAACAAAATGAGATTTCCATCTATTTTTACTGC Alpha-factor mutant-4 caagtcgcccatTTTTGGTTCACCTTCTTCTCTTTTATCC Alpha-factor mutant-5 gtgttttttcatTTTTGGTTCACCTTCTTCTCTTTTATCCA Alpha-factor mutant-6 gagtaaattcttTTTTGGTTCACCTTCTTCTCTTTTATCCA Alpha-factor mutant-7 gggcattttcatTTTTGGTTCACCTTCTTCTCTTTTATCC AqAga-F-1 ggtgaaccaaaaAAATTGACCTCTACTAATTTATTCAAGTGTTTG AqAga-R-2 ttacatgaggatccTCACTTAGCGGATCTCAATTCAAAT Aga3463-F-1 aggtgaaccaaaaATGAAAAAACACGCACTAGCAG Aga3463-R-2 acatgaggatccTTATTTTGATACTGCAATCTTGACCGT PdAgaC-F-1 ggtgaaccaaaaATGAAAATGCCCTTGACCTATTTATG PdAgaC-R-2 acatgaggatccTTATTGGAGGATGATTTTTTTTGTCTTTTGC agaNash-F-1 gtgaaccaaaaATGGGCGACTTGCCAGAA agaNash-R-2 aaggactcccgtacgTCAGGATGCAACGTTTTGGAAAGTA NH852-F-1 ggtgaaccaaaaAAGAATTTACTCCAATTATTGAGCGTTTT NH852-R-2 aaggactcccgtacgTCATTGCTTAACGAACAAAGTACTC Plasmid backbone fragment one-1 ctcattttgttTATAGTTTTTTCTCCTTGACGTTAAAGTATAG Plasmid backbone fragment one-2 ctcattttgt tTTTTGAGGG AATATTCAAC TGTTTTTTTT Plasmid backbone fragment two-1 atccgctaag tgaGGATCCT CATGTAATT AGTTATGTC ACG Plasmid backbone fragment two-2 gttgcatcct gaCGTACGGG AGTCCTTTAA TTAACA Plasmid backbone fragment two-3 gtatcaaaat aaGGATCCTC ATGTAATTAG TTATGTCACG Plasmid backbone fragment two-4 gttaagcaat gaCGTACGGG AGTCCTTTAA TTAACA Plasmid backbone fragment two-5 catcctccaa taaGGATCCT CATGTAATTAG TTATGTCACG
[0093] Table 2 Primers used to construct engineered strains overexpressing tHMG1 and IDI1
[0094]
[0095]
[0096] Table 3 Primers used for constructing strains overexpressing PgDDS, CYP716A47, PgCPR1, CYP716A53v2 and UGTPg100
[0097]
[0098]
[0099] The culture medium used in the present application is as follows (the sterilization and sterilization of the culture medium can be performed according to conventional operation) :
[0100] The composition of the uracil YNB auxotrophic plate is as follows: 6.7 g / L amino acid-free yeast nitrogen source, 20 g / L glucose, 50 mg / L histidine, 50 mg / L tryptophan, 50 mg / L leucine are added according to the genotype of Saccharomyces cerevisiae; 1.5% agar powder is added to obtain YNB solid culture medium.
[0101] The composition of the YPD liquid culture medium is as follows: 10 g / L yeast powder, 20 g / L peptone, 20 g / L glucose, and deionized water as solvent.
[0102] Lugol's iodine solution plate: 5 mL of Lugol's iodine solution is added to the uracil YNB auxotrophic plate and shaken to obtain.
[0103] Example 1: Construction of an engineering strain using red algae polysaccharide
[0104] (1) Construction of a recombinant vector expressing agarase and neojagato-biohydrolase
[0105] The gene of the secretion peptide in this embodiment is from the alpha-mating factor (a-factor mutant) of Saccharomyces cerevisiae, the nucleotide sequence of which is shown in SEQ ID NO. 1, which is mainly responsible for regulating the extracellular expression of downstream proteins. The gene cluster sequence contains a Kozak sequence, which provides an important signal and binding site for ribosome recognition of the start codon, and can significantly enhance the translation initiation efficiency. The agarase Aga3463 gene is from the genome of strain Pseudoalteromonas sp. NJ21 (NCBI sequence number of the gene is KF700697), the agarase Aga gene is from the genome of strain Aquimarina agarilytica ZC1 (NCBI sequence number of the gene is WP_010180283), the agarase PdAgaC gene is from the genome of strain Persicobacter sp. CCB-QB2 (NCBI sequence number of the gene is WP_053404800), the neoaigaro-biohydrolase agaNash gene is from the genome of strain Cellvibrio sp. OA-2007 (NCBI sequence number of the gene is WP_010182780), and the neoaigaro-biohydrolase NH852 gene is from the genome of strain Aquimarina agarilytica ZC1 (NCBI sequence number of the gene is AB911560). After codon optimization of the screened agarases from three different sources and the neoaigaro-biohydrolases from two different sources, six plasmids were constructed by permutation and combination.
[0106] The p426 Gal backbone vector (2μori, pBR322 ori, and F1 ori) was used to construct the Saccharomyces cerevisiae expression plasmid, in which URA3 is a screening marker, ampicillin (Amp) is a resistance label, and the strong promoter P GAL7 and the promoter P GAL1 The plasmid construction was performed by Gibson assembly method, and the specific operation was performed according to the instructions of the ready-to-use seamless cloning kit of Shengong (product number B632219-0020). The method is as follows: specific primers containing homologous arms (see Table 1, the lowercase letters in the primers are homologous arms) were designed, and high-fidelity enzyme Max DNA polymerase to carry out polymerase chain reaction (PCR) amplification to obtain the target fragment, and the PCR reaction system is as follows: DNA template (50-200 ng) 0.5 μL, forward and reverse primers (10 μM) 0.4 uL each, high-fidelity enzyme reaction buffer 10 μL, and ddH2O to 20 μL; the PCR reaction program is as follows: 98 ℃ pre-denaturation for 3 min, 98 ℃ for 10 s, 58 ℃ for 5 s, 72 ℃ for 0.5-3 min, 30 cycles; finally, 72 ℃ extension for 10 min; the amplified target fragment is detected by agarose gel electrophoresis, and the SanPrep column PCR product purification kit (model number B518141-0100) is used for purification and recovery of the gene fragment, and the gene concentration of all DNA samples is calculated by K5600C micro spectrophotometer. The DNA fragment-recovered PCR linearized plasmid and the target fragment are mixed, and the Gibson assembly reaction solution is added and connected at 50 ℃ for 45 min. The vector is transformed into Escherichia coli DH5α strain, and the positive single clone is screened by using the ampicillin resistance of the plasmid, and the successful ligation is verified by colony PCR and sequencing, to obtain the exogenous expression vector of the lysozyme.
