Fluorescent PCR (Polymerase Chain Reaction) detection kit for African swine fever virus

Abstract

The invention relates to the technical field of virus detection, and particularly discloses an African swine fever virus fluorescent PCR detection kit. The kit comprises three groups of specific primer probes, namely a B646L gene primer probe, an EP402R gene primer probe and an endogenous reference gene primer probe, the detection method of the kit comprises the following steps: adding a sample to be detected into the integrated detection reagent card, adsorbing nucleic acid by the magnetic beads, and amplifying the nucleic acid. By designing the specific primers and probes and optimizing the reaction system and conditions, the B646L gene and the EP402R gene can be simultaneously detected in one reaction, and the amplification reactions of the two genes do not interfere with each other, so that the prepared fluorescent PCR detection kit for the African swine fever virus not only has high sensitivity and strong specificity, but also has good repeatability, and the kit is suitable for being used in the detection of the African swine fever virus. The accurate detection of the African swine fever virus is realized, and a more efficient detection method is provided for the prevention, control and diagnosis of epidemic situations.

Description

Technical Field

[0001] The present application relates to the technical field of virus detection, and more specifically, to a fluorescent PCR detection kit for African swine fever virus. Background Art

[0002] African swine fever (ASF) is an acute, hemorrhagic, and highly contagious disease caused by the African swine fever virus (ASFV). The World Organization for Animal Health (WOAH) lists it as a notifiable animal disease, and it is a priority animal disease for prevention in my country. It is characterized by a short onset of illness, with a mortality rate of up to 100% in the most acute and acute phases of infection. Clinical manifestations include fever (up to 40-42°C), a rapid heartbeat, and difficulty breathing. The clinical symptoms of ASF are similar to those of swine fever and can only be confirmed through laboratory testing.

[0003] The laboratory diagnostic methods for ASFV are mainly divided into pathogen detection and serological detection, mainly including virus isolation and red blood cell adsorption, PCR detection, Realtime-PCR detection, and ELISA detection. These methods have the problems of long detection time, low sensitivity, and many false positives. The magnetic bead-mediated integrated polymerase amplification (microfluidics) technology has the characteristics of full closed process, high sensitivity, strong stability, intelligent result output, and remote monitoring visualization. This technology integrates nucleic acid extraction and nucleic acid amplification, and can realize the use of magnetic beads throughout the entire nucleic acid detection process. Combining microfluidics technology with real-time fluorescence quantitative PCR technology to develop an African swine fever virus microfluidic fluorescence PCR detection kit based on microfluidics technology can increase the speed of ASFV detection, shorten the detection time, and improve accuracy. Based on the above statements, this application proposes an African swine fever virus fluorescence PCR detection kit. Summary of the Invention

[0004] In order to solve the problems of existing ASFV detection technology such as long time consumption, low sensitivity and many false positives, the present application provides an African swine fever virus fluorescent PCR detection kit.

[0005] In the first aspect, the present application provides an African swine fever virus fluorescence PCR detection kit, comprising a sample lysis extract, a sample washing solution, and a reaction premix for detecting African swine fever virus.

[0006] Preferably, the sample lysis extraction solution comprises the following components: SDS, TritonX-100, KCl, ethanol, EDTA and Tris-HCl.

[0007] Preferably, the sample lysis extract comprises the following components: 3M SDS, 3% TritonX-100, 0.5M KCl, 30% ethanol, 0.8mM EDTA and 15mM Tris-HCl.

[0008] Preferably, the sample washing solution comprises sample washing solution I and sample washing solution II.

[0009] Preferably, the sample washing solution I comprises the following components: guanidine hydrochloride, PBS buffer, EDTA, isopropanol, NP-40 and NaCl; and the sample washing solution II is isopropanol.

[0010] Preferably, the sample washing solution I comprises the following components: 2M guanidine hydrochloride, 12mM PBS buffer, 2mM EDTA, 30% isopropanol, 3% NP-40 and 0.3M NaCl; the sample washing solution II is 50% isopropanol.

[0011] Preferably, the reaction premix includes a B646L gene primer probe, an EP402R gene primer probe, an internal standard gene primer probe, and a DNA-direct realtime PCR master mix.

