Preparation method of platelet-derived growth factor BB

Abstract

The invention discloses a preparation method of a platelet-derived growth factor BB. The preparation method comprises the following steps: cloning and implanting a coding gene of the platelet-derived growth factor BB into a prokaryotic expression vector to construct a recombinant prokaryotic expression vector, transferring the recombinant prokaryotic expression vector into a proper prokaryotic host cell, and culturing the prokaryotic host cell to obtain the platelet-derived growth factor BB recombinant prokaryotic expression vector. A non-soluble recombinant protein containing the platelet-derived growth factor BB is expressed, and a high-purity protein is separated. Compared with the existing reverse purification technology, the method for preparing the platelet-derived growth factor BB has the advantages that the purification steps are simple, the protein loss amount is reduced, the required purification consumables are low in price, and the cost can be greatly reduced in development and production.

Description

Technical Field

[0001] The invention relates to a preparation method of platelet-derived growth factor BB (PDGF BB), belonging to the field of biotechnology. Background Art

[0002] Platelet-derived growth factor (PDGF) is a common peptide regulatory factor that stimulates connective tissue proliferation. It is synthesized by bone marrow macrophages and stored in platelet Q granules. PDGF is a basic glycoprotein with a molecular weight of 28-35 kDa. It is a dimer of two polypeptide chains, composed of two subunits (A chain and B chain) bound by disulfide bonds. PDGF is an important mitogen that stimulates the division and proliferation of various cells, including vascular smooth muscle cells, fibroblasts, and glial cells. It regulates individual development and cell differentiation, and plays a prominent role in wound healing. PDGF was originally isolated from platelets. Endothelial cells, vascular smooth muscle cells, activated monocytes, and macrophages can also produce PDGF. It is composed of two different polypeptide chains, linked by disulfide bonds to form dimers. Different combinations of dimers form three isomers: PDGF-AA, PDGF-BB, and PDGF-AB. PDGF has two distinct receptors, α and β, which are transmembrane glycoproteins with five immunoglobulin-like domains in the extracellular receptor binding region and a tyrosine protein kinase in the cytoplasm. Receptor α recognizes both PDGF-AA and PDGF-BB, and thus binds all three PDGF isoforms with high affinity. Receptor β recognizes PDGF-BB and only binds PDGF-BB with high affinity, PDGF-AB with low affinity, and does not bind PDGF-AA. Upon binding to PDGF, the receptor forms a dimer, resulting in several different responses. The cellular effects mediated by the two receptors differ, and the effects of binding are determined by the type of receptor. As a key member of the PDGF / VEGF family of growth factors, it plays a crucial role in cell signaling and tissue development.

[0003] As part of this family of growth factors, PDGF-BB likely shares conserved structural and functional features with related proteins, contributing to cell growth, angiogenesis, and vascular development. Its membership in the PDGF / VEGF family of growth factors highlights its importance in orchestrating essential physiological processes required for tissue homeostasis. Research on PDGF-BB has provided insights into its specific functions within the context of the growth factor family, offering potential applications in therapeutic interventions and a deeper understanding of its broader impact on cellular processes involved in vascular development and maintenance. Further exploration of the role of PDGF-BB is expected to enhance our understanding of its contributions to normal physiological and pathological conditions. Currently, PDGF-BB is produced by expressing it in Escherichia coli followed by reverse-phase purification to separate monomers and dimers. Reverse-phase purification columns are expensive, and the purification process requires the use of organic solvents, which are costly and hazardous chemicals. This can easily lead to environmental pollution and experimental accidents during development, posing safety risks. The production process provided by the present invention is safe, simple, and highly specific, making it more suitable for large-scale production and reducing costs. Summary of the Invention

[0004] The purpose of the present invention is: to address the deficiencies of the existing technology, the present invention aims to provide a method for preparing platelet-derived growth factor BB.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides a method for preparing platelet-derived growth factor BB, comprising the following steps:

[0007] Step 1) The gene encoding platelet-derived growth factor BB is cloned and implanted into the prokaryotic expression vector pET 28a(+) to construct a recombinant prokaryotic expression vector;

[0008] Step 2) Transforming the recombinant prokaryotic expression vector constructed in step 1 into the prokaryotic host cell Escherichia coli BL21-CodonPlus-RIPL;

[0009] Step 3) culturing the prokaryotic host cells of step 2 to express an insoluble fusion protein containing platelet-derived growth factor BB;

[0010] Step 4) Affinity chromatography is used to purify and separate the fusion protein containing platelet-derived growth factor BB. After renaturation, the dimeric active protein is separated by ion exchange.

[0011] Preferably, the gene encoding platelet-derived growth factor BB in step 1) is as shown in SEQ ID NO: 1.

[0012] Preferably, the step 4) specifically includes the following steps:

[0013] Step 4.1) Centrifuging and separating the bacterial cells in the fermentation broth, disrupting the cells, centrifuging, and dissolving the inclusion body precipitate;

[0014] Step 4.2) The platelet-derived growth factor-BB fusion protein was initially isolated from the dissolved supernatant protein using affinity chromatography;

[0015] Step 4.3) refolding the isolated platelet-derived growth factor-BB fusion protein;

[0016] Step 4.4) separating the platelet-derived growth factor monomer and dimer using an ion exchange method, and harvesting the dimer protein;

[0017] Step 4.5) Buffer system replacement to obtain active dimeric protein.