[0107] The signal peptide widely used in yeast, i.e., the alpha-factor leader protein, is used to guide secretion. The alpha-factor mutant-AqAga fragment is obtained by using the genome of Saccharomyces cerevisiae CENPK2-1D (purchased from Shanghai Lianzu Biotechnology Co., Ltd.) as a template and using alpha-factor mutant-1 and alpha-factor mutant-2 as primers; the AqAga fragment is obtained by using the PUC57-AqAga plasmid (the nucleotide sequence of AqAga is shown as SEQ ID NO. 3) synthesized by GenScript as a template and using AqAga-F-1 and AqAga-R-2 as primers; the alpha-factor mutant-agaNash fragment is obtained by using alpha-factor mutant-3 and alpha-factor mutant-4 as primers; the agaNash fragment is obtained by using the PUC57-agaNash plasmid (the nucleotide sequence of agaNash is shown as SEQ ID NO. 6) synthesized by GenScript as a template and using agaNash-F-1 and agaNash-R-2 as primers; the backbone fragment A is obtained by using the p426Gal plasmid as a template and using plasmid backbone fragment one-1 and plasmid backbone fragment one-2 as primers; and the backbone fragment B is obtained by using the p426Gal plasmid as a template and using plasmid backbone fragment two-1 and plasmid backbone fragment two-2 as primers. The alpha-factor mutant-AqAga fragment, the AqAga fragment, the alpha-factor mutant-agaNash fragment, the agaNash fragment, the backbone fragment A and the backbone fragment B are mixed in a molar ratio of 1:1:1:1:1:1, and the above operation is performed to obtain the lysozyme expression vector as shown in SEQ ID NO. 7.Figure 2 The p426-AqAga-agaNash plasmid shown.
[0108] The α-factor mutant-Aga3463 fragment was obtained using the genome of Saccharomyces cerevisiae CEN PK2-1D as a template and α-factor mutant-1 and α-factor mutant-5 as primers; the Aga3463 fragment was obtained using the PUC57-Aga3463 plasmid (the nucleotide sequence of Aga3463 is shown as SEQ ID NO. 2) synthesized by GenScript as a template and Aga3463-F-1 and Aga3463-R-2 as primers; the α-factor mutant-NH852 fragment was obtained using α-factor mutant-3 and α-factor mutant-6 as primers; the NH852 fragment was obtained using the PUC57-NH852 plasmid (the nucleotide sequence of NH852 is shown as SEQ ID NO. 5) synthesized by GenScript as a template and NH852-F-1 and NH852-R-2 as primers; and the backbone fragment C was obtained using the p426Gal plasmid as a template and plasmid backbone fragment two-3 and plasmid backbone fragment two-4 as primers. The α-factor mutant-Aga3463 fragment, the Aga3463 fragment, the α-factor mutant-NH852 fragment, the NH852 fragment, the backbone fragment A, and the backbone fragment C were mixed at a molar ratio of 1:1:1:1:1:1, and the P426-Aga3463-NH852 plasmid was obtained by following the above procedure.
[0109] The α-factor mutant-AqAga fragment, the AqAga fragment, the α-factor mutant-NH852 fragment, the NH852 fragment, the backbone fragment A, and the backbone fragment B were mixed at a molar ratio of 1:1:1:1:1:1, and the P426-AqAga-NH852 plasmid was obtained by following the above procedure.
[0110] The PdAgaC fragment was obtained by using the genome of Saccharomyces cerevisiae CEN PK2-1D as a template and using the alpha-factor mutant-1 and the alpha-factor mutant-7 as primers; the PdAgaC fragment was obtained by using the PUC57-PdAgaC plasmid (the nucleotide sequence of PdAgaC is shown as SEQ ID NO. 4) synthesized by GenScript as a template and using PdAgaC-F-1 and PdAgaC-R-2 as primers; and the backbone fragment D was obtained by using the p426 Gal plasmid as a template and using the plasmid backbone fragment two-5 and the plasmid backbone fragment two-4 as primers. The alpha-factor mutant-PdAgaC fragment, the PdAgaC fragment, the alpha-factor mutant-NH852 fragment, the NH852 fragment, the backbone fragment A and the backbone fragment D were mixed at a molar ratio of 1:1:1:1:1:1, and the p426-PdAgaC-NH852 plasmid was obtained by following the above operation.
[0111] The backbone fragment E was obtained by using the p426 Gal plasmid as a template and using the plasmid backbone fragment two-3 and the plasmid backbone fragment two-2 as primers. The alpha-factor mutant-Aga3463 fragment, the Aga3463 fragment, the alpha-factor mutant-agaNash fragment, the agaNash fragment, the backbone fragment A and the backbone fragment E were mixed at a molar ratio of 1:1:1:1:1:1, and the p426-Aga3463-agaNash plasmid was obtained by following the above operation.
[0112] The backbone fragment F was obtained by using the p426 Gal plasmid as a template and using the plasmid backbone fragment two-5 and the plasmid backbone fragment two-2 as primers. The alpha-factor mutant-PdAgaC fragment, the PdAgaC fragment, the alpha-factor mutant-agaNash fragment, the agaNash fragment, the backbone fragment A and the backbone fragment F were mixed at a molar ratio of 1:1:1:1:1:1, and the p426-PdAgaC-agaNash plasmid was obtained by following the above operation.
