Method for constructing gene editing system of hybrid larch

Abstract

The invention relates to a method for constructing a gene editing system of hybrid larch, aiming at solving the problem of difficulty in gene editing of the hybrid larch and optimizing the gene editing system of the hybrid larch. The method comprises the following steps: 1, taking a hybrid larch callus growing for about 10 days as a gene editing transformation material; 2, preparing an infection solution, and resuspending the target gene-containing agrobacterium by using the infection solution to obtain an infection solution containing the agrobacterium; 3, placing the hybrid larch callus in an infection solution containing agrobacterium tumefaciens, and transferring the hybrid larch callus into a shaking table for infection; 4, filtering out the callus of the hybrid larch from the infection solution, and laying the callus on a culture medium containing acetosyringone; and 5, carrying out bacterium removal treatment on the callus which is placed for about 24 hours, and then laying the callus on a culture medium containing cephalosporin for subsequent screening. The CRISPR / Cas9 editing system of the hybrid larch callus, which is constructed by the method, is used for transforming larch genes, so that the CRISPR / Cas9 edited transgenic larch callus can be obtained. The method is used for constructing the CRISPR / Cas9 editing system of the hybrid larch.

Description

Technical Field

[0001] The present invention relates to a method for constructing a hybrid larch CRISPR / Cas9 editing system. Background Art

[0002] Larch (Larix spp.) is a very important afforestation species in northern my country. Hybrid larch is a very important fast-growing and cold-resistant species in the genus Larix, characterized by rapid growth, high ecological benefits, and technological value. It also has strong resistance to harsh climates, diseases, and insect pests. Due to the long growth cycle of hybrid larch, the selection of new varieties using conventional breeding techniques is time-consuming and slow to produce results. Furthermore, there are constraints such as a lack of gene sources and hybrid incompatibility. Plant genetic transformation technology refers to the use of molecular biology and genetic engineering techniques to insert gene fragments isolated from various organisms (including animals, plants, or microorganisms) into the genome of the recipient plant through various means. Through the replication, transcription, and translation of the exogenous genes, the recipient plant's physiological and biochemical traits are targeted.

[0003] Currently, the genetic transformation system for hybrid larch is immature and the genome editing system has low universality, making it difficult to carry out gene editing work in hybrid larch. Therefore, it is necessary to establish a gene editing system for hybrid larch and optimize the gene editing system for larch. Summary of the Invention

[0004] The present invention aims to solve the problem of difficulty in gene editing caused by the current lack of a gene editing system for hybrid larch, and provides a new method for constructing a hybrid larch gene editing system.

[0005] The present invention provides a method for constructing a gene editing system for hybrid larch, which is carried out according to the following steps:

[0006] S1. Take hybrid larch callus as transformation material;

[0007] S2. resuspending the Agrobacterium containing the target gene in an infection solution to obtain an infection solution containing Agrobacterium;

[0008] S3. Place the transformed material into the infection solution containing Agrobacterium and shake-cultivate;

[0009] S4. After the callus is infected, water is removed and the infected callus is spread on a medium containing acetosyringone and cultured in the dark.

[0010] S5. After bacterial scars appear on the callus tissue, perform sterilization treatment: wash the callus tissue containing bacteria obtained by co-cultivation in sterile deionized water, then wash it with a sterilization solution containing cephalosporin, and then spread it on a culture medium containing cephalosporin;

[0011] S6. After no bacteria grow on the culture medium containing cephalosporin and new callus tissue grows, the new callus tissue is spread on a culture medium containing hygromycin and cephalosporin. When new callus tissue grows, the construction of the hybrid larch gene editing system is completed.

[0012] Furthermore, the Agrobacterium containing the target gene in step 2 is an Agrobacterium transformed with a target gene knockout vector, wherein the target gene is the hybrid larch gene to be studied.

