Application of soybean ARGONAUTE family gene GmAGO5 in soybean resistance to soybean mosaic virus disease
By knocking out the soybean ARGONAUTE family gene GmAGO5, CRISPR technology is used to reduce the gene expression of viral CP protein, solving the problem of prevention and control of soybean mosaic virus disease, achieving enhanced high resistance to SMV by soybeans, and avoiding the ecological risks of pesticides.
Patent Information
- Application Number
- CN202510666576.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2025-09-02
AI Technical Summary
The prior art is difficult to effectively improve the resistance of soybeans to soybean mosaic virus disease. The use of insecticides has ecological security risks, and the virus symptoms are easily confused with other diseases, which lead to difficulties in prevention and control.
Through genetic engineering, the soybean ARGONAUTE family gene GmAGO5 was knocked out, and the CRISPR mediation technology was used to reduce the expression of viral CP protein genes, thereby enhancing the resistance of soybean to SMV.
It significantly reduces the expression of viral CP protein genes, reduces the content of soybean mosaic virus in soybeans, improves soybeans' resistance to SMV, and avoids the ecological risks of insecticides.
Smart Images

Figure CN120574841A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to application of soybean ARGONAUTE family gene GmAGO5 in soybean resistance to soybean mosaic virus disease, and belongs to the field of genetic engineering. Background Art
[0002] Research on soybean mosaic virus (SMV) dates back to the early 20th century. Infections were documented at the Connecticut Agricultural Experiment Station in the United States, and Kendrick and Gardner (1921) formally named the virus and revealed its seed-transmissibility. Conover (1948) first confirmed the existence of multiple strains of SMV, with different strains causing phenotypic traits such as mosaic, necrosis, or resistance in host varieties. Virus transmission is carried out non-persistently by 31 aphid species, with feeding by the vector insects being the primary driver of field spread. In 1980, Hill and Benner characterized the basic characteristics of the SMV genome, confirming structural homology with members of the potyvirus genus. In 1992, Jayaram's team completed the whole-genome sequencing of strains G2 and G7, laying the foundation for molecular mechanisms. SMV is a widespread and devastating viral disease in soybean-producing areas worldwide. The virus is rapidly transmitted by aphids, causing typical symptoms such as leaf mosaic and necrosis, significantly reducing soybean yield and seed quality. Its pathogenic mechanism involves a pathogen-vector-host interaction, and different virus strains vary in their ability to infect soybean genotypes. Diseased seeds are the primary source of SMV transmission, and viral symptoms can be easily confused with other diseases, making accurate virus identification crucial for prevention and control. Current prevention and control strategies include avoiding adjacent plantings of crops that host the virus, selecting resistant varieties, rigorously screening for virus-free seeds to reduce the risk of seed transmission, and judicious use of pesticides to reduce the density of vector insect populations. It's worth noting that pesticides can accidentally harm non-target beneficial insects, necessitating a careful balance between ecological safety and virus control.
[0003] Argonaute (AGO) proteins are core components of plant gene regulatory networks, playing a key role in developmental regulation, stress response, and maintenance of genome stability by specifically binding to small RNAs (sRNAs). Its molecular structure contains three characteristic functional domains: the PAZ domain is responsible for recognizing the 3' end of sRNA, the MID domain binds to the 5' phosphate group of sRNA, and the PIWI domain has endonuclease activity and is directly involved in the cleavage of target RNA. In terms of developmental regulation, loss of function of AGO1 can lead to abnormal leaf polarity, dwarf plants, and reproductive development defects in Arabidopsis, while rice AGO1 mutants exhibit an extreme dwarf phenotype, which is closely related to its core role in mediating the miRNA pathway. AGO7 precisely regulates the timing of plant development through a conserved tasiRNA production mechanism. In the field of disease and stress resistance, the AGO family demonstrates a multi-layered defense mechanism: AGO1 / 2 / 4 / 7 / 10 directly cleave viral RNA or initiate DNA methylation by binding to viral-derived siRNA (vsiRNA), building a broad-spectrum antiviral defense line; AGO2 can also specifically bind to miR393b to inhibit MEMB12 gene expression and promote antimicrobial protein secretion; notably, AGO4's resistance to plantain mosaic virus is independent of the canonical RdDM pathway, revealing a novel antiviral mechanism. These findings not only clarify the pivotal role of AGO proteins in plant immunity but also provide important theoretical basis for molecular breeding of crop disease resistance.