[0113] (2) Construction of an engineered strain Sq-0 overexpressing tHMG1 and IDI1
[0114] The wild type S. cerevisiae CEN PK2-1D was engineered to integrate tHMG1 (truncated hydroxymethylglutaryl coenzyme A reductase, amino acid sequence as shown in SEQ ID NO. 7) and IDI1 (isopentenyl diphosphate delta isomerase, amino acid sequence as shown in SEQ ID NO. 9) into the genome GAL80 site to obtain the engineering strain S. cerevisiae Sq-0. The specific construction process is as follows:
[0115] A. Selection of genome GAL80 target and construction of Cas9-sgRNA plasmid
[0116] The wild type S. cerevisiae CEN PK2-1D genome was queried to locate the GAL80 gene open reading frame ORF. When using the CRISP-Cas9 system for S. cerevisiae gene editing, the specific 20nt sequence of sgRNA was screened by online design tool CHOPCHOP (https: / / chopchop.cbu.uib.no / ). A high-efficiency and non-off-target 20nt sgRNA target sequence (ACGATAGTTGCAGTATGGCG) was selected. In the construction of Cas9-sgRNA plasmid, the designed 20nt sequence was used as a homologous arm, and primer GAL80-sgRNA-F and primer GAL80-sgRNA-R were used for PCR linearization amplification. After recovering 10251bp fragments, 100ng of linearized plasmid was transformed into E. coli DH5α competent cells. To ensure the correctness of the plasmid construction, three positive transformants were randomly selected for culture, and the plasmid was extracted and sent to Shanghai Shengong Company for sequencing verification to obtain the Cas9-sgRNA plasmid targeting the GAL80 site. p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 was linearized by PCR amplification, and 100ng of linearized plasmid was recovered to transform into E. coli DH5α competent cells. To ensure the correctness of the plasmid construction, three positive transformants were randomly selected for culture, and the plasmid was extracted and sent to Shanghai Shengong Company for sequencing verification to obtain the Cas9-sgRNA plasmid targeting the GAL80 site. p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 was obtained by inserting the Cas9 protein gene into p426-SNR52p-gRNA.csr-1.Y-SUP4t (catalog number 68060, Baosai Biotechnology). The specific operation is as follows: taking p426-SNR52p-gRNA.csr-1.Y-SUP4t as the template, taking sg-F and sg-R as the primers, obtaining the sgRNA fragment; taking the SpCas9 plasmid of Addgene company as the template, taking Cas9-F and Cas-R as the primers, obtaining the Cas9 fragment; mixing the sgRNA fragment and the Cas9 fragment F at a molar ratio of 1:1, and following the above operation, obtaining p426-PTEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 plasmid.
[0117] B. Construction of donor DNA integration fragment
[0118] After the homologous arms of GAL80 site were introduced by primers, tHMG1 and IDI1 were amplified by PCR and assembled, and then purified into high-concentration T ADH1 -IDI1-P gal1,10 -tHMG1-T CYC1 linear donor DNA. The specific operation is as follows: taking the genome of Saccharomyces cerevisiae CEN PK2-1D as a template, and taking tHMG1-F and tHMG1-R as primers, a tHMG1 gene fragment (nucleotide sequence as shown in SEQ ID NO. 8) was obtained; at the same time, taking IDI1-F and IDI1-R as primers, an IDI1 gene fragment (nucleotide sequence as shown in SEQ ID NO. 10) was obtained. Taking pGAL1,10-MCS-His-MCS-Flag-URA plasmid (Biyun Tian) as a template, and taking P gal1,10 -F and P gal1,10 -R as primers, a bidirectional promoter P gal1,10 was obtained; taking GAL80-T ADH1 -F and GAL80-T ADH1 -R as primers, a terminator T ADH1 was obtained; taking GAL80-T CYC1 -F and GAL80-T CYC1 -R as primers, a terminator T CYC1 was obtained. The tHMG1 gene fragment, the IDI1 gene fragment, the bidirectional promoter P gal1,10 , the terminator T ADH1 and the terminator T CYC1 were mixed in a molar ratio of 1:1:1:1:1, Gibson assembly reaction liquid was added, and connection was carried out at 50°C for 45 min. The vector was transformed into Escherichia coli DH5α strain, and positive single colonies were screened by using the ampicillin resistance of the plasmid, and the successful connection was verified by colony PCR and sequencing. The correct vector was subjected to PCR amplification by primers GAL80-T ADH1 -F and GAL80-T CYC1 -R, and the SanPrep column PCR product purification kit was used to purify and recover the gene fragment, so that the donor DNA was obtained.
[0119] C. Yeast gene editing
[0120] The CEN PK2-1D of Saccharomyces cerevisiae was prepared into a state of being sensitive to editing according to the instructions of the ZYMO Frozen-EZ Yeast Transformation II Kit, and the amount of the Cas9-sgRNA plasmid targeting the GAL80 site was about 500 ng, and the amount of the linear donor DNA was 1 μg during the experiment. The transformation system was directly coated on the uracil YNB auxotrophic screening plate medium and incubated in a 30°C incubator for 4-5 days to form single plate colonies. The initial screening of the yeast transformants was verified by colony PCR: single colonies were picked from the uracil YNB auxotrophic plate and placed in a tube mixed with the PCR system, and the GAL80 site verification primer F and the GAL80 site verification primer R were used to verify whether the target gene was integrated into the yeast genome. In order to continue to use the uracil URA3 screening tag in subsequent experiments, it is necessary to discard the tag integrated in the gene. The specific operation is as follows: the above-mentioned correctly screened transformants were inoculated into YPD liquid medium, cultured in a 220 rpm, 30°C shaker for 16 h, coated on a solid YPD plate containing 1 mg / mL of 5-fluoroleucine for negative screening, and the colonies grown on the plate were subjected to PCR verification again. The correct strain indicates that the tag has been discarded, and the engineering strain S. cerevisiae Sq-0 (genotype: ΔGAL80::tHMG1+IDI1) is obtained at this time.
