Deinococcus micrococci and application thereof
Through the application of fermentation products of microcens, the lack of natural ultraviolet absorbers in cosmetics is solved, and cosmetic ingredients with high safety and effective antioxidant, anti-inflammatory and moisturizing effects are provided, especially the preparation and application of polypeptides and polynucleotides.
Patent Information
- Application Number
- CN202510234740.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-03-01
- Filing Date
- 2025-02-28
- Publication Date
- 2025-09-02
AI Technical Summary
Most of the ultraviolet absorbers in existing skin care products are chemical synthetics, and there are doubts about their safety and effectiveness. Research on the separation of natural microorganisms and application in cosmetics has not been fully developed.
Deinococcus weizhi and its fermentation broth, fermentation product filtrate, fermentation lysate or extract are provided, and are used as antioxidant, moisturizing and anti-inflammatory ingredients for cosmetics, especially through the preparation and application of chemically synthesized polypeptides and polynucleotides.
It has achieved medium and high safety of cosmetics, strong cell repair ability, anti-inflammatory and moisturizing effects, and polypeptides and polynucleotides have significant antioxidant effects and are suitable for the preparation of antioxidant products.
Smart Images

Figure CN120574701A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the separation, identification and application of a new species of Deinococcus. Background Art
[0002] Deinococcus strains are a class of bacteria with exceptional resistance to radiation. These strains do not form endospores, and their cells are spherical or rod-shaped and non-motile. In 1956, Anderson discovered the first Deinococcus strain, Deinococcus radiodurans R1, from canned meat that had been sterilized by radiation. This bacterium has been extensively studied to elucidate its radiation resistance mechanism. Currently, this genus encompasses 20 published species. Because Deinococcus strains have a radiation tolerance that is over a thousand times greater than that of Escherichia coli, their application in research has garnered significant attention.
[0003] Common radiation includes solar radiation, electromagnetic radiation, and thermal radiation. The most damaging to human skin are UVA and UVB rays contained in sunlight, with UVB being the primary cause of skin damage. To prevent damage from external radiation, people often add various UV absorbers to skincare products. Compared to conventional UV absorbers, naturally derived UV protectants not only offer superior UV protection but are also safer, non-toxic, and non-irritating.
[0004] In addition, the isolation and screening of natural microorganisms and the application of natural ingredients in cosmetics have become a hot topic in research and development in the pharmaceutical and cosmetics industries, and have high practical application value. Summary of the Invention
[0005] An object of the present invention is to provide a new microbial strain resource.
[0006] Various aspects of the invention, together with preferred embodiments, are described in the appended claims.
[0007] In one aspect, the present invention provides a microbial strain resource related to a species of Deinococcus weizhi. The Deinococcus weizhi described in the present invention may also be referred to as Deinococcus sp.
[0008] Another aspect of the present invention relates to a fermentation broth, a fermentation product filtrate, a fermentation lysate or an extract of a fermentation broth of Deinococcus weizhi.
[0009] Another aspect of the present invention relates to the use of Deinococcus weizhi or its fermentation liquid, fermentation product filtrate, fermentation lysate, and fermentation liquid extract in the preparation of probiotic fermentation cosmetic raw materials.
[0010] Furthermore, more specifically, the strain or its fermentation liquid, fermentation product filtrate, fermentation lysate, or fermentation liquid extract is used as one or more of the active ingredients in cosmetic raw materials for antioxidant, moisturizing, anti-inflammatory, anti-photoaging, or anti-glycation.
[0011] Another aspect of the present invention relates to the use of Deinococcus weizhi or its fermentation broth, fermentation product filtrate, fermentation lysate, and fermentation broth extract in the preparation of antioxidant products.
[0012] Furthermore, as a specific embodiment, the antioxidant product is selected from health products, pharmaceutical compositions or cosmetics.
[0013] Another aspect of the present invention relates to a health product comprising the Deinococcus weizhi or its fermentation broth, fermentation product filtrate, fermentation lysate or fermentation broth extract.
[0014] Another aspect of the present invention relates to a pharmaceutical composition comprising the Deinococcus weizhi or its fermentation broth, fermentation product filtrate, fermentation lysate or fermentation broth extract.
[0015] Another aspect of the present invention relates to a cosmetic composition comprising the strain or one or more of its fermentation broth, fermentation product filtrate, fermentation lysate, and fermentation broth extract.
[0016] Furthermore, more specifically, the cosmetics or skin care products are characterized in that they include cosmetics or skin care products in dosage forms such as lotions, essences, ointments, creams, milks, gels, and facial masks.
[0017] Further, as a specific embodiment, the Deinococcus weizhi is Deinococcus sp. VB142, which is deposited in the China Center for Type Culture Collection (CCTCC) of Wuhan University with a deposit number of CCTCC M2024185 and a deposit date of January 23, 2024; and is also deposited in the Korea Culture Collection (KCTC) with a deposit number of 15470BP and a deposit date of June 19, 2023.
[0018] Further, as a specific embodiment, the Deinococcus weizhi is Deinococcus sp. VB226, China Center for Type Culture Collection (CCTCC), Wuhan University, with a deposit number of CCTCC M2024186 and a deposit date of January 23, 2024.
[0019] As used herein, the term "sequence identity" refers to the degree of identity of the amino acid residues or bases between sequences after aligning the two sequences for maximum correspondence over a specified region of comparison.
[0020] The present invention provides a new microbial strain resource, specifically relates to Deinococcus weizhi identified as a new species, and provides specific Deinococcus sp. VB142 and Deinococcus sp. VB226 obtained by conventional fermentation. The fermentation broth, fermentation product filtrate, fermentation lysate, and fermentation broth extract can be used to prepare antioxidant products selected from health products, pharmaceutical compositions or cosmetics, and have broad application value and market prospects.
[0021] The second aspect of the present invention provides a polypeptide having an amino acid sequence with at least 90% sequence identity to the amino acid sequence shown in SEQ ID NO. 3.
[0022] The polypeptides provided by the present invention have high safety, strong cell repair capabilities, anti-inflammatory, scar-lightening, and hydrating properties. The polypeptides of the present invention are derived from Deinococcus microti. Through further genomic research, the inventors analyzed the differences between the genomes of Deinococcus microti and other Deinococcus species, discovered a series of exocrine polypeptides unique to Deinococcus microti and isolated several with repair and anti-inflammatory properties. Based on the amino acid sequences of the isolated polypeptides, those skilled in the art can more quickly obtain the polypeptides of the present invention through chemical synthesis.
[0023] The term "peptide" used in this specification may refer to a linear molecule formed by amino acid residues bound to each other through peptide bonding. The peptide can be prepared according to chemical synthesis methods known in the art, especially according to solid phase synthesis technology.
[0024] According to specific embodiments of the present invention, the polypeptides provided herein can be directly chemically synthesized, isolated from a secretory polypeptide of Deinococcus weizhi, or transferred into other host cells for secretory expression. The present invention provides the amino acid sequences of the aforementioned polypeptides. Those skilled in the art can obtain the polypeptides described herein using existing techniques, and any method known in the art for obtaining polypeptides is within the scope of protection of the present invention. The synthesized polypeptides can be directly stored in powdered form for ease of storage and transportation.