[0013] Furthermore, the infection solution and acetosyringone medium described in S2 are a mixture of 25-35 g / L sucrose, 5-6 g / L agar, 4-6 ml / L potassium salt, 4-6 ml / L iron salt, 4-6 ml / L calcium salt, 4-6 ml / L macroelements, 1.5-2.5 ml / L trace element I, 0.5-2 ml / L trace element II A, 0.5-2 ml / L trace element II B, 15-25 ml / L hydrolyzed casein, 15-25 ml / L inositol, 10-20 ml / L glutamine, 4-6 ml / L organic matter, 80-120 uM acetosyringone, 0.5-2 mg / L KT, and 4-6 mg / L 2,4-D;

[0014] Potassium salt is composed of 18~20 g / 100ml KNO3 and 2~3 g / 100ml KH2PO4; iron salt is composed of 0.05~0.10g / 100ml FeSO4 and 0.05~0.10 g / 100ml Na2EDTA; calcium salt is 4~5 g / 100ml Ca(NO3)2; the remainder is composed of 3~5 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5 g / 100ml MgSO4 and 2~3 g / 100mlMgCl2; trace element I is composed of 0.2~0.5 g / 100ml KI, 0.5~1.0 g / 100ml H3BO3, 0.5~1.0 g / 100ml MnSO4, 0.5~1.0 g / 100ml The composition of the water is ZnSO4; the trace element II A is 0.01~0.05 g / 100ml Na2MoO4; the trace element II B is composed of 0.01~0.05 g / 100ml CuSO4 and 0.1~0.5 g / 100ml CoCl2; the organic matter is composed of 0.01~0.05 g / 100ml VB1, 0.005~0.02 g / 100ml VB5, 0.01~0.03 g / 100ml VB6 and 0.03~0.05g / 100ml glycine;

[0015] The macroelements are composed of 2~6 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5g / 100ml MgSO4, and 2~3 g / 100ml MgCl2;

[0016] The mass concentration of hydrolyzed casein is 2~3 g / 100 ml; the mass concentration of inositol is 4~6 g / 100 ml; and the mass concentration of glutamine is 2~4 g / 100 ml.

[0017] Furthermore, the OD value of the infection solution containing Agrobacterium in S2 was 600 It is 0.5~0.6.

[0018] Furthermore, in S4, the callus tissue was soaked with the infection solution and infected at 28°C, 200 rpm for 20 min.

[0019] Furthermore, S4 was placed on acetosyringone medium and co-cultured in the dark for 20-24 h.

[0020] Furthermore, the sterilization solution and cephalosporin culture medium in step 5 are prepared by mixing 25-35 g / L sucrose, 5-6 g / L agar, 4-6 ml / L potassium salt, 4-6 ml / L iron salt, 4-6 ml / L calcium salt, 4-6 ml / L macroelements, 1.5-2.5 ml / L trace element 1, 0.5-2 ml / L trace element 2A, 0.5-2 ml / L trace element 2B, 15-25 ml / L hydrolyzed casein, 15-25 ml / L inositol, 10-20 ml / L glutamine, 4-6 ml / L organic matter, 80-120 uM acetosyringone, 0.5-2 mg / L KT, 4-6 mg / L 2,4-D, and 450-550 mg / L cephalosporin;

[0021] Potassium salt is composed of 18~20 g / 100ml KNO3 and 2~3 g / 100ml KH2PO4; iron salt is composed of 0.05~0.10g / 100ml FeSO4 and 0.05~0.10 g / 100ml Na2EDTA; calcium salt is 4~5 g / 100ml Ca(NO3)2; the remainder is composed of 3~5 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5 g / 100ml MgSO4 and 2~3 g / 100mlMgCl2; trace element I is composed of 0.2~0.5 g / 100ml KI, 0.5~1.0 g / 100ml H3BO3, 0.5~1.0 g / 100ml MnSO4, 0.5~1.0 g / 100ml The composition of the water is ZnSO4; the trace element II A is 0.01~0.05 g / 100ml Na2MoO4; the trace element II B is composed of 0.01~0.05 g / 100ml CuSO4 and 0.1~0.5 g / 100ml CoCl2; the organic matter is composed of 0.01~0.05 g / 100ml VB1, 0.005~0.02 g / 100ml VB5, 0.01~0.03 g / 100ml VB6 and 0.03~0.05g / 100ml glycine;

[0022] The macroelements are composed of 2~6 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5g / 100ml MgSO4, and 2~3 g / 100ml MgCl2;

[0023] The mass concentration of hydrolyzed casein is 2~3 g / 100 ml; the mass concentration of inositol is 4~6 g / 100 ml; and the mass concentration of glutamine is 2~4 g / 100 ml.