[0004] The applicant previously used genetic engineering techniques to successfully generate transgenic soybean plants edited with the GmAGO5 gene, a member of the soybean ARGONAUTE family. After inoculating the GmAGO5-edited transgenic plants and control plants with soybean mosaic virus (SMV), they found that GmAGO5 negatively regulates soybean resistance to SMV, indicating that GmAGO5 is an important gene for enhancing soybean resistance to SMV. Summary of the Invention
[0005] The purpose of the present invention is to disclose the disease resistance genetic engineering application of soybean ARGONAUTE family gene GmAGO5. This gene can be introduced into soybean as a target gene. Knocking out the GmAGO5 gene in soybean can reduce the expression level of the viral CP protein gene and enhance soybean resistance to SMV.
[0006] The purpose of the present invention can be achieved through the following technical solutions:
[0007] The soybean ARGONAUTE family gene GmAGO5 has a nucleotide sequence of: SEQ ID NO.1.
[0008] The soybean ARGONAUTE family gene GmAGO5 has an amino acid sequence of SEQ ID NO.2.
[0009] Application of soybean ARGONAUTE family gene GmAGO5 in regulating soybean resistance to SMV. The nucleotide sequence of the soybean ARGONAUTE family gene GmAGO5 is: SEQ ID NO.1.
[0010] The application is preferably to knock out GmAGO5 in soybean to reduce the accumulation of SMV in soybean.
[0011] When using GmAGO5 to construct a plant knockout vector, any enhanced promoter or inducible promoter can be added before its transcription start nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as by adding a selective marker gene (GUS gene, luciferase gene, etc.) to the plant. From the perspective of transgenic plant safety, no selective marker gene can be added, and transformed plants can be screened by adversity.
[0012] After the soybean GmAGO5 protein encoding gene GmAGO5 of the present invention is transformed into soybeans through genetic engineering, the gene is knocked out through CRISPR mediation, thereby reducing the expression level of the viral CP protein gene and reducing the SMV content in soybeans.
[0013] The plant knockout vector carrying GmAGO5 of the present invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transfection, and the transformed plant tissues can be cultivated into plants. The transformed plant hosts can be monocots such as sorghum, rice, wheat, and corn, as well as dicots such as peanuts, soybeans, rapeseed, tomatoes, poplars, turfgrasses, and alfalfa.
[0014] Beneficial effects
[0015] Soybean GmAGO5 encodes a gene in the ARGONAUTE family. In soybean research, we found that CRISPR-mediated knockout of this gene reduced the expression of the viral CP protein gene, thereby reducing the content of soybean mosaic virus (SMV). Therefore, the GmAGO5 gene could be used to breed soybean varieties resistant to SMV. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 Relative expression of the GmAGO5 gene in soybean varieties Kefeng No. 1 and Nannong 1138-2 at different time points after soybean mosaic virus inoculation (n = 3). Two-tailed t-test: *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant. Error bars represent ± SE (standard error).
[0017] Figure 2 Targeted sequencing results of the GmAGO5 gene in the CRISPR / Cas9 gene-edited strains of GmAGO5. Tianlong No. 1 (TL) is the wild-type strain, while KO-AGO5-31-3-3 and KO-55-1 are CRISPR / Cas9 gene-edited strains.
[0018] Figure 3 The GmAGO5 gene-edited material exhibits resistance to SMV-SC7. Images were taken 21 days after inoculation. The PBS control was inoculated with only 0.01 mol / l phosphate buffer. The SMV was inoculated with SC7 virus, the Tianlong No. 1 (TL) gene-editing receptor, and the KO-AGO5-31-3-3 and KO-55-1 CRISPR / Cas9 gene-edited lines. White bars in the first row = 5 cm, and white bars in the second row = 1 cm.
[0019] Figure 4 Determination of viral CP content in the GmAGO5 gene-edited strain. qRT-PCR assay for SMV viral CP expression (n = 3). Two-tailed t-test: ***, P < 0.001. Error bars represent ±SE. DETAILED DESCRIPTION
[0020] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0021] Unless otherwise specified, the methods used in the following examples are all conventional methods.
[0022] Example 1 Inducible Expression of GmAGO5 Gene in SMV SC7 Strain
[0023] The susceptible variety Nannong 1138-2 and the disease-resistant variety Kefeng No. 1 were selected for planting. When soybeans grew to the true leaf stage, they were inoculated with the soybean mosaic virus SC7 strain. Soybean leaf tissues were collected at 0h, 2h, 8h, and 24h after inoculation, and after being crushed in a mortar, they were transferred to a 1.5mL EP tube containing lysis solution and shaken thoroughly to mix. Subsequently, total RNA was extracted using the Total RNA Kit from Tiangen (Beijing, China). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by a spectrophotometer. Tubulin, which is constitutively expressed in soybeans, was used as an internal reference, and its primer sequences were F: GGAGTTCACAGAGGCAGAG and R: CACTTACGCATCACATAGCA. Using the extracted total RNA as a template, the reverse transcription kit (TaKaRa Primer Script TMReverse transcription was performed according to the instructions of the RT reagent kit to obtain the first strand of cDNA. Then, fluorescence quantitative PCR (Real-time RT-PCR) was performed with primers F: CAACCAGATTCACGCCATCC and R: GAGACGCGGCACGAACAG to detect the expression changes of the GmAGO5 gene at different time points after the two soybean varieties were infected with the virus. Figure 1 ).