[0025] The third aspect of the present invention provides an isolated polynucleotide encoding the polypeptide described above, wherein:
[0026] According to a specific embodiment of the present invention, the polynucleotide has at least one of the nucleotide sequences shown in SEQ ID NO. 4 with a sequence identity of at least 90%.
[0027] It should be noted that, for the nucleic acids mentioned in the present specification and claims, those skilled in the art will understand that they actually include any one or both of the complementary double strands. For convenience, although only one strand is provided in most cases in this specification and claims, the other strand complementary thereto is also disclosed. In addition, the nucleic acid sequences in this application include DNA forms or RNA forms, and disclosure of one of them means that the other is also disclosed. Those skilled in the art can easily synthesize the polypeptides of the present invention using the nucleic acid sequences or amino acid sequences provided by the present invention.
[0028] The fourth aspect of the present invention is to provide a plurality of expression vectors, wherein the expression vectors comprise the polynucleotides as described above, wherein:
[0029] According to a specific embodiment of the present invention, the expression vector comprises a polynucleotide shown in SEQ ID NO. 4 with at least 90% sequence identity.
[0030] According to an embodiment of the present invention, the expression vector may include optional control sequences that are operably linked to the nucleic acid molecule. The control sequences are one or more control sequences that direct the expression of the nucleic acid molecule in a host. The expression vectors proposed in the embodiments of the present invention can efficiently express the polypeptide in large quantities in suitable host cells.
[0031] The fifth aspect of the present invention is to provide a recombinant cell carrying the above-mentioned polynucleotide, the above-mentioned expression vector or capable of expressing the above-mentioned polypeptide.
[0032] According to a specific embodiment of the present invention, the recombinant cell is obtained by introducing the aforementioned expression vector into a host cell.
[0033] It should be noted that the recombinant cells of the present invention are not particularly limited and may be prokaryotic cells, eukaryotic cells, or bacteriophages. The prokaryotic cells may be Escherichia coli, Bacillus subtilis, Streptococcus, or Proteus mirabilis, among others. The eukaryotic cells include fungi such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Trichoderma, insect cells such as fall armyworms, plant cells such as tobacco, and mammalian cells such as BHK cells, CHO cells, COS cells, and myeloma cells. In some embodiments, the recombinant cells of the present invention are preferably mammalian cells, including BHK cells, CHO cells, NSO cells, or COS cells, and do not include animal germ cells, fertilized eggs, or embryonic stem cells.
[0034] The host cell is transformed and / or transfected with the expression vector.
[0035] The sixth aspect of the present invention provides a composition, wherein the drug comprises at least one of the aforementioned polypeptides, polynucleotides, expression vectors, recombinant cells, and compositions.
[0036] The seventh aspect of the present invention is to provide an external medicine, which comprises at least one of the aforementioned polypeptides, polynucleotides, expression vectors, recombinant cells, and compositions.
[0037] According to a specific embodiment of the present invention, the drug comprises a polypeptide of SEQ ID NO. 3 or a combination thereof having at least 90% sequence identity as an active ingredient.
[0038] According to a specific embodiment of the present invention, the external medicine includes dosage forms such as ointment, pill, water, wine, powder, and medicine thread (medicine tablet), which can be used directly. The usage includes plaster, coating, application, mixing, fumigation, washing, soaking, bathing, eye drops, ear irrigation, nasal drops, etc.
[0039] According to a specific embodiment of the present invention, the topical drug dosage forms include solution type, suspension type, emulsion type; ointments can also be divided into ointments, creams, gels; there are also tinctures, liniments, spirits, powders, oils, pastes, plasters, film coatings, aerosols, etc.
[0040] The eighth aspect of the present invention is to provide a cosmetic comprising at least one of the aforementioned polypeptide, polynucleotide, expression vector, recombinant cell, and composition.
[0041] According to a specific embodiment of the present invention, the cosmetic comprises a polypeptide of SEQ ID NO. 3 or a combination thereof having at least 90% sequence identity as an active ingredient.
[0042] According to the "Regulations on the Management of Cosmetics Labels", cosmetics refer to products that are applied to the human body (skin, hair, nails, lips, teeth, etc.) by smearing, spraying, drinking or other similar methods to achieve the purpose of cleaning, maintenance, beautification, modification and change of appearance, or to correct human odor and maintain good condition.
[0043] According to a specific embodiment of the present invention, the cosmetics include cleaning products, skin care products, oral products, etc.
[0044] A ninth aspect of the present invention provides the use of the aforementioned polypeptide, polynucleotide, expression vector, recombinant cell, and composition in the preparation of cosmetics.
[0045] According to a specific embodiment of the present invention, the cosmetic has at least one of the effects of anti-inflammation, scar reduction, and moisturizing.
[0046] The tenth aspect of the present invention provides the use of the aforementioned polypeptide, polynucleotide, expression vector, recombinant cell, and composition in the preparation of a drug.
[0047] According to a specific embodiment of the present invention, the drug has at least one of the effects of anti-inflammation, accelerating wound healing of the skin surface, and reducing scar formation.
[0048] The present invention also provides a use of the aforementioned polypeptide sequence (SEQ ID NO. 3) and nucleotide sequence (SEQ ID NO. 4) for identifying Deinococcus microti.
[0049] Furthermore, the present invention also provides a method for identifying microdeinococci, comprising:
[0050] (1) designing a primer set that is reverse complementary to the sequence of the polynucleotide described in the second aspect;
[0051] (2) using the primer set to amplify the sample to be tested,
[0052] Wherein, the sample to be tested from which the nucleic acid fragment can be amplified is a sample containing Deinococcus microti.
[0053] Further, as a specific embodiment, the primer set has the nucleotide sequences shown as SEQ ID No. 5 and SEQ ID No. 6. BRIEF DESCRIPTION OF THE DRAWINGS
[0054] Figure 1 The results of ANI analysis and comparison of Deinococcus weizhi VB142 and VB226 with Deinococcus species are shown;
[0055] Figure 2The results of DPPH radical scavenging rate of Deinococcus weizhi fermentation lysates VB142-1, VB226-1 and fermentation product filtrates VB142-2, VB226-2 in antioxidant test are shown.
[0056] Figure 3 These are the hydroxyl radical scavenging results of Deinococcus weizhi fermentation lysates VB142-1, VB226-1 and fermentation product filtrates VB142-2, VB226-2 in antioxidant testing.