[0024] Furthermore, in S4, the callus containing bacteria was sterilized by washing it 2 to 3 times in sterile clean water, and then washing it with a sterilization solution containing cephalosporin, and each time it was placed in a shaker at 200 rpm for 5 minutes for 2 to 3 times, and then spread on a culture medium containing cephalosporin.

[0025] Furthermore, the culture medium for hygromycin and cephalexin in S6 is a mixture of 25-35 g / L sucrose, 5-6 g / L agar, 4-6 ml / L potassium salt, 4-6 ml / L iron salt, 4-6 ml / L calcium salt, 4-6 ml / L macroelements, 1.5-2.5 ml / L trace element I, 0.5-2 ml / L trace element II A, 0.5-2 ml / L trace element II B, 15-25 ml / L hydrolyzed casein, 15-25 ml / L inositol, 10-20 ml / L glutamine, 4-6 ml / L organic matter, 80-120 uM acetosyringone, 0.5-2 mg / L KT and 4-6 mg / L 2,4-D, 150-250 mg / L cephalexin, and 3-5 mg / L hygromycin.

[0026] Potassium salt is composed of 18~20 g / 100ml KNO3 and 2~3 g / 100ml KH2PO4; iron salt is composed of 0.05~0.10g / 100ml FeSO4 and 0.05~0.10 g / 100ml Na2EDTA; calcium salt is 4~5 g / 100ml Ca(NO3)2; the remainder is composed of 3~5 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5 g / 100ml MgSO4 and 2~3 g / 100mlMgCl2; trace element I is composed of 0.2~0.5 g / 100ml KI, 0.5~1.0 g / 100ml H3BO3, 0.5~1.0 g / 100ml MnSO4, 0.5~1.0 g / 100ml The composition of the water is ZnSO4; the trace element II A is 0.01~0.05 g / 100ml Na2MoO4; the trace element II B is composed of 0.01~0.05 g / 100ml CuSO4 and 0.1~0.5 g / 100ml CoCl2; the organic matter is composed of 0.01~0.05 g / 100ml VB1, 0.005~0.02 g / 100ml VB5, 0.01~0.03 g / 100ml VB6 and 0.03~0.05g / 100ml glycine;

[0027] The macroelements are composed of 2~6 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5g / 100ml MgSO4, and 2~3 g / 100ml MgCl2;

[0028] The mass concentration of hydrolyzed casein is 2~3 g / 100 ml; the mass concentration of inositol is 4~6 g / 100 ml; and the mass concentration of glutamine is 2~4 g / 100 ml.

[0029] Furthermore, in S6, after the cephalosporin culture medium stops growing bacteria and new callus tissue grows, the new callus tissue is divided into balls and spread on a culture medium containing hygromycin and cephalosporin.

[0030] Beneficial effects of the present invention:

[0031] This study uses hybrid larch callus as a starting material to construct and optimize a gene editing system suitable for hybrid larch. This gene editing system is used to transform hybrid larch genes, yielding gene-edited callus. Hybrid larch is an important and high-quality species within the genus Larix. Research on its gene editing system has important implications for research on genetic transformation systems for other larch species and has broad application in genetic engineering breeding of larch. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the electrophoresis diagram of the NAC2 gene fragment containing gRNA-1 / 2 / 3 / 4;

[0033] Figure 2 This is the electrophoresis diagram of gRNA in vitro transcription;

[0034] Figure 3 This is the electrophoresis diagram of the molecular weight of Cas9 protein;

[0035] Figure 4 The results of in vitro cleavage verification of RNPs activity;

[0036] Figure 5 Detection result map constructed for editing vector;

[0037] Figure 6 Schematic diagram of the composition of four different vectors. DETAILED DESCRIPTION

[0038] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed in the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify the contents of the present invention based on the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0039] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0040] Example 1:

[0041] The method for constructing a hybrid larch callus gene editing system in this embodiment includes the following steps: This embodiment is specifically used to transform the hybrid larch NAC2 gene.