[0121] (3) Screening of engineering strains with high efficiency of degrading red algal polysaccharides
[0122] 1) The six plasmids (as shown in Table 4) obtained in step (1) were introduced into the Saccharomyces cerevisiae Sq-0 strain by lithium acetate transformation method to obtain six engineering strains, namely engineering strain Sq-Ag1, engineering strain Sq-Ag2, engineering strain Sq-Ag3, engineering strain Sq-Ag4, engineering strain Sq-Ag5, and engineering strain Sq-Ag6. The specific operation is as follows: the Sq-0 strain was picked from the solid plate and inoculated in YPD liquid medium, and cultured at 30°C, 220 rpm for 16 h. 500 μL of bacterial solution was centrifuged at 8000 rpm to remove the supernatant. 3 μL of salmon sperm ssDNA (denatured in boiling water for 5 min, then quickly inserted into ice for standby) with a concentration of 10 mg / mL, 100 μL of transformation solution (1 mL of transformation solution contains 800 μL of 50% PEG3350, 200 μL of 2 mol / L LiAc, 7.5 μL of β-mercaptoethanol, and the rest is deionized water), and 0.1-1 μg of plasmid were added in sequence. After mixing, it was placed in a 37°C water bath for 30 min, and then centrifuged at 8000 rpm for 3 min to remove the supernatant. Finally, the bacterial body was resuspended with 500 μL of sterile water, and 80 μL was coated on a uracil YNB auxotrophic plate and cultured at 30°C for 3-5 days.
[0123] Table 4. Genotypes of 6 agarase-based engineered strains
[0124]
[0125] 2) Six strains (Sq-Ag1, Sq-Ag2, Sq-Ag3, Sq-Ag4, Sq-Ag5, and Sq-Ag6) were individually inoculated into 5 mL of uracil-based YNB auxotrophic liquid medium and cultured at 30°C and 220 rpm for 16–24 h. 2 μL of each bacterial culture was then dropped onto Lugol's iodine agar plates and incubated for 48 h. The presence of a clear hydrolysis zone was observed; any undegraded portions would be stained dark by Lugol's iodine. Results are as follows: Figure 3 As shown in Figure A, a large transparent hydrolysis zone forms around the colony, indicating that all six strains have the ability to secrete agarase extracellularly.
[0126] 3) Pick single colonies of *Saccharomyces cerevisiae* from fresh (no more than one month old) plates and inoculate them onto YNB auxotrophic plates containing 3 mL of uracil. Incubate overnight at 30°C and 220 rpm to ensure the cells enter a stable logarithmic growth phase, thus obtaining the primary seed culture. Transfer the seed culture of the six activated engineered strains to YPDA medium at a 1% inoculation rate and incubate for 96 hours to obtain the fermentation broth. Determine the enzyme activities of agarase and neoagarbiose hydrolase. The composition of YPDA medium is as follows: 10 g / L yeast extract, 20 g / L peptone, 25 g / L red algae polysaccharide (catalog number: 214010, BD Bacto™, USA), 10 g / L glucose, and deionized water as the solvent.
[0127] A. Determination of agarase activity
[0128] Take 200 μL of fermentation broth and add it to an 800 μL colorimetric tube containing 0.3% w / v agar in Tris-HCl buffer (pH 8.0). Incubate at 40 °C with shaking for 20 min. Add 1 mL of DNS and incubate in a boiling water bath for 5 min. Cool and dilute to 10 mL with distilled water, then mix well. Measure the absorbance of 200 μL at 540 nm, using the inactivated enzyme solution as a control. According to the standard curve (Y = 1.391X - 0.07451, R...),... 2 =0.9974) to calculate the reducing sugar content in the fermentation broth. Enzyme activity unit (U) is defined as the amount of enzyme required to convert 1 μg of reducing sugar in 1 minute under the above conditions.
[0129] B. Determination of the activity of neo-agar-biose hydrolase
[0130] To detect neojuncose hydrolase, galactose detection kit (Abeam) was used. First, the galactose standard in the kit was diluted to 1 nmol / μL: 10 μL of 100 nmol / μL galactose standard was taken and added to 990 μL of galactose detection buffer and mixed well. 0, 2, 4, 6, 8, 10 μL of the diluted standard was added to a series of wells, respectively. The wells were supplemented with galactose detection buffer to 50 μL per well, and finally 0, 2, 4, 6, 8, 10 nmol of galactose standard was obtained per well. The galactose standard curve was plotted with the horizontal coordinate as the galactose concentration (nmol) and the vertical coordinate as the absorbance value (OD 570 nm ). The subsequent galactose content in the fermentation broth was calculated according to the standard curve (Y = 0.07252X + 0.03044, R 2 = 0.9945). 25 μL of fermentation broth (inactivated enzyme solution as control group) was added to 25 μL of 2 mM neojuncose, 44 μL of galactose assay buffer, 2 μL of galactose probe, 2 μL of galactose enzyme mix, 2 μL of HRP, and the total volume of the reaction reagent was 100 uL. The reaction reagent was incubated at 37°C for 40 min. Then, the absorbance value was obtained at a wavelength of 570 nm. The enzyme activity unit (U) was defined as the amount of enzyme required to convert 1 μmol of galactose per minute.
[0131] The results of enzyme activity determination are shown in B of Figure 3 Compared with the blank strain and the strain containing empty vector, the total enzyme activity of the engineering strain Sq-Ag5 reached the highest, and the enzyme activities of agarase AqAga and neojuncose hydrolase agaNash reached 31.79 U / mL and 49.14 mU / mL, respectively, which indicated that it could efficiently catalyze both key steps of agar degradation (agar depolymerization + neojuncose cleavage), providing a good foundation for subsequent fermentation application. Therefore, this strain was used for subsequent preliminary fermentation experiment.
[0132] Example 2: Engineering strain Sq-Ag5 for fermentation production of squalene with red algae polysaccharide as substrate
[0133] Since the pathway of rare ginsenoside Rh1 biosynthesis from glucose involves a large number of genes, a modular analysis method is adopted, which is divided into a squalene synthesis module and a rare ginsenoside Rh1 synthesis module. Squalene (a natural triterpenoid compound) is a key precursor of the rare ginsenoside synthesis pathway and is also a substance of the endogenous pathway in yeast. In the fermentation process, unlike monosaccharides such as glucose and xylose, red algae polysaccharide has viscosity, and when agar is the only carbon source in the culture medium, yeast cells cannot grow, and a small amount of glucose needs to be added in the early stage to start microbial growth. In this embodiment, the synthesis of squalene under different low glucose concentrations and red algae polysaccharide concentrations is studied orthogonally.