[0057] Figure 4 A graph showing the activity of the polypeptide in Example 8 of the present invention in promoting HaCaT cell scratch repair;
[0058] Figure 5 The figure shows the tail area of zebrafish in the test of the moisturizing and hydrating efficacy of the polypeptide in Example 10 of the present invention;
[0059] Figure 6 The figure shows the moisturizing and hydrating rate (%) of the polypeptide in Example 10 of the present invention;
[0060] Figure 7 The nucleic acid electrophoresis diagram of the PCR products of the polypeptide nucleotides (SEQ ID NO. 4) of Deinococcus urumqiensis R12, Deinococcus radiodurans DSM20539, Deinococcus microcaulis VB142, and VB226 is shown;
[0061] Figure 8 The comparison results of polypeptide nucleotide sequence sequencing of Urumqi Deinococcus R12, Deinococcus weizhi VB142, and VB226 are shown. DETAILED DESCRIPTION
[0062] The present invention will be further described below with reference to the examples, but the present invention is not limited by the following examples.
[0063] The present invention provides a use of the above-mentioned polypeptide sequence and nucleotide sequence for identifying Deinococcus microti.
[0064] Sequence analysis: Alignments were performed using the ClustalW sequence alignment method with default parameters. The preferred parameter settings used were: for pairwise alignments: Gap open penalty: 10; Gap extension penalty: 0.1, and for multiple alignments, a gap open penalty of 10 and a gap extension penalty of 0.2. The protein weight matrix was set to Identity. Residue specificity and hydrophobicity penalties were both "on," gap spacing was 4, and terminal gap spacing was "off." No negative matrices were used, and finally, the Delay Divergent Cut-off was set to 30%.
[0065] The determination method of the present invention determines sequence similarity based on sequence identity. In bacterial identification, according to currently accepted guidelines, if the 16S rRNA sequence similarity between two bacteria is less than 97%, it generally indicates that they may belong to different species. Conversely, if the similarity is greater than 97%, it indicates that the species are closer in taxonomy. This threshold is based on extensive research on bacterial 16S rRNA sequence comparisons and reflects the subtle but significant genetic differences between species. Even if the currently commonly used 16S rRNA score exceeds the species classification threshold, it still cannot be used to confirm that the species belongs to the same species. Further genome-wide determination is usually required using the Average Nucleotide Identity (ANI). This metric, based on the average value of all orthologous protein-coding genes in each genome, is used to compare the genetic relationship between two genomes at the nucleotide level. ANI has a high degree of discrimination between closely related species, with an ANI value of 95% being considered the standard for species demarcation, meaning that an ANI value greater than 95% is considered a species. For polypeptide sequence identification, the similarity criteria are different. In the present invention, two polypeptide sequences are considered similar if their identity reaches or exceeds 80%. This standard reflects that at the protein level, even if there is a certain degree of sequence difference, structural and functional similarities may still be retained.
[0066] Sequence identity: A quantitative measure of the degree of homology between two amino acid sequences or two nucleotide sequences of equal length. If the sequences to be compared are not of equal length, they must be aligned to give the best possible match, allowing for the insertion of gaps or (optionally) truncation at the ends of the polypeptide or nucleotide sequence. Sequence identity can be calculated using where Ndif is the total number of residues that are not identical in the two sequences after alignment, and Nref is the number of residues in one sequence. Thus, the DNA sequence AGTCAGTC and the sequence AATCAATC (Ndif=2 and Nref=8) have 75% sequence identity. Gaps are calculated as the inconsistency of specific residues, i.e., the DNA sequence AGTGTC and the DNA sequence AGTCAGTC (Ndif=2 and Nrep=8) have 75% sequence identity. For all embodiments of the present invention relating to amino acid sequences, the percentage of sequence identity between one or more sequences can also be based on an alignment performed using clustalW software (http: / / www.ebi.ac.uk / clustalW / index.html) using default settings.
[0067] SEQ ID NO.1:
[0068]
[0069] SEQ ID NO.2:
[0070]
[0071] SEQ ID No. 3
[0072] ASSPQREPEKRPTFSQLTDP
[0073] SEQ ID No.4
[0074] gccagctcccctcaaagggagccagaaaagcgtccaaccttttcccaactcacagacccctaa
[0075] SEQ ID No.5
[0076] ctcagtcagcttcgctgcc
[0077] SEQ ID No.6
[0078] Cgtagcacgggccttttagg
[0079] SEQ ID No.7
[0080] cccacggaatccagaacgatg
[0081] SEQ ID No.8
[0082] ccgcttgccataggtcttgc
[0083] Example 1. Isolation and identification of VB142.
[0084] 1. Separation of VB142
[0085] The strain VB142 with anti-ultraviolet properties was isolated and screened from the facial skin of adult women. The isolation method is as follows: using 20% glycerol as the sampling liquid, collect samples from the facial skin of adult women and add them to the sampling liquid. Take 100uL and spread it on solid culture medium, culture at 30℃ for 72h, select an orange-red strain, and obtain VB142 after repeated purification.
[0086] 2. Identification of VB142
[0087] (1) Morphological characteristics: When VB142 was cultured in TGY solid medium at 30°C for 72 h, the bacteria were spherical, and the colonies were round, small, convex, smooth, opaque, and orange-red.
[0088] (2) Physiological and biochemical characteristics: The following physiological and biochemical characteristics of VB142 were determined according to the methods of the Manual of Identification of Common Bacteria Systems.
[0089] VB142 is a Gram-positive bacterium and catalase-positive. Its utilization of different carbon sources is shown in Table 1.
[0090] Table 1. Carbon source utilization results of VB142
[0091]
[0092]
[0093] Note: “+” indicates that the carbon source can be utilized, and “-” indicates that the carbon source cannot be utilized.
[0094] (3) 16S rRNA gene
[0095] The 16S rRNA gene sequence of VB142 is shown in SEQ ID NO: 1. Similarity comparison results show that the most similar 16S rRNA gene sequence to this strain is Deinococcus wulumuqiensis R12 of the genus Deinococcus. T , and its sequence identity is 94.28%.
[0096] (4) G+C mol% value
[0097] The G+C mol% content of VB142 is 63.99%.
[0098] (5) Whole genome ANI value
[0099] Whole genome sequence analysis showed that Figure 1 As shown, VB142 and Deinococcus wulumuqiensis R12 T The ANI value of the alignment was 85.63%.
[0100] Based on morphological, physiological and biochemical characteristics, 16SrRNA gene and whole genome sequence analysis, VB142 was named a new species of the genus Deinococcus (Deinococcus weizhi).
[0101] Example 2: Isolation and identification of VB226.
[0102] 1. Separation of VB226
[0103] The strain VB226 with anti-ultraviolet properties was isolated and screened from the facial skin of adult women. The isolation method is as follows: using 20% glycerol as the sampling liquid, collect samples from the facial skin of adult women and add them to the sampling liquid. Take 100uL and spread it on solid culture medium, culture at 30℃ for 72h, select an orange-red strain, and obtain VB226 after repeated purification.
[0104] 2. Identification of VB226
[0105] (1) Morphological characteristics: VB226 was cultured in TGY solid medium at 30°C for 72 h. The bacteria were spherical, and the colonies were round, small, convex, smooth, opaque, and light orange-red.
[0106] (2) Physiological and biochemical characteristics: The following physiological and biochemical characteristics of VB226 were determined according to the methods of the Manual of Identification of Common Bacteria Systems.
