Lactococcus lactis subsp. Lactis for improving oral health as well as metagen and application of lactococcus lactis subsp. Lactis

Abstract

The invention discloses lactococcus lactis subsp. Lactis for improving oral health as well as a metagen and application of the lactococcus lactis subsp. Lactis, and belongs to the field of foods and health-care foods. According to the invention, a strain of lactococcus lactis subsp. Lactis WZA-LL85 capable of improving oral health is separated and screened for the first time from wine naturally fermented by peasants, the lactococcus lactis subsp. Lactis WZA-LL85 and the postbiotics thereof have the efficacy of improving oral health, and the postbiotics of the lactococcus lactis subsp. Lactis WZA-LL85 and a lalang grass rhizome extract solution are combined for use; the traditional Chinese medicine composition has a synergistic effect in the aspects of repairing oral mucosa and promoting enamel remineralization, can reduce tooth sensitivity and play a role in improving oral health, and has a good development value and a wide market prospect.

Description

Technical Field

[0001] The invention belongs to the field of food and health-care food, and particularly relates to a strain of Lactococcus lactis subspecies lactis for improving oral health, its postbiotics and applications. Background Art

[0002] The oral cavity is an important part of the human body, and oral health includes oral ulcers, periodontal (gum) diseases, tooth sensitivity, and other diseases and functional disorders that affect the oral cavity. Oral ulcers, also known as mouth sores, refer to painful round or oval ulcer spots that appear on the mucous membranes of the lips, palate, tongue, cheeks, etc. in the mouth. As a common oral mucosal disease, oral ulcers are obviously painful when they occur, and are characterized by periodicity, recurrence, and self-limiting. Tooth sensitivity refers to the short, sharp pain or discomfort that occurs when the teeth are stimulated within the physiological range of mechanical, temperature, chemical, etc. The occurrence of tooth sensitivity is mainly due to damage to the enamel covering the outer layer of the tooth crown. Enamel is the hard structure of the outermost layer of the tooth. The essence of enamel damage is the loss of minerals (such as hydroxyapatite) or the destruction of the physical structure.

[0003] Lactococcus lactis subsp. lactis, a Gram-positive coccus of the genus Lactococcus, has a wide range of applications in food additives, industry, agriculture, and feed. In recent years, Lactococcus lactis has become a research hotspot as a probiotic with great potential.

[0004] Postbiotics refer to inanimate microorganisms and / or their component preparations that are beneficial to the health of the host. They have multiple biological activities such as anti-inflammatory, immunomodulatory, and antibacterial. At present, the development of postbiotic products for improving oral health functions in existing technologies is still in its infancy, and there are few reports on related products. The development of postbiotic products to improve oral health is of great significance and has broad market prospects. Summary of the Invention

[0005] In view of the above prior art, the present invention aims to provide a strain of Lactococcus lactis subsp. lactis and its postbiotics and applications for improving oral health. The combination of the Lactococcus lactis subsp. lactis WZA-LL85 postbiotics and Imperata cylindrica root extract provided by the present invention can improve oral health.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect of the present invention, a strain of Lactococcus lactis subsp. lactis WZA-LL85 is provided. The Lactococcus lactis subsp. lactis WZA-LL85 was deposited in the China Center for Type Culture Collection on July 22, 2024, with a deposit number of CCTCC No: M 20241628 and a classification name of Lactococcus lactics subsp. lactis WZA-LL85.

[0008] In a second aspect, the present invention provides a Lactococcus lactis subsp. lactis WZA-LL85 postbiotic, wherein the Lactococcus lactis subsp. lactis WZA-LL85 postbiotic comprises Lactococcus lactis subsp. lactis WZA-LL85 bacteria or a fermentation metabolite of Lactococcus lactis subsp. lactis WZA-LL85 bacteria as an active ingredient.