[0024] Example 2 Genetic Engineering Application of Soybean ARGONAUTE Family Gene GmAGO5
[0025] 1) Cloning of the soybean ARGONAUTE family gene GmAGO5
[0026] Total RNA from the leaves of the soybean variety Nannong 1138-2 was used as a template to synthesize the first-strand cDNA by reverse transcription. Subsequently, PCR amplification was performed using primers (F: ACCACACTTCCTTCCCTCCTA, R: CACAACGCTCTGTTTACCGC). The PCR amplification program was as follows: initial denaturation at 95°C for 3 minutes; followed by 35 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 1 minute 30 seconds. The sequence was then incubated at 72°C for 5 minutes, and finally maintained at a constant temperature of 12°C. After amplification, the PCR product was cloned into the pUC19-T vector, resulting in a 2877-bp CDS sequence of the soybean GmAGO5 gene with the complete coding region. The coding region sequence is shown in SEQ ID NO. 1.
[0027] 2) Construction of plant expression vector
[0028] sgRNA was designed using the CRISPR-P website (http: / / cbi.hzau.edu.cn / crispr / ). Four sgRNAs were selected for GmAGO5, and four pairs of targeting sequences were designed. The primer sequences are as follows:
[0029] sgF1:GGCCAGGGTTCGGTCTTGTA,
[0030] sgR1:TACAAGACCGAACCCTGGCCC;
[0031] sgF2:AGACGCGGCACGAACAGGTG,
[0032] sgR2:CACCTGTTCGTGCCGCGTCT;
[0033] sgF3:GACGGAGACGCGGCACGAAC,
[0034] sgR3:GTTCGTGCCGCGTCTCCGTC;
[0035] sgF4:ATTCAGTGAACGGCCAGGGTT,
[0036] sgR4:AACCCTGGCCGTTCACTGAAT.
[0037] These four targets were integrated into four sgDNA expression cassettes and finally ligated into the pGmUbi-Cas9-4XsgR vector. For details on the vector construction method, see Zhang et al., Plant Biotechnology Journal, 2020, 18:1384-1395. The ligation product was transformed into Escherichia coli, and single colonies were picked for bacterial testing. Bands appeared in the bacterial test, and sequencing showed that the sequences of the four sgRNAs were correct, indicating that the pGmUbi-Cas9-4XsgR-GmAGO5 vector was successfully constructed. The vector was transferred into Agrobacterium tumefaciens strain EHA105 by the freeze-thaw method and transformed into soybeans using the soybean cotyledonary node transformation method.
[0038] 3) Phenotypic identification of GmAGO5 gene-edited strains inoculated with SMV
[0039] Two knockout strains were obtained by tissue culture. The sgRNA fragments of the target gene of the sample were PCR amplified and sequenced. The sequencing results were analyzed by combining the peak plots. Both KO-AGO5-31-3-3 and KO-55-1 strains had large insertions or deletions at the sgRNA site ( Figure 2 ).
[0040] After the first pair of true leaves expanded, the wild-type Tianlong No. 1 and knockout strains were inoculated with 0.5 mL of SMV-SC7 virus suspension. Disease development was observed 21 days after inoculation. The wild-type Tianlong No. 1 plants showed more severe virus infection symptoms, with significant leaf mosaic and wrinkled deformities ( Figure 3 ). The expression of the viral CP gene was subsequently detected, and the results showed that the expression of the SMV-CP gene in the two knockout strains was significantly reduced compared with the wild type ( Figure 4 The detection primer sequences for the viral CP protein gene are F: CAGATGGGCGTGGTTATGA, R: ACAATGGGTTTCAGCGGATA. These results indicate that knocking out GmAGO5 reduces viral accumulation and improves soybean resistance to SMV-SC7.
Claims
1. Application of soybean GmAGO5 gene in soybean mosaic virus resistance, characterized in that: The soybean GmAGO5 gene nucleotide sequence is: SEQ ID NO.
1.
2. The use according to claim 1, characterized in that Knocking out the soybean GmAGO5 gene improves soybean resistance to soybean mosaic virus disease.
3. Use of a plant knockout vector carrying the soybean GmAGO5 gene according to claim 1 in constructing soybean materials resistant to soybean mosaic virus disease.
Citation Information
Cited By
Application of soybean ARGONAUTE family gene GmAGO5 in improvement of yield and quality
CN120099025A
Application of soybean argonaute family gene Gmago5 in improving yield and quality
CN120099025B