[0134] Since the red algae polysaccharide will coagulate under the fermentation conditions of yeast at 30℃, it is necessary to first explore the specific conditions for liquefying the red algae polysaccharide under the action of low-concentration hydrochloric acid. The liquefaction conditions must meet two goals: to ensure the flowability of the fermentation medium to facilitate the movement of microorganisms, and to ensure that no monosaccharides are hydrolyzed during the liquefaction pretreatment. In 25mL of yeast culture medium (consisting of 10g / L glucose and 25g / L red algae polysaccharide), a gradient of 0.001 to 0.01M (0.001M, 0.002M, 0.003M, 0.004M, 0.005M, 0.006M, 0.007M, 0.008M, 0.009M, 0.01M) of hydrochloric acid was used to treat at 121℃ for 20min. The results show that very low acid concentration (0.005M hydrochloric acid) can make agar open its structure to a flowing state, and the whole process does not coagulate during yeast shake flask culture; as shown in A of Figure 4 , 0.005M hydrochloric acid liquefied yeast culture medium was detected by HPLC, and no new cellobiose and monosaccharides were decomposed, and the medium was adjusted to pH 6.0 and used for yeast fermentation experiment. In 25mL of yeast culture medium (containing 10g / L glucose, 25g / L red algae polysaccharide), 0.005M of hydrochloric acid was added, 121℃ high-pressure sterilization was treated for 20min, and after cooling, the pH was adjusted to 6.0 as the liquefied fermentation medium. In the liquefied medium, the engineering strain Sq-Ag5 was added at an inoculation amount of 1% (v / v), and after inoculation, it was cultured in a shaker at 30℃ and 220rpm. As shown in B of Figure 4 , in the initial stage (0h), the middle stage (48h), and the terminal stage (120h) of fermentation, the medium state gradually transitions from viscous to clear after being decomposed by yeast. The medium is relatively turbid in the initial stage of fermentation, containing colloidal substances that have not been fully decomposed, and the amount of flocculation is significantly reduced in the middle stage, and the medium gradually becomes clear. In the terminal stage, the culture solution is transparent yellow, and there is basically no insoluble substance.
[0135] The orthogonal fermentation experiment YPDA liquid medium was configured with glucose concentration of 0, 2.5, 5, 7.5, 10 g / L, red algae polysaccharide 10, 15, 20, 25, 30 and 40 g / L, and the first-stage seed liquid was inoculated into a 250 mL shake flask containing 25 mL YPDA liquid medium at an inoculation amount of 1% v / v, and was fermented at 30°C and 220 rpm for 96 h. The squalene content in the fermentation liquid was detected by high performance liquid chromatograph (HPLC), so as to determine the optimal carbon source composition in the culture medium. In order to determine the squalene accumulation amount, 0.5 mL of the fermentation liquid was added to a broken tube containing 0.5 g of glass beads with a size of 0.5 mm and 1 mL of ethyl acetate. The Bioprep-24R instrument was used to break the cells, and then centrifuged at 10000 g for 1 min. The upper ethyl acetate layer was filtered through a 0.22 μm filter membrane, and subjected to HPLC analysis. The LC-16 (Shimadzu Corporation, Japan) equipped with an SPD-16 dual-wavelength ultraviolet detector and an Agilent Poroshell 120EC-C18 2.1×100 mm chromatographic column were used for detection. The eluent was 100% acetonitrile, the flow rate was 0.5 mL / min, the injection amount was 2 μL, and the detection wavelength was 210 nm. The results are shown in Figure 5 As shown in the results, the engineered strain Sq-Ag5 can realize step-by-step degradation and saccharification of red algae polysaccharide from 0 to 1. When the concentration of red algae polysaccharide is ≤25 g / L, the squalene yield increases with the increase of the concentration of red algae polysaccharide, but high-concentration red algae polysaccharide (more than 25 g / L) begins to inhibit the increase of squalene, and the possible reason is that high-concentration red algae polysaccharide can cause the viscosity of the culture medium to be too high, affecting oxygen transfer or cell metabolism. The highest squalene yield of 667.02 mg / L can be achieved with 10 g / L of glucose and 25 g / L of red algae polysaccharide.
[0136] Example 3: Fermentation production of rare ginsenoside Rh1 using red algae polysaccharide as substrate
[0137] (1) A recombinant Saccharomyces cerevisiae strain S. cerevisiae Rh1-con stably accumulating rare ginsenoside Rh1
[0138] The engineering strain S. cerevisiae Sq-0 was fermented for 96 h at 30 °C, 220 rpm using YPDA medium containing 10 g / L glucose, 25 g / L porphyra polysaccharide according to the method of Example 3. The data at the end of fermentation showed that only 5.89 mg / L of squalene was detected for the wild-type S. cerevisiae CEN PK2-1D, while the squalene yield of the engineering strain S. cerevisiae Sq-0 was as high as 362 mg / L. In order to synthesize the rare ginsenoside Rh1, the wild-type S. cerevisiae CEN PK2-1D and S. cerevisiae Sq-0 were used as the starting strains, and the enzymes of the heterologous pathway of the rare ginsenoside Rh1 were screened and integrated into the corresponding sites of the above two yeast strains by searching the literature and database, and the construction scheme is shown in Figure 6 (especially noteworthy is that the wild-type S. cerevisiae CEN PK2-1D does not integrate the two enzymes tHMG1 and IDI1). Among them, the GenBank accession number of the gene PgDDS (dammaradienol synthase) is AB265170.1, the GenBank accession number of the gene CYP716A47 (protopanaxadiol synthase) is JN604537.1, the GenBank accession number of the gene PgCPR1 (cytochrome P450 reductase) is AIC73829.1, the GenBank accession number of the gene CYP716A53v2 (protopanaxatriol synthase) is JX036031.1, and the GenBank accession number of the gene UGTPg100 (glycosyltransferase) is A0A0K0PVW1.1, and the above-mentioned genes are all codon-optimized according to the preference of S. cerevisiae.