[0009] The preparation method of the Lactococcus lactis subspecies lactis WZA-LL85 postbiotic comprises the following steps:

[0010] The activated Lactococcus lactis subspecies lactis WZA-LL85 is inoculated into a liquid culture medium, and the fermentation is terminated after constant temperature fermentation for 24-36 hours. The bacterial precipitate is collected by centrifugation and inactivated. After inactivation, the bacterial cells are dried to prepare postbiotics that improve oral health.

[0011] In a third aspect, the present invention provides use of the Lactococcus lactis subsp. lactis WZA-LL85 or the Lactococcus lactis subsp. lactis WZA-LL85 postbiotic in the preparation of a product for improving oral health.

[0012] Improving oral health refers to repairing oral mucosa and / or promoting remineralization of tooth enamel.

[0013] In a fourth aspect, the present invention provides a product for improving oral health, wherein the product is prepared from a postbiotic of Lactococcus lactis subsp. lactis WZA-LL85 and an extract of Imperata cylindrica root.

[0014] The mass ratio of the Lactococcus lactis subsp. lactis WZA-LL85 postbiotics to the Imperata cylindrica root extract in the product is 1:(1-2).

[0015] Preferably, the product is taken orally or by spraying. For oral administration, 1 mL is held in the mouth for ≥30 seconds before swallowing, three times daily. For spraying, 0.5 mL is sprayed 5-6 times daily.

[0016] Beneficial effects of the present invention:

[0017] The present invention isolates and screens a strain of Lactococcus lactis subspecies WZA-LL85 for improving oral health from naturally fermented wine produced by farmers for the first time. The Lactococcus lactis subspecies WZA-LL85 and its postbiotics have the effect of improving oral health. The combination of the Lactococcus lactis subspecies WZA-LL85 postbiotics and a solution of an Imperata cylindrica root extract has a synergistic effect in repairing oral mucosa and promoting the remineralization of tooth enamel, can reduce tooth sensitivity, and improve oral health. The invention has good development value and broad market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 for Figure 1 This is a photo of the colony morphology of strain WZA-LL85.

[0019] Figure 2 This is a Gram-stained photograph of strain WZA-LL85 under a 1000× microscope. DETAILED DESCRIPTION

[0020] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0021] As introduced in the background technology section, the oral cavity is an important part of the human body, and oral health has a significant impact on an individual's overall health and quality of life. The probiotic properties of postbiotics do not depend on the activity of probiotics. Compared with live probiotic microorganisms, they have higher stability and safety. From the perspective of practical application, they have good development value and broad market prospects.

[0022] Based on this, the present invention discloses a strain of Lactococcus lactis subsp. lactis, its postbiotics and applications for improving oral health. The present invention first isolates and screens a strain of Lactococcus lactis subsp. lactis WZA-LL85, which is extracted from naturally fermented wine from farmers in Tai'an City, China. The Lactococcus lactis subsp. lactis WZA-LL85 has been deposited in the China Center for Type Culture Collection on July 22, 2024, with a deposit number of CCTCC No: M 20241628, and is classified and named: Lactococcus lactics subsp. lactis WZA-LL85. The Lactococcus lactis subsp. lactis WZA-LL85 and its postbiotics have the effect of improving oral health. The Lactococcus lactis subsp. lactis WZA-LL85 postbiotics are used in combination with a solution of Imperata cylindrica root extract to prepare a product that can repair the oral mucosa and promote the remineralization of tooth enamel, thereby improving oral health.

[0023] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present invention, rather than to limit the scope of the present invention.

[0024] The Lactococcus lactis subsp. lactis WZA-LL85 used in the present invention has been deposited in the China Center for Type Culture Collection on July 22, 2024, with a deposit number of CCTCC No: M 20241628, and a classification name of Lactococcus lactics subsp. lactis WZA-LL85.