[0042] 1. gRNA design of hybrid larch NAC2 gene and in vitro cleavage experiment to verify RNPs activity.

[0043] (1) Design of gRNA for the hybrid larch NAC2 gene

[0044] Select 4 gRNAs with higher scores according to the website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / SCORE

[0045] gRNA-1: GCATGGAGCTTTATTTTCAAGGG

[0046] gRNA-2:GTACAGGCTTGTCAATGACGAGG

[0047] gRNA-3: GCAAAAACTGGAGAACAGCATGG

[0048] gRNA-4: TGTCGAGTATTCCTGAAAAGTGG

[0049] (2) In vitro cleavage experiments to verify RNPs activity

[0050] The hybrid larch whole plant cDNA was used as a template and NAC2-F / R was used as primer to clone the fragment containing sgRNA-1 / 2 / 3 / 4. The fragment length was about 1000 bp. All PCR products were verified on 1.5% agarose gel. Figure 1 As shown, after the band is correct, the PCR product is recovered by gel; T7 promoter is added before the selected sgRNA-1 / 2 / 3 / 4 sequence, followed by stem-loop, which is synthesized by the company. This sequence is used as the in vitro transcription template sequence of sgRNA for PCR amplification. The primer sequences used are shown in Table 1. In vitro transcription is performed using the HiScribe T7RNA Synthesis Kit (NEB). Figure 2 As shown; CRISPR-Cas9 Protein (MCE) was diluted to 1 mg / ml, as Figure 3 As shown. RNP was prepared in vitro, sgRNA and Cas9 activities were detected, and verification was performed on a 1% agarose gel at 120V for 30min and observed under a gel imager. Figure 4 shown.

[0051] NAC2-F:ATGGGCGACTTGAACTGC

[0052] NAC2-R: CTAGAGAAAGTAATCTGACTCGAGTG

[0053] Table 1 Primers and sequences used for synthesis and amplification of sgRNA

[0054] Primer name Primer sequence 5'-3' BS6 AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGC BS7 AAAAAAAGCACCGACTCGGTGC T25-long GAAATTAATACGACTCACTATAG T7-gRNA-1-stem-loop TAATACGACTCACTATAGGTACAGGCTTGTCAATGACGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGG T7-gRNA-2-stem-loop TAATACGACTCACTATAGGCATGGAGCTTTATTTTCAAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGG T7-gRNA-3-stem-loop TAATACGACTCACTATAGGCAAAAACTGGAGAACAGCAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGG T7-gRNA-4-stem-loop TAATACGACTCACTATAGTGTCGAGTATTCCTGAAAAGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGG

[0055] Second, we selected two known Cas9 promoters (CaMV35S, ZmUbi) to drive Cas9 gene expression, and two promoters driving gRNA (OsU3, AtU6) to drive gRNA expression. We assembled them into four different vectors (see Figure 6 ).

[0056] 3. After the vector plasmid is digested, the product is recovered and purified by gel purification and the primer is directly annealed. T4 DNA ligase is added and ligated at 4°C overnight. The recombinant vector is transformed into Escherichia coli. Single clones are picked and expanded, tested and sequenced. The test results are shown in the figure below. Figure 5 ,As can be seen from the figure, after the gene was sequenced with the corresponding ,bands, the sequencing results were all correct, and the editing vectors were ,successfully obtained and were named 1245-559, 1247-559, 1261-559, 1263-559.

[0057] 4. Streak the Agrobacterium transformed with the NAC2 gene editing vector onto LB solid medium (containing 50 mg / L kanamycin, 50 mg / L gentamicin, and 50 mg / L rifampicin) and incubate in an incubator at 28°C for 48 h. Pick a single colony and transfer it to 5 mL of LB liquid medium (containing 50 mg / L kanamycin, 50 mg / L gentamicin, and 50 mg / L rifampicin) and incubate at 28°C, 200 rpm, for 24 h. After successful detection, transfer 5 mL of the microplate broth to 50 mL of LB liquid medium and incubate for 14-16 h to an OD value of 0.8. Centrifuge at 8000 rpm for 10 minutes to obtain the Agrobacterium containing the editing vector.