[0139] Then the construction of yeast homologous recombination module was carried out. The expression module PgDDS was integrated at the X-3 site (chromosome coordinates Chr X:223616...224744), the expression module genes CYP716A47 and PgCPR1 were integrated at the XI-3 site (chromosome coordinates Chr XI:93378...94567), and the expression module genes CYP716A53v2 and UGTPg100 were integrated at the LPP1 site (SGD number: S000002911). The specific integration method in this embodiment is to edit the selected genomic sites of the Saccharomyces cerevisiae genome using the CRISPR-Cas9 system. The 20nt sequence of the sgRNA was designed in the website CHOPCHOP (https: / / chopchop.cbu.uib.no / ). The 20nt sequences of the X-3, XI-3, and LPP1 integration sites are GACACATTAGTCTCGTATGT, GTAGAAATCAGACGCACGCT, and ATGAAACTTGAATGTCCGCT, respectively. When constructing the Cas9-sgRNA plasmid, the designed 20nt sequence was used as the homologous arm, and primers X-3-sgRNA-F and X-3-sgRNA-R, XI-3-sgRNA-F and XI-3-sgRNA-R, and LPP1-sgRNA-F and LPP1-sgRNA-R were used to amplify the p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 PCR linearization amplification was performed, and after recovering the fragments of the three sites, 100 ng of linearized plasmid was transformed into E. coli DH5α competent cells. To ensure the correctness of the plasmid construction, three positive transformants were randomly selected for culture, and the plasmid was extracted and sent to Shanghai Shengong Company for sequencing verification. At this time, the Cas9-sgRNA plasmid with the sgRNA sequence targeting the X-3, XI-3, and LPP1 sites was constructed.
[0140] The gene editing of PgDDS was completed by introducing the upstream and downstream homologous arms of the X-3 site using primers, and then using PCR amplification and fusion PCR assembly. The purified high-concentration T ADH1 -PgDDS-P gal1,10 linear donor DNA was obtained. The specific operation is as follows: taking the PUC57-PgDDS plasmid (the nucleotide sequence of PgDDS is shown in SEQ ID NO. 11) synthesized by Shengong Company as the template, and taking PgDDS-F and PgDDS-R as the primers, the PgDDS fragment was obtained; taking the pGAL1,10-MCS-His-MCS-Flag-URA plasmid as the template, and taking X-3-T ADH1 -F and X-3-TADH1 -R is a primer to get terminator T ADH1 ; X-3-P gal1,10 -F and X-3-P gal1,10 -R is a primer to get bidirectional promoter X-3-P gal1,10 . The bidirectional promoter X-3-P gal1,10 , PgDDS gene fragment and terminator X-3-T ADH1 are mixed at a molar ratio of 1:1:1, Gibson assembly reaction solution is added, and ligation is performed at 50°C for 45 min. The vector is transformed into E. coli DH5a strain, and positive single colonies are screened using the ampicillin resistance of the plasmid. Colony PCR is used to verify successful ligation and sequencing, and the correct vector is amplified by PCR using primers X-3-T ADH1 -F and X-3-P gal1,10 -R, and the SanPrep column PCR product purification kit is used to purify and recover the gene fragment, thereby obtaining the donor DNA.
[0141] The gene editing of CYP716A47 and PgCPR1 is completed by using PCR amplification and fusion PCR assembly after introducing the upstream and downstream homologous arms of XI-3 site by primers, and then purifying the high-concentration P gal1,10 -CYP716A47-T ALT1 -P gal7 -PgCPR1-T CYC1 linear donor DNA. The specific operation is as follows: taking the PUC57-CYP716A47 plasmid (the nucleotide sequence of CYP716A47 is shown in SEQ ID NO. 12) synthesized by Sheng Wu Company as a template, and taking CYP716A47-F and CYP716A47-R as primers, a CYP716A47 fragment is obtained. Taking the PUC57-PgCPR1 plasmid (the nucleotide sequence of PgCPR1 is shown in SEQ ID NO. 13) synthesized by Sheng Wu Company as a template, and taking PgCPR1-F and PgCPR1-R as primers, a PgCPR1 fragment is obtained. Taking the pGAL1,10-MCS-His-MCS-Flag-URA plasmid as a template, and taking XI-3-P gal1,10 -F and XI-3-P gal1,10 -R as primers to get bidirectional promoter XI-3-P gal1,10 ; taking the genome of Saccharomyces cerevisiae CEN PK2-1D as a template, and taking T ALT1 -F and T ALT1 -R as primers to get ALT1 GAA1 Terminator, abbreviated as terminator T ALT1 ; taking the pGAL1,10-MCS-His-MCS-Flag-URA plasmid as a template, and taking P gal7 -F and P gal7R is a primer to obtain the terminator XI-3-T gal7 ; XI-3-T CYC1 F and XI-3-T CYC1 R is a primer to obtain the terminator XI-3-T CYC1 The CYP716A47 gene fragment, the bidirectional promoter XI-3-P gal1,10 , the PgCPR1 gene fragment, the terminator T ALT1 , and the terminator XI-3-T CYC1 are mixed at a molar ratio of 1:1:1:1:1, Gibson assembly reaction solution is added, and ligation is performed at 50°C for 45 min. The vector is transformed into the E. coli DH5a strain, positive monoclonal is screened by using the ampicillin resistance of the plasmid, and colony PCR is used to verify successful ligation and sequencing. The correct vector is PCR amplified by using primers XI-3-P gal1,10 F and XI-3-T CYC1 R, and the SanPrep column PCR product purification kit is used to purify and recover the gene fragment, so as to obtain the donor DNA.
[0142] The gene editing of CYP716A53v2 and UGTPg100 is completed by using PCR amplification and fusion PCR assembly after the upstream and downstream homologous arms of the LPP1 site are introduced by primers. The linear donor DNA is purified into high-concentration T ADH1 CYP716A53v2-P gal1,10 UGTPg100-T ALT1 . The specific operation is as follows: the PUC57-CYP716A53v2 plasmid (the nucleotide sequence of CYP716A53v2 is shown as SEQ ID NO. 14) synthesized by Sheng Wu Company is used as a template, CYP716A53v2-F and CYP716A53v2-R are used as primers, and the CYP716A53v2 fragment is obtained. The PUC57-UGTPg100 plasmid (the nucleotide sequence of UGTPg100 is shown as SEQ ID NO. 15) synthesized by Sheng Wu Company is used as a template, UGTPg100-F and UGTPg100-R are used as primers, and the UGTPg100 fragment is obtained. The pGAL1,10-MCS-His-MCS-Flag-URA plasmid is used as a template, LPP1-T ADH1 F and LPP1-T ADH1 R is a primer to obtain the terminator LPP1-T ADH1 ; LPP1-P gal1,10 F and LPP1-P gal1,10 R is a primer to obtain the bidirectional promoter LPP1-P gal1,10; with the genome of Saccharomyces cerevisiae CEN PK2-1D as a template, LPP1-T ALT1 -F and LPP1-T ALT1 -R as primers to obtain the terminator LPP1-T ALT1 The CYP716A53v2 gene fragment, the bidirectional promoter LPP1-P gal1,10 , the UGTPg100 gene fragment, the terminator LPP1-T ADH1 and the terminator LPP1-T ALT1 are mixed at a molar ratio of 1:1:1:1:1, Gibson assembly reaction solution is added, and ligation is performed at 50°C for 45 min. The vector is transformed into Escherichia coli DH5α strain, and positive monoclonal is screened by using the ampicillin resistance of the plasmid, and the successful ligation is verified by colony PCR and sequencing. The correct vector is subjected to PCR amplification by using primers LPP1-T ADH1 -F and LPP1-T ALT1 -R, and the SanPrep column PCR product purification kit is used for purification and recovery of the gene fragment, so as to obtain the donor DNA.