[0107] VB226 is a Gram-positive bacterium and catalase-positive. Its utilization of different carbon sources is shown in Table 2.
[0108] Table 2. Carbon source utilization results of VB226
[0109]
[0110] Note: “+” indicates that the carbon source can be utilized, and “-” indicates that the carbon source cannot be utilized.
[0111] (3) 16S rRNA gene
[0112] The 16SrRNA gene sequence of VB226 is shown in SEQ ID NO.2. The similarity comparison results show that the most similar 16SrRNA gene sequence of this strain is Deinococcus wulumuqiensis R12 T ), with a sequence identity of 94.28%.
[0113] (4) G+C mol% value
[0114] The G+C mol% content of VB226 is 64%.
[0115] (5) Whole genome ANI value
[0116] Whole genome sequence analysis showed that Figure 1 As shown, VB226 and Deinococcus wulumuqiensis R12 T ) The ANI value of the comparison was 85.47%.
[0117] Based on morphological, physiological and biochemical characteristics, 16SrRNA gene and whole genome sequence analysis, VB226 was named a new species of the genus Deinococcus (Deinococcus weizhi).
[0118] Example 3
[0119] By using comparative genomics methods, the genomic information of the two new species of Deinococcus microphyllus described in Example 2 and other Deinococcus species disclosed in NCBI (such as Deinococcus urumqiensis and Deinococcus radiodurans) was analyzed, and their genomic sequence differences were found. It was found that Deinococcus microphyllus had certain specific sequences compared with other Deinococci. For example, the inventors of the present application unexpectedly discovered an exocrine polypeptide unique to Deinococcus microphyllus, such as the polypeptide described in the present invention, the amino acid sequence of which is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.
[0120] Furthermore, the position of the exocrine polypeptide unique to Deinococcus weizhi in the genome of Deinococcus weizhi VB142 is Chromosome 1 (2576018..2576080), and the position of the exocrine polypeptide unique to Deinococcus weizhi in the genome of Deinococcus weizhi VB226 is Chromosome 1 (66689..66772).
[0121] Example 4
[0122] A method for preparing a filtrate and fermentation lysate of a Deinococcus microcarpa fermentation product:
[0123] (1) Preparation of seeds / fermentation medium
[0124] According to the mass percentage of each substance in the total mass of the culture medium, 5.0 g of peptone, 5.0 g of yeast extract, and 1.0 g of glucose were dissolved in water and the volume was adjusted to 1 L as the seed / fermentation medium TGY, which was sterilized and cooled to room temperature for use.
[0125] (2) Bacteria activation
[0126] VB142 and VB226 were inoculated on TGY solid medium respectively and activated at 30℃.
[0127] (3) Obtaining VB142 and VB226 seed solutions
[0128] The activated VB142 and VB226 were inoculated into the seed culture medium prepared in (1) and cultured at 30°C for one day to obtain the VB142 and VB226 seed solutions.
[0129] (4) Obtaining VB142 and VB226 fermentation broth
[0130] The VB142 and VB226 seed liquids prepared in (3) were inoculated into the fermentation medium prepared in (1), and cultured at 30°C for 2-3 days to obtain VB142 and VB226 fermentation liquids.
[0131] (5) Preparation of fermentation product filtrate
[0132] The fermentation broth obtained in (4) was centrifuged at 8000 rpm / min for 10 min to obtain the fermentation product filtrate and bacterial cells of VB142 and VB226.
[0133] (6) Preparation of fermentation lysate
[0134] The VB142 and VB226 bacterial cells obtained in (5) were lysed and dissolved in water to obtain VB142 and VB226 fermentation lysates.
[0135] Example 5
[0136] The fermentation product filtrates and fermentation lysates of Deinococcus microti VB142 and VB226 obtained in Example 4 were respectively subjected to antioxidant activity testing as follows:
[0137] (1) DPPH free radical scavenging ability detection method
[0138] a. Sample testing
[0139] Add 10 μL of the test solution and 190 μL of the working solution to a 96-well plate, vortex to mix, and incubate in the dark at room temperature for 30 minutes. Measure the absorbance at 515 nm. A control tube is provided for each test tube.
[0140] b. Calculation formula
[0141] DPPH free radical scavenging rate D% = {[A 空白 -(A 样品 -A 对照 )]÷A 空白}×100%
[0142] The results are as follows Figure 2 As shown, the fermentation supernatants and lysates of VB142 and VB226 had the ability to scavenge DPPH free radicals.
[0143] (2) Hydroxyl radical scavenging ability test
[0144] a. Sample testing
[0145] Add the sample to be tested and the detection reagent to each EP tube, vortex to mix, and place in a 37°C water bath for 60 minutes. Centrifuge at 10,000 rpm for 10 minutes at room temperature. Transfer 200 μL of the supernatant to a 96-well plate and measure the absorbance at 536 nm.
[0146] b. Calculation formula
[0147] Hydroxyl radical scavenging rate D% = (A 测定 -A 对照 )÷(A 空白 -A 对照)×100%
[0148] The results are as follows Figure 3 As shown, the fermentation supernatants and lysates of VB142 and VB226 had the ability to scavenge hydroxyl radicals.
[0149] Example 6
[0150] Reagent preparation: The lysates of Deinococcus microti VB142 and VB226 obtained in Example 4 were respectively prepared into 1% stock solutions with standard dilution water and used immediately; Sodium hyaluronate water drink produced by Sinopharm Group Health Industry Research Institute Co., Ltd. was stored in a cool, dry and dark place, and the original solution was used as the stock solution.
[0151] Experimental Animals: Zebrafish were reared in aquaculture water at 28°C (water quality: 200 mg of instant sea salt per liter of reverse osmosis water, conductivity 450-550 μS / cm, pH 6.5-8.5, and hardness 50-100 mg / L CaCO3). These zebrafish were bred and provided by our company's aquaculture center under the Laboratory Animal Use License No. SYXK(Zhejiang)2022-0004. Their husbandry and management practices meet the requirements of AAALAC accreditation (certification number: 001458). Wild-type AB strain zebrafish were bred using natural pair mating. Zebrafish aged 6 hours post-fertilization (hpf) were used for the hydration and moisturizing efficacy evaluation of the samples.
[0152] Detection method: 2dpf melanin allele mutant Albino strain zebrafish were randomly selected in a 6-well plate, and 30 zebrafish were treated in each well (experimental group). The sample was given 0.025% water-soluble solution, and the positive control sodium hyaluronate water light drink was 0.05%. At the same time, a normal control group and a model control group were set up, and the capacity of each well was 3mL. Except for the normal control group, the other experimental groups were given sodium chloride water-soluble solution to establish a zebrafish water deprivation model. After treatment at 28℃ for 22h, 10 zebrafish were randomly selected from each experimental group and photographed under a dissecting microscope. NIS-ElementsD 3.20 advanced image processing software was used to analyze and collect data, and the zebrafish tail area (A) was analyzed. The statistical analysis results of this indicator were used to evaluate the hydrating and moisturizing efficacy of the sample. The statistical processing results are expressed as Mean±SEM. The formula for calculating the hydrating and moisturizing efficacy is as follows:
[0153] Moisturizing rate % = (S 样品 -S 模型对照 )÷(S 正常对照 -S 模型对照 )×100%
[0154] SPSS 26.0 software was used for statistical analysis, and P < 0.05 indicated that the difference was statistically significant. The specific results are shown in Table 3.