[0012] Preferably, the B646L gene primer probe includes a forward F primer, a reverse R primer and a probe, and the optimal reaction concentrations are: B646L-F 0.4 μM, B646L-R 0.4 μM, B646L-probe 0.3 μM, and the nucleotide sequences are: B646L-F: GCTCTTACATACCCTTCCACTAC (SEQ ID NO. 1); B646L-R: GGATACGTTAATATGACCACTGGG (SEQ ID NO. 2); B646L-probe: FAM-AACCCCCGATCCGGGTGCGATG-BHQ1 (SEQ ID NO. 3).

[0013] Preferably, the EP402R gene primer probe includes a forward F primer, a reverse R primer and a probe, and the optimal reaction concentrations are: EP402R-F 0.6 μM, EP402R-R 0.6 μM, EP402R-probe 0.2 μM, and the nucleotide sequences are: EP402R-F: AGGCTTAGGAAGTAATGGTTCTC (SEQ ID NO.4); EP402R-R: GAAAGTCCACCACCTGAATCT (SEQ ID NO.5); EP402R-probe: ROX-AGTGGTGTCATCATCATGCTGACATTGTTCT-BHQ3 (SEQ ID NO. 6).

[0014] Preferably, the internal standard gene primer probe includes a forward F primer, a reverse R primer and a probe, and the optimal reaction concentration is: 18S-F 0.3 μM, 18S-R 0.3 μM, 18S-probe 0.2 μM, and the nucleotide sequences are: 18S-F: GCCCGATCCGTTACTTTG (SEQ ID NO. 7); 18S-R: GCCGTCCCTCTTAATCATGG (SEQ ID NO. 8); 18S-probe: VIC-TTAGAGTGTTCAAAGCAGGCCCAAGC-BHQ2 (SEQ ID NO. 9).

[0015] Preferably, the reaction premix includes B646L-F 0.4 μM, B646L-R 0.4 μM, B646L-probe 0.3 μM, EP402R-F 0.6 μM, EP402R-R 0.6 μM, EP402R-probe 0.2 μM, 18S-F 0.3 μM, 18S-R 0.3 μM, 18S-probe 0.2 μM, and 1× DNA-direct realtime PCR master mix.

[0016] In a second aspect, the present application provides a non-diagnostic detection method for an African swine fever virus fluorescent PCR detection kit, which specifically comprises the following steps: S1. The first, second, third, and fourth chambers of the integrated detection reagent card are respectively used to store the sample lysis extract, sample washing solution I, sample washing solution II, and reaction premix solution; S2. Add the sample to be tested to the integrated detection reagent card, cover the card, and gradually carry out the following reactions in the integrated detection reagent card: (1) The sample lysis extraction solution lyses the sample to be tested, and the magnetic beads adsorb African swine fever virus DNA and internal standard gene DNA; (2) The magnetic beads adsorb African swine fever virus DNA and internal standard gene DNA for directional movement, and the sample washing solution removes non-nucleic acid samples on the magnetic beads; (3) The magnetic beads enter the molecular amplification reaction area, the viral DNA dissociates from the magnetic beads, and the reaction program is set to perform fluorescent quantitative PCR reaction; (4) Analyze whether the sample to be tested is infected with African swine fever virus based on the fluorescence curve.

[0017] Preferably, the reaction procedure in step (3) is 40 cycles of 95°C for 40s, 90°C for 1-3s, and 61-65°C for 45s, and the dissociation buffer is 10mM Tris-HCl, pH 8.0.

[0018] In summary, this application has the following beneficial effects: 1. By designing specific primers and probes, this application can simultaneously detect the B646L gene and the EP402R gene in one reaction, thereby achieving comprehensive detection of African swine fever type I virus and African swine fever type II virus, effectively improving the efficiency of virus detection. The optimized reaction system and reaction conditions have good operating effects and improve the accuracy and sensitivity of detection.

[0019] 2. The African swine fever virus fluorescent PCR detection kit prepared in this application has high sensitivity, and the detection sensitivity of the B646L gene and EP402R gene is 1 copies / μL.

[0020] 3. The African swine fever virus fluorescent PCR detection kit prepared in this application has strong specificity and can accurately detect the B646L gene-positive plasmid standard and the EP402R gene-positive plasmid standard. However, no amplification curves were generated for the detection of swine fever virus CSFV, porcine parvovirus PPV, porcine Japanese encephalitis virus JEV, porcine circovirus type 2 PCV2, and porcine epidemic diarrhea virus PEDV.