[0025] The formula of the MRS agar plate used in the present invention is: 10.0g peptone, 10.0g beef extract, 4.0g yeast powder, 20.0g glucose, 0.2g magnesium sulfate, 5.0g sodium acetate, 2.0g triammonium citrate, 2.0g dipotassium hydrogen phosphate, 0.04g manganese sulfate, 1.0g Tween-80, 20.0g agar, 1.0L distilled water; adjust the pH to 5.7+0.2, sterilize at 121°C for 15 minutes, and set aside. The preparation method of the MRS liquid culture medium differs from that of the MRS agar plate only in that agar is no longer added to the formula.

[0026] The Imperata cylindrica root extract used in the examples of the present invention is a brown fine powder with an effective substance content of 10:1, and is purchased from Shaanxi Xinyangwei Biotechnology Co., Ltd.

[0027] The clean-grade SD rats used in the present invention were purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd.

[0028] Example 1: Isolation, purification and identification of strains:

[0029] Take 5mL of naturally fermented wine from a farmer in Tai'an, China, and dilute it to 10mL with 0.9% saline. -6 , take 200 μL of the dilution and spread it on a ready-to-use MRS agar plate, culture it at 37℃ microaerophilically (5% hypoxia) for 48 hours until colonies grow, pick a single colony, and examine it under a microscope using Gram staining to observe the bacterial morphology. WZA-LL85 colonies are round, with irregular edges, opaque, white on the front, flat in shape, grayish in surface, moist in texture, and easy to pick up ( Figure 1 ), Gram-positive bacteria ( Figure 2 ).

[0030] The 16S rRNA gene sequence of the WZA-LL85 strain was identified using the primer sequences shown in SEQ ID NO: 1-SEQ ID NO: 2.

[0031] SEQ ID NO: 1: AGAGTTTGATCCTGGCTCAG;

[0032] SEQ ID NO:2: GGTTACCTTGTTACGACTT.

[0033] The 16S rRNA gene sequence of WZA-LL85 was compared with the sequence of Lactococcus lactis by BLAST-N at NCBI, showing 100% sequence identity with the species Lactococcus lactis. It was identified as Lactococcus lactis subsp. lactis and named Lactococcus lactis subsp. lactis WZA-LL85. The strain was deposited as a biological deposit with the following information:

[0034] Strain name: Lactococcus lactis subsp. lactis WZA-LL85;

[0035] Taxonomic nomenclature: Lactococcus lactics subsp. lactis WZA-LL85;

[0036] Depository: China Center for Type Culture Collection;

[0037] Abbreviation of depository institution: CCTCC;

[0038] Address: Wuhan University, Wuchang District, Wuhan City, Hubei Province;

[0039] Deposit date: July 22, 2024;

[0040] Deposit number: CCTCC No:M 20241628.

[0041] Example 2: Preparation of Lactococcus lactis subsp. lactis WZA-LL85 postbiotics

[0042] The activated Lactococcus lactis subspecies WZA-LL85 was added at a rate of 2×10 9 The inoculum size was 200 CFU / mL and inoculated into 1 L of MRS liquid culture medium. The culture was kept at 37°C and fermented under 5% hypoxia for 24 hours, then the fermentation was terminated. The bacterial precipitate was obtained by centrifugation and inactivated at 95°C for 15 minutes. The inactivated bacterial precipitate was spray-dried to prepare Lactococcus lactis subsp. lactis WZA-LL85 postbiotics.

[0043] Example 3: Preparation of a product to improve oral health

[0044] 50 g of the Lactococcus lactis subsp. lactis WZA-LL85 postbiotic powder prepared in Example 2 and 50 g of Imperata cylindrica root extract were dissolved in 1 L of sterile water to obtain a product for improving oral health.

[0045] Test Example 1: Oral mucosa repair experiment

[0046] (1) Experimental methods:

[0047] Ten clean-grade SD rats (weighing 250-300 g) were randomly selected and divided into five groups (experimental group 1, experimental group 2, experimental group 3, experimental group 4, and control group), with two rats in each group. A mouse model of oral ulcer was established using chemical burning.