[0155] Table 3 Hydrating and moisturizing efficacy data
[0156]
[0157]
[0158] *: compared with the normal control group, P < 0.05; ***: compared with the normal control group, P < 0.001
[0159] As shown in Table 3, in the zebrafish water deprivation model, both VB142 and VB226 lysates have hydrating and moisturizing effects, and their effects are better than those of sodium hyaluronate water drink.
[0160] Example 7
[0161] Reagent preparation: The lysates of Deinococcus microti VB142 and VB226 obtained in Example 4 were respectively prepared into 1% stock solutions with standard dilution water and used immediately; dipotassium glycyrrhizate was prepared into 1% stock solutions with standard dilution water and used immediately.
[0162] Experimental Animals: Transgenic neutrophil green fluorescent MPX strain zebrafish were maintained at 28°C in aquaculture water (water quality: 200 mg of instant sea salt per liter of reverse osmosis water, conductivity 450-550 μS / cm, pH 6.5-8.5, and hardness 50-100 mg / L CaCO3). These zebrafish were bred and provided by our company's fish farming center under the Laboratory Animal Use License No. SYXK(Zhejiang)2022-0004. Their husbandry and management complies with AAALAC accreditation (certification number: 001458). Zebrafish were bred using natural pair mating. Zebrafish aged 2 days per 1 dpf were used for anti-inflammatory efficacy testing.
[0163] Experimental method: 2dpf transgenic neutrophil green fluorescent MPX strain zebrafish were randomly selected in a 6-well plate, and 30 zebrafish were treated in each well (experimental group). The sample was given 0.006% in water, and the positive control dipotassium glycyrrhizate was 0.031%. At the same time, a normal control group and a model control group were set up, and the capacity of each well was 3mL. Except for the normal control group, the other experimental groups were given sodium dodecyl sulfate in water to establish a zebrafish inflammation model. After treatment at 28°C for 18 hours, 10 zebrafish were randomly selected from each experimental group and photographed under a dissecting microscope. NIS-Elements D 3.20 advanced image processing software was used to analyze and collect data, and the number of zebrafish neutrophils (N) was analyzed. The anti-inflammatory efficacy of the sample was evaluated based on the statistical analysis results of this indicator. The statistical processing results are expressed as Mean±SEM. The formula for calculating the anti-inflammatory efficacy is as follows:
[0164] Anti-inflammatory efficacy % = (N 模型 -N 样品 )÷N模型 ×100%
[0165] Statistical analysis was performed using SPSS 26.0 software, and P < 0.05 indicated that the difference was statistically significant. The anti-inflammatory efficacy data are shown in Table 4.
[0166] Table 4 Anti-inflammatory efficacy data
[0167]
[0168] ***: Compared with the model control group, P < 0.001
[0169] As shown in Table 4, in the zebrafish inflammation model induced by sodium dodecyl sulfate, both VB142 and VB226 lysates have anti-inflammatory effects and are superior to dipotassium glycyrrhizate.
[0170] Example 8
[0171] Reagent preparation: The lysates of Deinococcus microti VB142 and VB226 obtained in Example 4 were respectively prepared into 1% stock solutions with standard dilution water, and used immediately after preparation; tea polyphenols were prepared into 30% stock solutions with standard dilution water, and used immediately after preparation.
[0172] Experimental Animals: Zebrafish were reared in aquaculture water at 28°C (water quality: 200 mg of instant sea salt per liter of reverse osmosis water, conductivity 450-550 μS / cm, pH 6.5-8.5, and hardness 50-100 mg / L CaCO3). These zebrafish were bred and provided by our company's fish farming center under the Laboratory Animal Use License No. SYXK(Zhejiang)2022-0004. Their husbandry and management complies with AAALAC accreditation (certification number: 001458). Wild-type AB strain zebrafish were bred using natural pair mating. Zebrafish aged 2 days per day were used for the anti-photoaging efficacy evaluation of the samples.
[0173] Detection method: 2dpf wild-type AB strain zebrafish were randomly selected in a 6-well plate, and 30 zebrafish were treated in each well (experimental group). The samples were dissolved in water (concentrations are shown in Table 5-2), and the positive control tea polyphenols were 0.001%. At the same time, a normal control group and a model control group were set up, and the capacity of each well was 3mL. Except for the normal control group, the other experimental groups were irradiated with ultraviolet light to establish a zebrafish photoaging model. After treatment at 28℃ for 22h, 10 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. NIS-ElementsD 3.20 advanced image processing software was used to analyze and collect data, and the zebrafish tail fin area (A) was analyzed. The statistical analysis results of this indicator were used to evaluate the anti-photoaging efficacy of the sample. The statistical processing results are expressed as Mean±SEM. The formula for calculating the anti-photoaging efficacy is as follows:
[0174] Anti-light aging rate % = (A sample - A model control) ÷ A model control × 100%
[0175] Statistical analysis was performed using SPSS26.0 software, and P<0.05 indicated that the difference was statistically significant. The anti-photoaging efficacy data are shown in Table 5.
[0176] Table 5 Anti-photoaging efficacy data
[0177]
[0178] ***: Compared with the model control group, P < 0.001
[0179] As shown in Table 5, in the UV-induced zebrafish aging model, both VB142 and VB226 lysates have anti-photoaging effects.
[0180] Example 9
[0181] Reagent preparation: The lysates of Deinococcus microti VB142 and VB226 obtained in Example 4 were respectively prepared into 1% stock solutions with standard dilution water and used immediately; aminoguanidine hydrochloride was prepared into 2% stock solutions with ultrapure water and stored in aliquots at -20°C in the dark.
[0182] Experimental Animals: Zebrafish were maintained in aquaculture water at 28°C (water quality: 200 mg of instant sea salt per liter of reverse osmosis water, conductivity 450-550 μS / cm, pH 6.5-8.5, and hardness 50-100 mg / L CaCO3). These zebrafish were bred and provided by our company's fish farming center under the Laboratory Animal Use License No. SYXK(Zhejiang)2022-0004. Their husbandry and management complies with AAALAC accreditation (certification number: 001458). Wild-type AB strain zebrafish were bred using natural pair mating. Zebrafish aged 2 days per day were used for the anti-glycation efficacy evaluation of the samples.