[0021] 4. The African swine fever virus fluorescent PCR detection kit prepared in this application has good repeatability, with the coefficient of variation within the group ranging from 0.42% to 1.24%, and the coefficient of variation between groups ranging from 0.27% to 1.92%. The coefficients of variation within and between groups are both less than 3%, and the reliability is strong. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the integrated molecular diagnostic results of the throat swab fluid of a healthy pig in Example 2. (1. B646L gene; 2. EP402R gene; 3. internal standard gene).

[0023] Figure 2 This is a graph showing the sensitivity test results of the African swine fever virus fluorescence PCR detection kit in Example 3. (1-7: 1×10 0 B646L gene plasmid, 1×10 1 B646L gene plasmid, 1×10 2 B646L gene plasmid, 1×10 3 B646L gene plasmid, 1×10 4 B646L gene plasmid, 1×10 5 B646L gene plasmid, 1×10 6B646L gene plasmid; 8-14: 1×10 0 EP402R gene plasmid, 1×10 1 EP402R gene plasmid, 1×10 2 EP402R gene plasmid, 1×10 3 EP402R gene plasmid, 1×10 4 EP402R gene plasmid, 1×10 5 EP402R gene plasmid, 1×10 6 EP402R gene plasmid; 15. internal standard gene).

[0024] Figure 3 This is a graph showing the specific detection results of the African swine fever virus fluorescent PCR detection kit in Example 4. (1. B646L gene; 2. EP402R gene; 3-7: Classical swine fever virus (CSFV), porcine parvovirus (PPV), Japanese encephalitis virus (JEV), porcine circovirus type 2 (PCV2), porcine epidemic diarrhea virus (PEDV); 8. internal standard gene). DETAILED DESCRIPTION

[0025] The present application is further described in detail below with reference to the embodiments.

[0026] Example 1 1. Primer and Probe Design The B646L gene, present in all genotypes of African swine fever virus (ASFV) (e.g., genotype I and genotype II), encodes the major capsid protein p72 and is an important target for serological and molecular biological detection. The EP402R gene, derived from genotype II viruses, plays a crucial role in ASFV infection, influencing the viral load in the host blood and virulence. Published B646L and EP402R gene sequences were searched from GeneBank. Multiple sequence alignments were performed to identify conserved regions. Based on sequence structural characteristics, appropriate annealing temperatures and GC content were selected to design multiple primer and probe pairs. After analysis and comparison, the optimal primer and probe pairs were selected, as shown in Table 1. The optimal primers were used for amplification and ligated into the pUC57 vector to generate B646L and EP402R gene-positive plasmid standards.

[0027] Table 1

[0028] 2. Design of internal standard primers and probes Published full-length 18S rRNA sequences for human, gorilla, gibbon, duck, mouse, camel, sheep, cattle, deer, horse, chicken, macaque, rabbit, pig, and whale species were searched in GeneBank for multiple sequence alignment analysis. A conserved region was selected as the internal standard gene target sequence. Primers and probes were designed to determine the optimal combination, as shown in Table 2. The optimal primers were used for amplification and ligated into the pUC57 vector to obtain the internal standard gene positive plasmid standard.

[0029] Table 2

[0030] Example 2 Optimization of the primer-probe reaction system and reaction conditions designed above.

[0031] Primer concentrations were screened in the range of 0.2–0.6 μM with an increase of 0.2 μM; The probe concentration was screened in the range of 0.1–0.3 μM with an increase of 0.1 μM; The annealing temperatures were optimized and set to 61°C, 62°C, 63°C, 64°C, and 65°C; The denaturation time was optimized and set to 1s, 2s, and 3s respectively; According to the optimized conditions, the Ct values ​​were compared, and the condition with the smallest Ct value was considered the best reaction condition. The results are shown in Tables 3, 4, 5, and 6.

[0032] Table 3

[0033] As shown in Table 3, the Ct value was the smallest when the concentration of the B646L primer was 0.4 μM, and the Ct value was the smallest when the concentration of the EP402R primer was 0.6 μM.

[0034] Table 4

[0035] As shown in Table 4, the Ct value is the smallest when the B646L probe concentration is 0.3 μM, and the Ct value is the smallest when the EP402R probe concentration is 0.2 μM, indicating that the optimal probe concentration of B646L is 0.3 μM, and the optimal probe concentration of EP402R is 0.2 μM.

[0036] Table 5

[0037] As shown in Table 5, when the annealing temperature is 64°C, the Ct values ​​of the B646L primer probe and the EP402R primer probe are both the smallest, indicating that the optimal annealing temperature is 64°C.