[0058] Prepare infection solution and use infection solution to resuspend Agrobacterium containing editing vector to obtain Agrobacterium infection solution containing editing vector; OD of infection solution containing Agrobacterium is 600 It is 0.5~0.6.

[0059] The infection solution is composed of 30g / L sucrose, 5ml / L potassium salt (18.198g / 100ml KNO3, 2.722g / 100mlKH2PO4), 5ml / L iron salt (0.0556g / 100ml FeSO4, 0.0746g / 100ml Na2EDTA), 5ml / L calcium salt (4.724g / 100ml Ca(NO3)2), 5ml / L macroelements (4g / 100ml NH4NO3, 5.13g / 100ml Mg(NO3)2, 4.92g / 100ml MgSO4, 2.034g / 100ml MgCl2), 2ml / L microelements (0.2075g / 100ml KI, 0.775g / 100ml H3BO3, 0.525g / 100ml MnSO4, 0.7344g / 100ml ZnSO4), 1ml / L micro (di) A (0.0125g / 100ml Na2MoO4), 1ml / L micro (di) B (0.01725g / 100ml CuSO4, 0.125g / 100ml CoCl2), 20ml / L hydrolyzed casein (2.5g / 100ml), 20ml / L inositol (5g / 100ml), 15ml / L glutamine (3g / 100ml), 5ml / L organic matter (0.02g / 100ml VB1, 0.01g / 100ml VB5, 0.02g / 100ml VB6, 0.04g / 100ml glycine), 100uM / L acetosyringone, 1 mg / L KT, 10mg / L 2,4-D;

[0060] 5. Place the pre-prepared hybrid larch callus into the infection solution of Agrobacterium containing the editing vector, and then place it in a shaker at 37°C and 200 rpm for infection for 20 minutes;

[0061] 6. After infection, drain the callus tissue with a funnel, place it on filter paper, absorb the excess infection liquid, and then spread it on the culture medium containing acetosyringone and co-cultivate in the dark for about 24 hours;

[0062] 7. After the callus tissue shows bacterial scars, sterilize it. Wash the callus tissue containing bacteria in sterile water for 2 to 3 times, then wash it with sterilization solution containing cephalosporin, shake it in a shaker at 200 rpm for 5 minutes each time for 2 to 3 times, and then spread it on a culture medium containing cephalosporin;

[0063] 8. After the cephalosporin culture medium has stopped growing bacteria and new callus tissue has grown, the new callus tissue is divided into small groups and spread on a culture medium containing hygromycin and cephalosporin for subsequent screening. The results of the obtained transgenic callus tissue are shown in the following table:

[0064] Vector name Number of infections The number of transgenic callus lines obtained 1245-559 20 0 1247-559 20 0 1261-559 20 17 1263-559 20 13

[0065] As can be seen from the table above, in order to improve the transformation efficiency, a vector promoter design was made as follows Figure 6 , 1245-559 and 1247-559 use 35S promoter to activate Cas9 protein, 1261-559 and 1263-559 use ZmUbi promoter to activate Cas9 protein, 1245-559 and 1247-559 did not successfully obtain transgenic lines, indicating that the 35S promoter did not function. When the promoter in the expression region of the vector does not work, the tag protein cannot function normally. As a result, no corresponding callus tissue was obtained during the screening process. The transgenic callus lines 1261-559 and 1263-559 were activated by AtU6 and OsU3 to activate gRNA to play the corresponding functions, such as Figure 6 , two different vectors can produce corresponding transgenic strains.