[0183] Detection method: 5dpf wild-type AB strain zebrafish were randomly selected into 1.5mL centrifuge tubes, and 10 zebrafish were treated in each tube (experimental group). The samples were given 0.05% water-soluble solution, and the positive control aminoguanidine hydrochloride was 0.02%. At the same time, a normal control group and a model control group were set up, and the capacity of each tube was 150μL. Except for the normal control group, the other experimental groups were given 0.4M glucose solution in water-soluble solution to establish a zebrafish AGEs increase model. Three biological replicates were set up in parallel. After shaking on a 60℃ shaker for 24 hours, the supernatant was centrifuged and the data was collected using a multifunctional microplate reader. The AGEs fluorescence value (S) of each experimental group was analyzed, and the anti-glycation efficacy of the sample was evaluated based on the statistical analysis results of this indicator. The statistical processing results are expressed as Mean±SEM. The formula for calculating the anti-photoaging efficacy is as follows:
[0184] Anti-glycation rate % = (S 模型对照 -S 样品 )÷S 模型对照 ×100%
[0185] Statistical analysis was performed using SPSS 26.0 software. P < 0.05 indicated that the difference was statistically significant. The anti-glycation efficacy is shown in Table 6.
[0186] Table 6 Anti-glycation efficacy data
[0187]
[0188] ***: Compared with the model control group, P < 0.001
[0189] As shown in Table 6, in the glucose-induced zebrafish glycation model, both VB142 and VB226 lysates have glycation efficacy.
[0190] Example 10
[0191] The exocrine polypeptide specific to Deinococcus microti provided in Example 3 of the present invention can be prepared by solid phase synthesis technology, which includes the following steps:
[0192] a) Reactor treatment:
[0193] Add 2 / 3 volume of dichloromethane (DCM, Aladdin) to the reactor and soak for 3 h;
[0194] b) Resin swelling:
[0195] 1.0 g of Wang resin (Sigma-Aldrich) was weighed and added to the reaction column, and 20 mL of N,N-dimethylformamide (DMF, Aladdin) was added and soaked for 30 min to fully swell the resin;
[0196] c) Attachment of the first amino acid:
[0197] A reaction solution containing 8 mmol of Fmoc-modified amino acid (Sigma-Aldrich, the peptide was Fmoc-Ala-OH), 0.9 mmol of 4-dimethylaminopyridine (DMAP, Aladdin), and 4.5 mmol of N,N'-diisopropylcarbodiimide (DIC, Aladdin) was prepared, and nitrogen was introduced and reacted for 2.5 hours.
[0198] d) Washing:
[0199] After the reaction was completed, the reaction solution was blown away and washed twice with 10 mL of DCM, isopropanol, and DMF, respectively.
[0200] e) Blocking of residual reactive groups:
[0201] 0.6 mL of benzoyl chloride (Aladdin) and 0.45 mL of pyridine (Aladdin) were dissolved in 10 mL of DCM, added to the resin, reacted for 1 hour, and then washed twice with 10 mL of DCM, isopropanol, and DMF respectively.
[0202] f) Removal of Fmoc protecting group:
[0203] Add 15 mL of a 20% piperidine solution in DMF to a reaction vessel and allow to react for 5 minutes under nitrogen. After draining, add another 20 mL of a 20% piperidine solution in DMF and allow to react for 20 minutes under nitrogen. After draining, wash twice with 10 mL of DCM, 10 mL of isopropanol, and then 10 mL of DMF. A small amount of resin was tested for removal using the ninhydrin (Sigma-Aldrich) method. If the resin appears black or purple-black, complete removal is indicated.
[0204] g) Amino acid condensation:
[0205] According to the peptide sequence, a second amino acid reaction solution was prepared containing 2 mmol of Fmoc-modified amino acid (the peptide was Fmoc-Ser-OH), 0.8 g of benzotriazole tetramethyltetrafluoroboric acid (TBTU, Aladdin) in 10 mL of DMF solution, 1 mL of 0.135 g / mL p-hydroxybenzonitrile (HoBt, Aladdin) and 0.4 mL of N,N-diisopropylethylamine (DIEA, Aladdin), which was added to the reactor and reacted for 2 hours under nitrogen.
[0206] h) Repeat d) → g) according to the amino acid sequence until the last amino acid is synthesized.
[0207] i) Cleavage of peptides:
[0208] A cutting reagent containing 82.5% trichloroacetic acid, 5% thioanisole, 5% water, 5% phenol, and 2.5% ethanedithiol was added, and the mixture was reacted at room temperature for 4 hours. After the reaction was completed, the mixture was fully dried under nitrogen to obtain the polypeptide powder.
[0209] Example 11
[0210] The safety of the polypeptide provided in Example 10 of the present invention was investigated using a cell proliferation assay. The solution used in this example was prepared as follows:
[0211] Complete DMEM medium was prepared as follows: 89% Gibco high-glucose DMEM medium (Gibco), 10% fetal bovine serum (Gibco), 1% 100× penicillin-streptomycin double antibody (Sigma-Aldrich);
[0212] Peptide solution of the experimental group: the polypeptides were dissolved in complete DMEM medium to a stock solution concentration of 5 mg / mL, stored at 4°C, and diluted with complete DMEM medium before use.
[0213] The experimental process of this example is as follows: HaCat cells growing in the logarithmic phase were plated on a 96-well plate, and 200 μL of 1×10 4 Cells were cultured using complete DMEM medium. After 24 hours of cell attachment, the medium was discarded and replaced with 100 μL of DMEM complete medium containing peptide 1-peptide 7. The concentrations of peptide 1-peptide 7 were 0, 0.05, 0.1, 0.25, 0.5, 1, 2.5, and 5 mg / mL, with 3 replicates for each concentration. After 24 hours, 100 μL of Cell Luminescent CellViability Assay kit was used for detection. The cells were incubated at 37°C for 10 minutes and the luminescence intensity was measured on a microplate reader to reflect the number of cells.
[0214] The test results are shown in Table 7:
[0215] Table 7: Relative cell number of each group in the cell proliferation assay
[0216] Concentration (mg / mL) peptides Blank group 100.00±2.16 0.05 93.31±4.56 0.10 94.34±1.05 0.25 94.43±1.84 0.50 94.38±3.34 1.00 99.71±1.31 2.50 103.11±2.81 5.00 106.22±1.83
[0217] The results showed that after the polypeptide was co-incubated with HaCat cells at a concentration below 5 mg / mL for 24 hours, its cell amount had no obvious inhibitory or promoting effect compared with the blank control, indicating that the peptide provided by the present invention is non-cytotoxic and highly safe.
[0218] Example 12
[0219] In order to observe the cell repair ability of the polypeptide provided in Example 10 of the present invention, a scratch repair function test was performed using HaCat cells. The solution used in this example was prepared as follows:
[0220] Complete DMEM medium: 89% high-glucose DMEM medium (Gibco), 10% fetal bovine serum (Gibco), 1% 100× penicillin-streptomycin double antibody (Sigma-Aldrich);
[0221] Peptide solution for the experimental group: The polypeptide prepared in Example 5 was dissolved in complete DMEM medium at a concentration of 2 mg / mL and stored at 4°C.