[0038] Table 6

[0039] As shown in Table 6, when the denaturation time is 2 s, the Ct values ​​of the B646L primer probe and the EP402R primer probe are both the smallest, indicating that the optimal denaturation time is 2 s.

[0040] The optimal reaction system was: B646L-F 0.4μM, B646L-R 0.4μM, B646L-probe 0.3μM, EP402R-F 0.6μM, EP402R-R 0.6μM, EP402R-probe 0.2μM, 18S-F 0.3μM, 18S-R 0.3μM, 18S-probe 0.2μM, and 1× DNA-direct realtime PCR master mix.

[0041] The optimal reaction conditions were: 95℃40s, 90℃2s, 64℃45s, 40 cycles, and the dissociation buffer was 10mM Tris-HCl, pH 8.0.

[0042] Result determination: No Ct value or Ct value of 40 is negative; Ct value <35 is positive; Ct value range of 35-40 is suspicious and requires re-testing. If the re-test Ct is <40 and there is an obvious peak on the amplification curve, it is positive, otherwise it is negative.

[0043] The B646L gene positive plasmid standard and the EP402R gene positive plasmid standard were mixed into the throat swab fluid of healthy pigs to simulate clinical samples. 200 μL of the throat swab fluid was added to the integrated molecular diagnostic reagent card for reaction. The results were as follows: Figure 1 As shown, the B646L gene positive plasmid standard peaks at a Ct value of 24, the EP402R gene positive plasmid standard peaks at a Ct value of 17, and the internal standard gene peaks at a Ct value of 28, indicating that the reaction of the kit of this application runs well and the results are accurate.

[0044] Example 3 Sensitivity testing of the African swine fever virus fluorescence PCR detection kit.

[0045] The B646L gene positive plasmid standard was diluted in a 10-fold gradient (1×10 0 Plasmid, 1×10 1 Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 Plasmid), EP402R gene positive plasmid standard was diluted in 10-fold gradient (1×10 0 Plasmid, 1×10 1Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 Plasmid) was used as a template, corresponding primers and probes were added, and fluorescence quantitative PCR detection was performed according to the optimal reaction system and reaction conditions described in Example 2.

[0046] The results are as follows Figure 2 As shown, the detection sensitivity of B646L gene and EP402R gene is 1 copies / μL, indicating that the kit and detection method of the present application can detect trace amounts of viruses, have high sensitivity, and can promptly control the development of the epidemic in the early stage of the epidemic.

[0047] Example 4 Specificity detection of African swine fever virus fluorescence PCR detection kit.

[0048] Using plasmid standards of the B646L gene, EP402R gene, classical swine fever virus CSFV, porcine parvovirus PPV, porcine Japanese encephalitis virus JEV, porcine circovirus type 2 PCV2, porcine epidemic diarrhea virus PEDV and internal standard genes (corresponding to 1, 2, 3, 4, 5, 6, 7, and 8, respectively) as templates, a fluorescent quantitative PCR amplification reaction was performed according to the optimal reaction system and reaction conditions described in Example 2.

[0049] The results are as follows Figure 3 As shown, both the B646L gene plasmid standard and the EP402R gene plasmid standard produced distinct peak amplification curves; whereas other porcine viral plasmid standards did not produce distinct amplification curves. This indicates that the kit of the present application does not produce nonspecific amplification curves and is highly specific.

[0050] Example 5 Repeatability testing of the African swine fever virus fluorescence PCR detection kit.

[0051] The copy number is 1×10 4 , 1×10 5 and 1×10 6 Intra-assay reproducibility experiments were conducted with the B646L gene-positive plasmid standard and the EP402R gene-positive plasmid standard. Each sample was assayed with three replicates for quantitative PCR. The mean Ct value, standard deviation, and coefficient of variation of the reaction results were calculated. The results are shown in Table 7.

[0052] Table 7

[0053] The copy number is 1×10 4 , 1×105 and 1×10 6 Inter-batch reproducibility experiments were conducted with the B646L gene-positive plasmid standard and the EP402R gene-positive plasmid standard. Fluorescence quantitative PCR was performed with three replicates per sample, and replicates were performed at two different time points. The mean Ct value, standard deviation, and coefficient of variation of the reaction results were calculated. The results are shown in Table 8.