[0143] The wild-type Saccharomyces cerevisiae CEN PK2-1D and S. cerevisiae Sq-0 are prepared into competent cells and edited according to the instructions of Saccharomyces cerevisiae transformation kit ZYMO Frozen-EZ Yeast Transformation II Kit. The amount of Cas9-sgRNA plasmid added during the experiment is about 500 ng, and the amount of linear donor DNA added is 1 μg. The transformation system is directly coated on the uracil YNB auxotrophic selection plate medium, and incubated in a 30°C incubator for 4-5 days to form single plate colonies. The yeast transformants are screened by colony PCR: single colonies on the uracil YNB auxotrophic plate are picked and placed in a tube mixed with the PCR system, and the X-3, XI-3 and LPP1 site verification primers are used to verify whether the target gene is integrated into the yeast genome. In order to continue to use the uracil URA3 selection tag in subsequent experiments, it is necessary to discard the tag integrated in the gene. The specific operation is as follows: the above-mentioned correctly screened transformants are inoculated into YPD liquid medium, cultured in a 220 rpm, 30°C shaker for 16 h, coated on a solid YPD plate containing 5-fluorouracil for negative screening, and the colonies grown on the plate are subjected to PCR verification again. At this time, the correct strain indicates that the tag has been discarded, and the engineering strain S. cerevisiae SC0Rh1 and the engineering strain S. cerevisiae Rh1-con are obtained, respectively.
[0144] (2) Recombinant strain synthesizes rare ginsenoside Rh1 using red algae polysaccharide as a substrate
[0145] The plasmid p426-AqAga-agaNash was introduced into the engineered strains S. cerevisiae SC0Rh1 and S. cerevisiae Rh1-con according to the lithium acetate transformation method in Example 1, obtaining the engineered strains S. cerevisiae SC0Rh1-Ag and S. cerevisiae Rh1-Ag. The primary seed liquid was transferred into YPDA medium (carbon source: 25 g / L porphyran, 10 g / L glucose) at a volume ratio of 1%, and cultured at 30°C, 220 rpm for 144 h. The sugar consumption, cell growth and rare ginsenoside Rh1 production were detected at 0, 12, 24, 48, 72, 96, 120 and 144 h after inoculation, respectively. The yeast cells were broken according to the method in Example 2, wherein the extractant ethyl acetate was replaced by n-butanol. The detection of rare ginsenoside Rh1 used LC-16 high performance liquid chromatograph equipped with SPD-16 dual-wavelength ultraviolet detector, and the chromatographic column was Neptune 5u C18 (250 x 4.6 mm); the mobile phase was water / acetonitrile; the detection wavelength was 203 nm, and the column temperature was 35°C. The gradient elution method was used: 0-6 min, 40-100%; 6-18 min, 100%; 18-25 min, 100-40%; 25-35 min, 40%. The results are shown in Figure 7 As compared with the control strain Rh1-con (only relying on a single carbon source glucose), the Rh1 production of Rh1-Ag was significantly improved in the late fermentation period (72-144 h), indicating that the engineered strain could continuously utilize porphyran to synthesize rare ginsenoside Rh1, and the highest yield was 141.78 mg / L at 144 h, and the specific fermentation liquid high performance liquid chromatogram is shown in Figure 8 As compared with the control strain Rh1-con (only relying on a single carbon source glucose), the Rh1 production of Rh1-Ag was significantly improved in the late fermentation period (72-144 h), indicating that the engineered strain could continuously utilize porphyran to synthesize rare ginsenoside Rh1, and the highest yield was 141.78 mg / L at 144 h, and the specific fermentation liquid high performance liquid chromatogram is shown in
[0146] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement modes, and all shall be included in the protection scope of the present application.
Claims
1. A brewing yeast that utilizes seaweed biomass to produce rare ginsenosides, characterized in that... It has the following characteristics: (1) Overexpression of agarase and neoagarbiose hydrolase; (2) Overexpression of hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate δ isomerase; (3) Overexpression of dammarene diol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxadiol synthase and glycosyltransferase; The agarase mentioned is derived from *Pseudoalteromonas* (…). Pseudoalteromonas Agarase derived from Corynebacterium marineum (Agaricus hydrophila) Aquimarina agarilytica agarase and agarase derived from Chlorobacterium acnes ( Persicobacter At least one of the agarases; The nucleotide sequence of the gene encoding the agarase derived from *Pseudomonas alterniflora* is shown in SEQ ID NO.2; The nucleotide sequence of the gene encoding the agarase derived from Corynebacterium marineis is shown in SEQ ID NO.3; The nucleotide sequence of the gene encoding the agarase derived from Chlorella is shown in SEQ ID NO.4; The aforementioned agarobacterium bisaccharide hydrolase is derived from Corynebacterium marineum (Agarolyticum). Aquimarina agarilytica The new agarobiose hydrolase and the enzyme derived from Vibrio fibrosus ( Cellvibrio At least one of the following: agarobacterium hydrolases; The nucleotide sequence of the gene encoding the novel agarobacterium bisaccharide hydrolase derived from Corynebacterium agaricum is shown in SEQ ID NO. 5; The nucleotide sequence of the gene encoding the novel agarobacterium hydrolase derived from Vibrio fibrosus is shown in SEQ ID NO. 6; The amino acid sequence of the hydroxymethylglutaryl-CoA reductase is shown in SEQ ID NO.7; The amino acid sequence of the isopentenyl diphosphate delta isomerase is shown in SEQ ID NO. 9; The nucleotide sequence of the gene encoding the dammarene diol synthase is shown in SEQ ID NO.11; The nucleotide sequence of the gene encoding the protopanaxadiol synthase is shown in SEQ ID NO.12; The nucleotide sequence of the gene encoding the cytochrome P450 reductase is shown in SEQ ID NO.13; The nucleotide sequence of the gene encoding the protopanaxadiol synthase is shown in SEQ ID NO.14; The nucleotide sequence of the gene encoding the glycosyltransferase is shown in SEQ ID NO.