[0048] Before modeling, rats were fed and watered freely and were acclimated for one week. The rats in experimental groups 1-4 and the control group were anesthetized by intraperitoneal injection of sodium pentobarbital (concentration 1%, 0.5 mL / 100 g). After that, the rats' mouths were opened with cotton thread, and a 5×5 mm 2 A fixed-size mold was prepared by absorbing 15 microliters of 80% glacial acetic acid with a cotton ball and placing it inside the mold. The mold was then placed on the buccal mucosa of anesthetized rats for 30 seconds (chemically burning the epithelial mucosa). The residual acetic acid was then removed. The immediate reaction at the treated site was recorded, and the formation of an ulcer model in the rats' oral mucosa was observed. A successful model was considered successful when the oral ulcer wound surface in each group was covered by a yellowish-white pseudomembrane.

[0049] The model rats were treated 24 hours after model establishment.

[0050] The activated Lactococcus lactis subspecies WZA-LL85 was added at a rate of 2×10 9 The inoculum of 100 CFU / mL was inoculated into 1 L of MRS liquid medium, and fermented at 37°C under 5% hypoxia for 24 hours, after which the fermentation was terminated to obtain a live fermentation liquid of Lactococcus lactis subsp. lactis WZA-LL85. In experimental group 1, mice were orally sprayed with the live fermentation liquid of Lactococcus lactis subsp. lactis WZA-LL85.

[0051] 100 g of the Lactococcus lactis subsp. lactis WZA-LL85 postbiotic powder prepared in Example 2 was dissolved in 1 L of sterile water to obtain a Lactococcus lactis subsp. lactis WZA-LL85 postbiotic solution. The Lactococcus lactis subsp. lactis WZA-LL85 postbiotic solution was orally sprayed into the mice in the experimental group 2.

[0052] 100 g of Imperata cylindrica root extract was dissolved in 1 L of sterile water to obtain Imperata cylindrica root extract solution, and the Imperata cylindrica root extract solution was orally sprayed into 3 mice in the experimental group.

[0053] The oral cavity of mice in experimental group 4 was sprayed with the product for improving oral health prepared in Example 3, and the oral cavity of mice in control group was sprayed with normal saline.

[0054] Experimental groups 1-4 and the control group were sprayed with a single spray volume of 0.5 mL six times daily. The gross morphology of the ulcers from onset to healing was regularly observed and recorded daily. Treatment was continued until the ulcers were completely healed. The average healing time for oral ulcers was calculated, and the results are shown in Table 1.

[0055] Table 1: Oral mucosal repair effect test

[0056] Grouping Days for ulcer surface to heal (d) Experimental Group 1 8.5 Experimental Group 2 7 Experimental Group 3 9.5 Experimental Group 4 5.5 control group 10.0

[0057] From the data shown in Table 1 above, it can be seen that the substances sprayed by experimental groups 1-4 have a certain effect on the healing of ulcer surfaces and the repair of oral mucosa. The speed of oral mucosal repair in experimental group 4 is significantly faster than that in experimental groups 1-3. The test results show that the combination of Lactococcus lactis subsp. lactis WZA-LL85 postbiotics and Imperata cylindrica root extract has achieved a synergistic effect in promoting oral mucosal repair and improving oral health.

[0058] Comparative Example 2: Enamel Remineralization Verification

[0059] The five middle lower incisors that were intact and without excessive wear were selected from the mouth of the same slaughtered cow. After the teeth were extracted, the tartar and attached soft tissue were removed. After being placed in a 0.5% chloramine T solution for 3 days, they were transferred to a demineralization solution for demineralization for 10 days. The demineralization solution was prepared by 2.2mmol / L calcium nitrate, 2.2mmol / L potassium dihydrogen phosphate and 50mmol / L potassium acetate, and the pH was adjusted to 5.0 using KOH solution. After demineralization, it was rinsed with deionized water and then ultrasonically cleaned with deionized water for 5 minutes. The treated incisors were immersed in the treatment solution for remineralization, and numbered in sequence as treatment 1-treatment 4 and the control group. The preparation method of the treatment solution used in each group is as follows:

[0060] Treatment solution used in treatment group 1: activated Lactococcus lactis subsp. lactis WZA-LL85 was added at a rate of 2×10 9 The inoculum amount of CFU / mL was inoculated into 1 L of MRS liquid culture medium, and the culture was kept at 37° C. and fermented under 5% hypoxia conditions for 24 hours, after which the fermentation was terminated to obtain a live bacterial fermentation liquid of Lactococcus lactis subspecies WZA-LL85.