[0222] The experimental process of this example is as follows: a scratch wound healing 2-well insert (ibidi) was attached to the center of a 12-well plate, and the concentration of the cell suspension was adjusted to 3×10 5 / mL, add 70μL of cell suspension to each well of the wound healing two-well insert. Avoid shaking the well plate after adding the cell suspension, and culture in an environment of 37°C and 5% carbon dioxide for at least 24 hours. Check the cell density after 24 hours under a microscope. After obtaining a fused cell layer in the two-well insert, gently remove the culture insert with sterile tweezers, wash the cell layer with PBS, and remove cell debris and non-adherent cells. DMEM complete culture medium containing a small peptide at a concentration of 2mg / mL was added to the wells of the 12-well plate. After the addition of the sample, take a picture of each of the three locations in the center of the field of view of the scratch in each well, and use Image J software for automatic image analysis to calculate the average cell confluence area. Three pictures were taken at the same location 12 hours later, and Image J software was also used for automatic image analysis to calculate the average cell confluence area. The test results are as follows Figure 4 As shown in Table 8:
[0223] Table 8: Healing rate of cell scratch test after 12 hours
[0224] sample Healing rate (%) Control 32.09±11.71 peptides <![CDATA[54.05±6.28 * ]]>
[0225] *: P<0.05; **: P<0.01vs Control
[0226] The results showed that the healing rate of the culture medium with the polypeptide added was significantly higher than that of the blank culture medium without the peptide added, indicating that the peptide provided by the present invention has a strong cell repair ability.
[0227] Example 13
[0228] In order to observe the anti-inflammatory effect of the polypeptide provided in Example 10 of the present invention, an anti-inflammatory activity inhibition test was performed using HaCat cells. The solution used in this example was prepared as follows:
[0229] Complete DMEM medium: 89% high-glucose DMEM medium (Gibco), 10% fetal bovine serum (Gibco), 1% 100× penicillin-streptomycin double antibody (Sigma-Aldrich);
[0230] Peptide solution for the experimental group: The peptide was dissolved in complete DMEM medium at a concentration of 2 mg / mL and stored at 4°C;
[0231] Inflammation inducer: fresh Escherichia coli DH5α, washed twice with PBS, resuspended in PBS, adjusted the bacterial solution to OD = 1.0, boiled at 95℃ for 10 minutes, and can be stored at -80℃.
[0232] Positive control: Palmitoyl tetrapeptide-7 (Guangzhou Baiyu Biological) was prepared into 2 mg / mL in complete DMEM medium and stored at 4°C.
[0233] The experimental process of this example is as follows: HaCat cells were seeded in a twelve-well plate, with 1×10 5 The culture medium was 0.5 mL of complete DMEM. After the cells adhered, the culture medium was discarded and fresh culture medium containing peptides 1 to 7 was added, along with 50 μL of an inflammatory inducer in triplicate. A positive control consisted of culture medium supplemented with the inflammatory inducer alone, and a blank control was supplemented with 50 μL of PBS. The cells were incubated for 24 hours. The supernatant was collected and IL-8 levels were measured using a human IL-8 detection kit (Dakoway Biotechnology Co., Ltd.).
[0234] The calculation process is as follows:
[0235] Inhibition rate = [1-(C 实验组 -C 空白组 ) / (C 阳性组 -C 空白组 )]×100%
[0236] The test results are shown in Table 9 below:
[0237] Table 9: Supernatant IL-8 levels and inhibition rates
[0238] Group IL-8 (pg / mL) Inhibition rate (%) blank 371.00±1.04 - inducers 1652.57±214.63 - Palmitoyl Tetrapeptide-7 1431.66±20.53 17.20±13.97 peptides 1065.03±13.73 45.85±9.13
[0239] It can be seen from the results in the above table that the polypeptide has a certain inhibitory effect on the expression of IL-8 activated by Escherichia coli inflammation inducer.
[0240] Example 14
[0241] The zebrafish experiment was used to observe the moisturizing effect of the polypeptide provided in Example 10 of the present invention. The solution used in this example was prepared as follows:
[0242] Peptide solution in the experimental group: small peptides were prepared into 1% with standard dilution water and used immediately after preparation.
[0243] Positive control: Sodium hyaluronate fruit-flavored drink (Jiangsu Yijiayuan Health Technology Co., Ltd.), stored in a cool, dry place. Directly aspirate the original solution and use it immediately.
[0244] The experimental process of this embodiment is as follows: 2dpf melanin allele mutant Albino strain zebrafish were randomly selected in a 6-well plate, and 30 zebrafish were treated in each well (experimental group). The samples were given water-soluble (all at a concentration of 0.05%), and the positive control was a sodium hyaluronate fruit-flavored drink at a concentration of 15.6μL / mL. At the same time, a normal control group and a model control group were set up, and the capacity of each well was 3mL. Except for the normal control group, the other experimental groups were given sodium chloride in water to establish a zebrafish water deprivation model. After treatment at 28℃ for 22h, 10 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. The data were analyzed and collected using NIS-Elements D 3.20 advanced image processing software, and the zebrafish tail area (S) was analyzed. The statistical analysis results of this indicator were used to evaluate the hydrating and moisturizing efficacy of the samples.
[0245] The results are expressed as Mean ± SEM. The formula for calculating the hydrating and moisturizing effect is as follows:
[0246] Moisturizing rate % = (S 样品 -S 模型对照 )÷(S 正常对照 -S 模型对照 )×100%
[0247] SPSS 26.0 software was used for statistical analysis, and P < 0.05 indicated that the difference was statistically significant.
[0248] Test results such as Figure 5 、 Figure 6 As shown in Table 10:
[0249] Table 10: Zebrafish tail water loss test to detect the moisturizing effect of small peptides
[0250]
[0251] Compared with the model control group, *: P < 0.05, **: P < 0.01, ***: P < 0.001
[0252] It can be seen from the results in the above table that the polypeptides can protect the zebrafish tail area reduction caused by dehydration and have the effect of replenishing water and moisturizing.
[0253] Example 15
[0254] This embodiment discloses a method for identifying Deinococcus microti. Specifically, the method uses specific primers and specific sequences for analysis, including:
[0255] 1. Genomic DNA extraction
[0256] The specimens in this example were from Deinococcus wulumuqiensis R12 isolated by Hangzhou Weizhi Biotechnology Co., Ltd. T , China General Microbial Culture Collection Center), D. radiodurans DSM 20539 T , China Marine Microbial Culture Collection Center), and DNA template extraction was performed using a kit provided by Guangzhou Meiji Biotechnology Co., Ltd. (product number: D3146).
[0257] 2. Peptide nucleotide sequence analysis
[0258] The isolated Deinococcus was amplified by PCR using a primer set, wherein SEQ ID NO.5 and SEQ ID NO.6 are the upstream and downstream primers of the nucleotide sequence of the polypeptide. The reaction system is shown in Table 11.
[0259] Table 11: Reaction system used
[0260] name Volume / μL phusion 0.5 DMSO 1.5 DNTP 2.0 F 2.0 R 2.0 5*HF buffer 10 DNA X <![CDATA[ddH2O]]> 32-X
[0261] This experiment used NEB's High-Fidelity PCR Master Mix (Cat. #M0531) is used for PCR amplification. This master mix combines a high-fidelity polymerase with an optimized reaction buffer to ensure high amplification efficiency and accuracy in PCR reactions.