Claims

1. A method for constructing a gene editing system for hybrid larch, characterized in that It is done in the following steps: S1. Take hybrid larch callus as transformation material; S2. resuspending the Agrobacterium containing the target gene in an infection solution to obtain an infection solution containing Agrobacterium; S3. Place the transformed material into the infection solution containing Agrobacterium and shake-cultivate; S4. After the callus is infected, water is removed and the infected callus is spread on a medium containing acetosyringone and cultured in the dark. S5. After bacterial scars appear on the callus tissue, perform sterilization treatment: wash the callus tissue containing bacteria obtained by co-cultivation in sterile deionized water, then wash it with a sterilization solution containing cephalosporin, and then spread it on a culture medium containing cephalosporin; S6. After no bacteria grow on the culture medium containing cephalosporin and new callus tissue grows, the new callus tissue is spread on a culture medium containing hygromycin and cephalosporin. When new callus tissue grows, the construction of the hybrid larch gene editing system is completed.

2. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that The Agrobacterium containing the target gene in step 2 is an Agrobacterium transformed with a target gene knockout vector, wherein the target gene is the hybrid larch gene to be studied.

3. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that The infection solution and acetosyringone medium of S2 are prepared by mixing 25-35 g / L sucrose, 5-6 g / L agar, 4-6 ml / L potassium salt, 4-6 ml / L iron salt, 4-6 ml / L calcium salt, 4-6 ml / L macroelements, 1.5-2.5 ml / L trace element I, 0.5-2 ml / L trace element II A, 0.5-2 ml / L trace element II B, 15-25 ml / L hydrolyzed casein, 15-25 ml / L inositol, 10-20 ml / L glutamine, 4-6 ml / L organic matter, 80-120 uM / L acetosyringone, 0.5-2 mg / L KT, and 4-6 mg / L 2,4-D. Potassium salt is composed of 18~20 g / 100ml KNO3 and 2~3 g / 100ml KH2PO4; iron salt is composed of 0.05~0.10 g / 100ml FeSO4 and 0.05~0.10 g / 100ml Na2EDTA; calcium salt is 4~5 g / 100ml Ca(NO3)2; the remainder is composed of 3~5 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5 g / 100ml MgSO4 and 2~3 g / 100ml MgCl2; trace element I is composed of 0.2~0.5 g / 100ml KI, 0.5~1.0 g / 100ml H3BO3, 0.5~1.0 g / 100ml MnSO4, 0.5~1.0 g / 100ml It is composed of ZnSO4; trace element II A is 0.01~0.05 g / 100ml Na2MoO4; trace element II B is composed of 0.01~0.05 g / 100ml CuSO4 and 0.1~0.5 g / 100ml CoCl2; organic matter is composed of 0.01~0.05 g / 100ml VB1, 0.005~0.02 g / 100ml VB5, 0.01~0.03 g / 100ml VB6 and 0.03~0.05 g / 100ml glycine; The macroelements are composed of 2~6 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5g / 100ml MgSO4, and 2~3 g / 100ml MgCl2; The mass concentration of hydrolyzed casein is 2~3 g / 100 ml; the mass concentration of inositol is 4~6 g / 100 ml; and the mass concentration of glutamine is 2~4 g / 100 ml.

4. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that The OD value of the infection solution containing Agrobacterium in S2 600 It is 0.5~0.

6.

5. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that In S4, the callus tissue was soaked with infection solution and infected at 28°C, 200 rpm for 20 min.

6. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that S4 was placed on acetosyringone medium and co-cultured in the dark for 20-24 h.

7. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that Step 5: The sterilization solution and cephalosporin culture medium are prepared by mixing 25-35 g / L sucrose, 5-6 g / L agar, 4-6 ml / L potassium salt, 4-6 ml / L iron salt, 4-6 ml / L calcium salt, 4-6 ml / L macroelements, 1.5-2.5 ml / L trace element 1, 0.5-2 ml / L trace element 2A, 0.5-2 ml / L trace element 2B, 15-25 ml / L hydrolyzed casein, 15-25 ml / L inositol, 10-20 ml / L glutamine, 4-6 ml / L organic matter, 80-120 uM acetosyringone, 0.5-2 mg / L KT, 4-6 mg / L 2,4-D, and 450-550 mg / L cephalosporin. Potassium salt is composed of 18~20 g / 100ml KNO3 and 2~3 g / 100ml KH2PO4; iron salt is composed of 0.05~0.10 g / 100ml FeSO4 and 0.05~0.10 g / 100ml Na2EDTA; calcium salt is 4~5 g / 100ml Ca(NO3)2; the remainder is composed of 3~5 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5 g / 100ml MgSO4 and 2~3 g / 100ml MgCl2; trace element I is composed of 0.2~0.5 g / 100ml KI, 0.5~1.0 g / 100ml H3BO3, 0.5~1.0 g / 100ml MnSO4, 0.5~1.0 g / 100ml It is composed of ZnSO4; trace element II A is 0.01~0.05 g / 100ml Na2MoO4; trace element II B is composed of 0.01~0.05 g / 100ml CuSO4 and 0.1~0.5 g / 100ml CoCl2; organic matter is composed of 0.01~0.05 g / 100ml VB1, 0.005~0.02 g / 100ml VB5, 0.01~0.03 g / 100ml VB6 and 0.03~0.05 g / 100ml glycine; The macroelements are composed of 2~6 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5g / 100ml MgSO4, and 2~3 g / 100ml MgCl2; The mass concentration of hydrolyzed casein is 2~3 g / 100 ml; the mass concentration of inositol is 4~6 g / 100 ml; and the mass concentration of glutamine is 2~4 g / 100 ml.

8. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that In S4, the callus containing bacteria was sterilized by washing it 2 to 3 times in sterile clean water, and then washing it with a sterilization solution containing cephalosporin. Each time, it was placed in a shaker at 200 rpm for 5 minutes and washed 2 to 3 times, and then spread on a culture medium containing cephalosporin.

9. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that The medium for hygromycin and cephalexin in S6 is a mixture of 25-35 g / L sucrose, 5-6 g / L agar, 4-6 ml / L potassium salt, 4-6 ml / L iron salt, 4-6 ml / L calcium salt, 4-6 ml / L macroelements, 1.5-2.5 ml / L trace element I, 0.5-2 ml / L trace element II A, 0.5-2 ml / L trace element II B, 15-25 ml / L hydrolyzed casein, 15-25 ml / L inositol, 10-20 ml / L glutamine, 4-6 ml / L organic matter, 80-120 uM acetosyringone, 0.5-2 mg / L KT and 4-6 mg / L 2,4-D, 150-250 mg / L cephalexin, and 3-5 mg / L hygromycin. Potassium salt is composed of 18~20 g / 100ml KNO3 and 2~3 g / 100ml KH2PO4; iron salt is composed of 0.05~0.10 g / 100ml FeSO4 and 0.05~0.10 g / 100ml Na2EDTA; calcium salt is 4~5 g / 100ml Ca(NO3)2; the remainder is composed of 3~5 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5 g / 100ml MgSO4 and 2~3 g / 100ml MgCl2; trace element I is composed of 0.2~0.5 g / 100ml KI, 0.5~1.0 g / 100ml H3BO3, 0.5~1.0 g / 100ml MnSO4, 0.5~1.0 g / 100ml It is composed of ZnSO4; trace element II A is 0.01~0.05 g / 100ml Na2MoO4; trace element II B is composed of 0.01~0.05 g / 100ml CuSO4 and 0.1~0.5 g / 100ml CoCl2; organic matter is composed of 0.01~0.05 g / 100ml VB1, 0.005~0.02 g / 100ml VB5, 0.01~0.03 g / 100ml VB6 and 0.03~0.05 g / 100ml glycine; The macroelements are composed of 2~6 g / 100ml NH4NO3, 5~6 g / 100ml Mg(NO3)2, 4~5g / 100ml MgSO4, and 2~3 g / 100ml MgCl2; The mass concentration of hydrolyzed casein is 2~3 g / 100 ml; the mass concentration of inositol is 4~6 g / 100 ml; and the mass concentration of glutamine is 2~4 g / 100 ml.

10. The method for constructing a gene editing system for hybrid larch according to claim 1, characterized in that In S6, after the cephalosporin culture medium has no bacteria and new callus tissue has grown, the new callus tissue is divided into balls and spread on a culture medium containing hygromycin and cephalosporin.

Images