[0061] Treatment liquid used in treatment group 2: 100 g of the Lactococcus lactis subsp. lactis WZA-LL85 postbiotic powder prepared in Example 2 was dissolved in 1 L of sterile water to obtain a Lactococcus lactis subsp. lactis WZA-LL85 postbiotic solution.

[0062] Treatment solution used in treatment group 3: 100 g of Imperata cylindrica root extract was dissolved in 1 L of sterile water to obtain Imperata cylindrica root extract solution.

[0063] The treatment solution used in experimental group 4: the product for improving oral health prepared in Example 3.

[0064] The treatment solution used in the control group was distilled water.

[0065] After 28 days of immersion treatment, the microhardness of the enamel surface of the bovine incisor teeth was measured using a Bangyi HV-1000Z micro Vickers hardness tester. The statistical results are shown in Table 2

[0066] Table 2: Microhardness statistics of bovine incisor enamel surface

[0067] Grouping <![CDATA[Enamel microhardness value (kg / mm 2 )]]> Process 1 327.8 Process 2 332.1 Process 3 316.4 Treatment group 4 347.8 control group 308.5

[0068] The results showed that compared with the control group, the product prepared by combining the postbiotics of Lactococcus lactis subsp. lactis WZA-LL85 and Imperata cylindrica root extract could significantly enhance the microhardness of demineralized bovine incisor enamel. The test results showed that the product for improving oral health prepared by the present invention can promote the remineralization of enamel.

[0069] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent replacements, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. A strain of Lactococcus lactis subsp. lactis WZA-LL85, characterized in that: The Lactococcus lactis subsp. lactis WZA-LL85 was deposited in the China Center for Type Culture Collection on July 22, 2024, with a deposit number of CCTCC No: M 20241628 and a classification name of Lactococcus lactics subsp. lactis WZA-LL85.

2. A postbiotic of Lactococcus lactis subsp. lactis WZA-LL85, characterized in that The Lactococcus lactis subsp. lactis WZA-LL85 postbiotics uses the Lactococcus lactis subsp. lactis WZA-LL85 bacterial body according to claim 1 or the fermentation metabolites of the Lactococcus lactis subsp. lactis WZA-LL85 bacterial body as an active ingredient.

3. The Lactococcus lactis subsp. lactis WZA-LL85 postbiotic according to claim 2, characterized in that The preparation method of the Lactococcus lactis subspecies lactis WZA-LL85 postbiotic comprises the following steps: The activated Lactococcus lactis subspecies lactis WZA-LL85 is inoculated into a liquid culture medium, and the fermentation is terminated after constant temperature fermentation for 24-36 hours. The bacterial precipitate is collected by centrifugation and inactivated. After inactivation, the bacterial cells are dried to prepare postbiotics that improve oral health.

4. Use of the Lactococcus lactis subsp. lactis WZA-LL85 according to claim 1 or the Lactococcus lactis subsp. lactis WZA-LL85 postbiotic according to claim 3 in the preparation of a product for improving oral health.

5. The use according to claim 4, characterized in that Improving oral health refers to repairing oral mucosa and / or promoting remineralization of tooth enamel.

6. A product for improving oral health, characterized in that: The product is prepared from the postbiotics of Lactococcus lactis subsp. lactis WZA-LL85 and Imperata cylindrica root extract according to claim 3.

7. The product according to claim 6, characterized in that The mass ratio of the Lactococcus lactis subsp. lactis WZA-LL85 postbiotics to the Imperata cylindrica root extract in the product is 1:(1-2).

Images