[0262] When preparing the PCR reaction, first calculate the required amount of DNA template according to the following formula: Addition volume = Total DNA amount / Concentration. The total amount of DNA should be controlled within the range of 50 ng to 250 ng to ensure the specificity and efficiency of the PCR reaction. Accurately calculating the amount of DNA template added ensures uniform distribution of the DNA in the reaction system, thereby improving the reproducibility and accuracy of amplification. The amplification procedure is shown in Table 12.
[0263] Table 12: Amplification Procedure
[0264]
[0265] 3. PCR product processing and sequencing
[0266] Gel electrophoresis detection:
[0267] After the PCR reaction is completed, the PCR product is first checked for purity by gel electrophoresis. Gel electrophoresis is a standard molecular biology technique used to separate and identify nucleic acid fragments. This step ensures that the PCR product is free of nonspecific amplification or contamination. Figure 7As shown, the PCR product was set to be 305 bp in length, and the products of VB142 and VB226 were less than 500 bp, while the PCR product of Deinococcus urumqiensis was larger than 1 kb, which was obviously different. There was no PCR product of Deinococcus radiodurans.
[0268] Furthermore, the inventors purchased Deinococcus radiodurans DRR1, ATCC27603, and 17438 from CCTCC and repeated the above steps, and found that Deinococcus radiodurans had no PCR product.
[0269] Purity and concentration determination:
[0270] Use the Nanodrop spectrophotometer to accurately measure the concentration of PCR products. Nanodrop technology provides detailed information on sample concentration and purity, ensuring that the quality of the samples submitted meets sequencing requirements.
[0271] Sample testing:
[0272] The PCR products that have passed the purity and concentration tests will be sent to Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as Sangon Biotech) for first generation sequencing analysis. Figure 8 As shown, the red frame area is the nucleotide sequence region of the polypeptide. The sequencing results of micro-Deinococcus VB142 and VB226 are completely consistent, and Urumqi Deinococcus R12 lacks a sequence. The above-mentioned embodiments only express several embodiments of the present invention. The description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for those of ordinary skill in the art, without departing from the concept of the present invention, several variations and controls can be made, which all fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent of the present invention should be based on the appended claims.
Claims
1. Deinococcus weizhi includes Deinococcus weizhi having at least 97% 16S rRNA sequence identity with SEQ ID NO. 1 or SEQ ID NO. 2 and an average nucleotide similarity (ANI) within 95%.
2. The Deinococcus weizhi according to claim 1 is Deinococcus sp. VB142, deposited in the China Center for Type Culture Collection (CCTCC) of Wuhan University with a deposit number of CCTCC M 2024185 and a deposit date of January 23, 2024; or deposited in the Korea Culture Collection (KCTC) with a deposit number of 15470BP and a deposit date of June 19, 2023.
3. The Deinococcus weizhi according to claim 1 is Deinococcus sp. VB226, which is deposited in the China Center for Type Culture Collection (CCTCC) of Wuhan University with a deposit number of CCTCC M 2024186 and a deposit date of January 23, 2024.
4. A fermentation broth, fermentation product filtrate, fermentation lysate or fermentation broth extract of Deinococcus weizhi according to any one of claims 1 to 3.
5. Use of Deinococcus weizhi or its fermentation broth, fermentation product filtrate, fermentation lysate, or fermentation broth extract as claimed in any one of claims 1 to 3 in the preparation of antioxidant, moisturizing, anti-inflammatory, anti-photoaging, or anti-glycation products.
6. The use according to claim 5, characterized in that: The antioxidant product is selected from health care products, pharmaceutical compositions or cosmetics.
7. A health product comprising the Deinococcus weizhi according to any one of claims 1 to 3 or the fermentation broth, fermentation product filtrate, fermentation lysate or fermentation broth extract according to claim 4.
8. A pharmaceutical composition comprising the Deinococcus weizhi according to any one of claims 1 to 3 or the fermentation broth, fermentation product filtrate, fermentation lysate or fermentation broth extract according to claim 4.
9. A cosmetic composition comprising the Deinococcus weizhi according to any one of claims 1 to 3 or the fermentation broth, fermentation product filtrate, fermentation lysate or fermentation broth extract according to claim 4.
10. The cosmetic or skin care product according to claim 9, characterized in that: Includes cosmetics or skin care products in dosage forms such as lotions, essences, ointments, creams, milks, gels, and facial masks.
11. An isolated polypeptide, characterized in that An amino acid sequence having at least 90% sequence identity to SEQ ID No. 3 is included.
12. An isolated polynucleotide, characterized in that The polynucleotide encodes the polypeptide according to claim 11; the nucleotide sequence has at least 90% sequence identity with any one of SEQ ID No.
4.
13. An expression vector, characterized in that Carrying the polynucleotide according to claim 12.
14. A recombinant cell, characterized in that Carrying the polynucleotide of claim 12, the expression vector of claim 13, or being capable of expressing the polypeptide of claim 11.
15. The recombinant cell according to claim 14, characterized in that The recombinant cell is obtained by introducing the expression vector according to claim 13 into a host cell.
16. A composition, characterized in that Comprising at least one of the polypeptide according to claim 11, the polynucleotide according to claim 12, the expression vector according to claim 13, and the recombinant cell according to claim 14 or 15.
17. A medicine for external use, characterized in that: The drug comprises at least one of the polypeptide according to claim 11, the polynucleotide according to claim 12, the expression vector according to claim 13, the recombinant cell according to claim 14 or 15, and the composition according to claim 16.
18. A cosmetic for external use, characterized in that: The cosmetic comprises at least one of the polypeptide according to claim 11, the polynucleotide according to claim 12, the expression vector according to claim 13, the recombinant cell according to claim 14 or 15, and the composition according to claim 16.
19. Use of the polypeptide according to claim 11, the polynucleotide according to claim 12, the expression vector according to claim 13, the recombinant cell according to claim 14 or 15, or the composition according to claim 16 in the preparation of cosmetics; Optionally, the cosmetic has at least one of the effects of anti-inflammation, scar reduction, and moisturizing.
20. Use of the polypeptide according to claim 11, the polynucleotide according to claim 12, the expression vector according to claim 13, the recombinant cell according to claim 14 or 15, or the composition according to claim 16 in the preparation of a medicament; Optionally, the drug has at least one of the effects of anti-inflammation, accelerating wound healing of the skin surface, and reducing scar formation.
21. Use of the polynucleotide according to claim 12 in identifying Deinococcus microti.
22. A method for identifying Deinococcus microti, characterized by: include (1) designing a primer set that is reverse complementary to the sequence of the polynucleotide according to claim 12; (2) using the primer set to amplify the sample to be tested, Wherein, the sample to be tested from which the nucleic acid fragment can be amplified is a sample containing Deinococcus microti.
23. The method of claim 22, wherein: The primer set has the nucleotide sequences shown as SEQ ID No. 5 and SEQ ID No. 6.