15.
2. The brewing yeast for producing rare ginsenosides using seaweed biomass according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the hydroxymethylglutaryl-CoA reductase is shown in SEQ ID NO. 8; The nucleotide sequence of the gene encoding the isopentenyl diphosphate delta isomerase is shown in SEQ ID NO.
10.
3. The brewing yeast for producing rare ginsenosides using seaweed biomass according to claim 1, characterized in that: The hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate δ isomerase are integrated into the GAL80 site of the genome; The dammarene diol synthase described herein is integrated at the X-3 site of the genome; The protopanaxadiol synthase and the protopanaxadiol synthase are integrated at the XI-3 site of the genome; The protopanaxadiol synthase and the glycosyltransferase are integrated into the LPP1 site of the genome.
4. The brewing yeast for producing rare ginsenosides using seaweed biomass according to claim 1, characterized in that: The starting strain of the Saccharomyces cerevisiae used to produce rare ginsenosides from seaweed biomass is the Saccharomyces cerevisiae CEN PK series strain. The seaweed biomass mentioned is algal polysaccharide.
5. The method for constructing a brewing yeast for producing rare ginsenosides using seaweed biomass as described in any one of claims 1 to 4, characterized in that... Includes the following steps: 1) Construct recombinant vectors expressing agarase and neo-agarbiose hydrolase; 2) Constructing Cas9-sgRNA plasmids: Specifically, constructing Cas9-sgRNA plasmids targeting the GAL80 site, Cas9-sgRNA plasmids targeting the X-3 site, Cas9-sgRNA plasmids targeting the XI-3 site, and Cas9-sgRNA plasmids targeting the LPP1 site. 3) Constructing donor fragments: Specifically, donor fragments of hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase genes, donor fragments of dammarene diol synthase genes, donor fragments of protopanaxadiol synthase and cytochrome P450 reductase genes, and donor fragments of protopanaxadiol synthase and glycosyltransferase genes. 4) Gene editing: The Cas9-sgRNA plasmid obtained in step 2) and the donor fragment obtained in step 3) were transformed into the starting strain of Saccharomyces cerevisiae. After screening, recombinant strains overexpressing hydroxymethylglutaryl-CoA reductase, isopentenyl diphosphate δ isomerase, dammarene diol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxadiol synthase and glycosyltransferase were obtained. 5) Construction of Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass: The recombinant vector obtained in step 1) was transferred into the recombinant strain obtained in step 4) to obtain Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass.
6. The construction method according to claim 5, characterized in that: The recombinant vector has a p426 Gal plasmid as its vector framework. The recombinant vector also contains a secretory peptide gene; The nucleotide sequence of the sgRNA in the Cas9-sgRNA plasmid targeting the GAL80 site is shown below: ACGATAGTTGCAGTATGGCG. The nucleotide sequence of the sgRNA in the Cas9-sgRNA plasmid targeting the X-3 site is shown below: gacacattagtctcgtatgt; The nucleotide sequence of the sgRNA in the Cas9-sgRNA plasmid targeting the XI-3 site is shown below: GTAGAAATCAGACGCACGCT; The nucleotide sequence of the sgRNA in the Cas9-sgRNA plasmid targeting the LPP1 site is shown below: ATGAAACTTGAATGTCCGCT. The structure of the hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase gene donor fragments is terminator-hydroxymethylglutaryl-CoA reductase gene-promoter-isopentenyl diphosphate delta isomerase gene-terminator; The structure of the protopanaxadiol synthase and cytochrome P450 reductase gene donor fragments is promoter-protopanaxadiol synthase gene-terminator-promoter-cytochrome P450 reductase gene-terminator; The structure of the protopanaxadiol synthase and glycosyltransferase gene donor fragments is terminator-protopanaxadiol synthase gene-promoter-glycosyltransferase gene-terminator.
7. The construction method according to claim 6, characterized in that: The secretory peptide gene mentioned above is derived from the α-mating factor of Saccharomyces cerevisiae; The terminator in the donor fragments of the hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase genes is T. ADH1 Terminator and T CYC1 Terminator; promoter is P gal1,10 promoter; The terminator in the dammarene diol synthase gene donor fragment is T. ADH1 Terminator, promoter is P gal1,10 promoter; The terminator in the donor fragments of the protopanaxadiol synthase and cytochrome P450 reductase genes is T. ALT1 Terminator and T CYC1 Terminator; promoter is P gal1,10 promoters and P gal7 promoter; The terminator of the protopanaxadiol synthase and glycosyltransferase gene donor fragments is T. ADH1 Terminator and T ALT1 Terminator; promoter is P gal1,10 Promoter.
8. The use of the Saccharomyces cerevisiae according to any one of claims 1 to 4 in the production of squalene and / or rare ginsenoside Rh1 using red algae polysaccharides as substrates.
9. The application according to claim 8, characterized in that... The method includes the following steps: fermenting the Saccharomyces cerevisiae of any one of claims 1 to 4, which utilizes seaweed biomass to produce rare ginsenosides, in a culture medium containing red algae polysaccharides to obtain squalene and / or rare ginsenoside Rh1.
Citation Information
Patent Citations
Method for producing limonene and derivatives thereof through metabolic engineering modified saccharomyces cerevisiae
CN116515658A
Pichia pastoris recombinant strain for producing squalene as well as construction method and application of pichia pastoris recombinant strain
CN117904167A
Cited By
Single plasmid integrated CRISPR / Cas9 gene editing system as well as preparation method and application thereof
CN121699959A