[0054] Table 8

[0055] According to Tables 7 and 8, the coefficient of variation within the group ranged from 0.42% to 1.24%, and the coefficient of variation between the groups ranged from 0.27% to 1.92%. The coefficients of variation within and between the groups were both less than 3%, indicating that the kit of the present application had good reproducibility both within and between the groups.

[0056] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. A fluorescent PCR detection kit for African swine fever virus, characterized in that: Contains sample lysis extraction solution, sample washing solution, and reaction premix solution for detecting African swine fever virus; The reaction premix includes a B646L gene primer probe, an EP402R gene primer probe, an internal standard gene primer probe, and a DNA-direct realtime PCR master mix; The B646L gene primer probe includes a forward F primer, a reverse R primer and a probe. The optimal reaction concentrations are: B646L-F 0.4 μM, B646L-R 0.4 μM, B646L-probe 0.3 μM. The nucleotide sequences are: B646L-F: GCTCTTACATACCCTTCCACTAC (SEQ ID NO. 1); B646L-R: GGATACGTTAATATGACCACTGGG (SEQ ID NO. 2); B646L-probe: FAM-AACCCCCGATCCGGGTGCGATG-BHQ1 (SEQ ID NO. 3); The EP402R gene primer probe includes a forward F primer, a reverse R primer and a probe. The optimal reaction concentrations are: EP402R-F 0.6 μM, EP402R-R 0.6 μM, EP402R-probe 0.2 μM. The nucleotide sequences are: EP402R-F: AGGCTTAGGAAGTAATGGTTCTC (SEQ ID NO.4); EP402R-R: GAAAGTCCACCACCTGAATCT (SEQ ID NO.5); EP402R-probe: ROX-AGTGGTGTCATCATCATGCTGACATTGTTCT-BHQ3 (SEQ ID NO. 6); The internal standard gene primer probe includes a forward F primer, a reverse R primer and a probe. The optimal reaction concentrations are: 18S-F 0.3 μM, 18S-R 0.3 μM, 18S-probe 0.2 μM, and the nucleotide sequences are: 18S-F: GCCCGATCCGTTACTTTG (SEQ ID NO. 7); 18S-R: GCCGTCCCTCTTAATCATGG (SEQ ID NO. 8); 18S-probe: VIC-TTAGAGTGTTCAAAGCAGGCCCAAGC-BHQ2 (SEQ ID NO. 9).

2. The African swine fever virus fluorescent PCR detection kit according to claim 1, characterized in that The sample lysis extraction solution includes the following components: SDS, TritonX-100, KCl, ethanol, EDTA and Tris-HCl.

3. The African swine fever virus fluorescent PCR detection kit according to claim 1, characterized in that The sample washing solution includes sample washing solution I and sample washing solution II.

4. The African swine fever virus fluorescent PCR detection kit according to claim 3, characterized in that The sample washing solution I comprises the following components: guanidine hydrochloride, PBS buffer, EDTA, isopropanol, NP-40 and NaCl; Sample wash solution II is isopropyl alcohol.

5. A non-diagnostic detection method of the African swine fever virus fluorescent PCR detection kit according to any one of claims 1 to 4, characterized in that: The specific steps include the following: S1. The first, second, third, and fourth chambers of the integrated detection reagent card are respectively used to store the sample lysis extract, sample washing solution I, sample washing solution II, and reaction premix solution; S2. Add the sample to be tested to the integrated detection reagent card, cover the card, and gradually carry out the following reactions in the integrated detection reagent card: (1) The sample lysis extraction solution lyses the sample to be tested, and the magnetic beads adsorb African swine fever virus DNA and internal standard gene DNA; (2) The magnetic beads adsorb African swine fever virus DNA and internal standard gene DNA for directional movement, and the sample washing solution removes non-nucleic acid samples on the magnetic beads; (3) The magnetic beads enter the molecular amplification reaction area, the viral DNA dissociates from the magnetic beads, and the reaction program is set to perform fluorescent quantitative PCR reaction; (4) Analyze whether the sample to be tested is infected with African swine fever virus based on the fluorescence curve.

6. The non-diagnostic detection method of the African swine fever virus fluorescent PCR detection kit according to claim 5, characterized in that: The reaction procedure in step (3) is 40 cycles of 95°C for 40s, 90°C for 1-3s, and 61-65°C for 45s. The dissociation buffer is 10mM Tris-HCl, pH 8.0.

Images