[0018] Preferably, the filler used in the affinity chromatography in step 4.2) is Ni-TED, and the eluent is imidazole solution.

[0019] Preferably, the step 4.4) comprises: concentrating the protein collected in step 4.3) and performing dialyzing for fluid exchange, and then passing the protein through an ion exchange column for gradient elution.

[0020] Preferably, the elution gradient reaches 60 column volumes.

[0021] Preferably, the ion exchange column is an SP Sepharose FF ion exchange column.

[0022] Preferably, the buffer system in step 4.5) is a 4 mM HCl aqueous solution.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention uses affinity chromatography and ion exchange methods for purification. The purity of the target protein after purification by this purification method can reach more than 98%. Compared with the previous reverse purification method, it not only reduces the purification steps and avoids cumbersome experiments, but also increases the protein recovery rate in the process. Since the reverse purification column is expensive, this method reduces cost expenditure during the development process. Therefore, this method has the advantages of simple purification steps and saving development costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the pET-28a vector map, gene sequence, and protein sequence;

[0026] Figure 2 This is the SDS-PAGE electrophoresis analysis of the protein in the prokaryotic expression system; where M: Marker standard; 1: supernatant sample after ultrasonic disruption; 2: precipitate sample after ultrasonic disruption;

[0027] Figure 3 Ni affinity chromatography SDS-PAGE electrophoresis analysis; where M: Marker standard; 1: 20mM Tris, 500mM NaCl, 8M UREA, pH8.0 + 500mM imidazole elution sample; 2: 20mM Tris, 500mM NaCl, 8M UREA, pH8.0 + 250mM imidazole elution sample; 3: 20mM Tris, 500mM NaCl, 8M UREA, pH8.0 + 100mM imidazole elution sample; 4: 20mM Tris, 500mM NaCl, 8M UREA, pH8.0 + 50mM imidazole-2 elution sample; 5: 20mM Tris, 500mM NaCl, 8M UREA, pH8.0 + 50mM imidazole-1 elution sample; 6: 20mM Tris, 500mM NaCl, 8M UREA, pH 8.0 + 10 mM imidazole elution sample; 7: Ni column chromatography flow-through sample; 8: supernatant sample after inclusion body solubilization;

[0028] Figure 4 Ion exchange chromatography SDS-PAGE electrophoresis analysis; where M: Marker standard; 1: Protein sample in reduced state; 2: Protein sample in non-reduced state; 3-4: SP purification flow-through samples; 5-14: Samples eluted under low salt gradient; 15-27: With increasing salt ions, the protein collected by gradient elution is sampled and run on the gel. Under high salt elution conditions, monomers and dimers can be clearly separated (all SDS-PAGE samples in this series are non-reduced protein samples).

[0029] Figure 5 The reduced and non-reduced SDS-PAGE images of the purified protein; M: Marker standard; R: reduced state gel image; N: non-reduced state gel image (protein is completely dimer under non-reducing conditions);

[0030] Figure 6 This is a graph showing the activity detection of platelet-derived growth factor BB dimer protein. DETAILED DESCRIPTION

[0031] To make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0032] In the examples of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the examples of the present invention, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0033] Example

[0034] A method for preparing platelet-derived growth factor BB comprises the following steps:

[0035] Transformation: The gene encoding platelet-derived growth factor BB (gene sequence: ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGAGCCTGGGCAGCCTGACCATTGCGGAACCGGCGATGATTGCGGAATGCAAAACCCGCACCGAAGTGTTTGAAATTAGCCGCCGCCTGATTGATCGCACCAACGCGAACTTTCTGGTGTGGCCGCCGTGCGTGGAAGTGCAGCGCTGCAGCGGCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCGACCCAAGTGCAGCTGCGCCCGGTGCAAGTGCGCAAAATTGAAATTGTGCGCAAAAAACCGATTTTTAAAAAAGCGACCGTGACCCTGGAAGATCATCTGGCGTGCAAATGCGAAACCGTGGCGGCCGCGCGCCCGGTGACCTAA (SEQ The pET28a gene was cloned and inserted into the prokaryotic expression vector pET28a (+). The vector map is shown in Figure 2. Figure 1 As shown, a recombinant prokaryotic expression vector was constructed; the constructed recombinant prokaryotic expression vector was transformed into the expression host BL21-CodonPlus-RIPL competent cells;

[0036] 2) E. coli expression: Use ZY medium for autoinduction expression under the following conditions: 37°C, 220 rpm, 6 h; 27°C, 200 rpm, 1 h; 16°C, 180 rpm, 24 h. Figure 2 For SDS-PAGE electrophoresis analysis of proteins in prokaryotic expression system;

[0037] 3) Purification:

[0038] A) Bacteria were disrupted using 20 mM Tris, 500 mM NaCl, 5 mM EDTA, 10 mM DTT, 1% Trition-100, 0.1% 114, pH 8.0. This buffer was used for bacterial disruption and the bacteria were disrupted by ultrasound.

[0039] B) Inclusion body washing: Buffer A: 20 mM Tris, 500 mM NaCl, 5 mM EDTA, 10 mM DTT, 1% Trition-100, 0.1% 114, pH 8.0; Buffer B: 20 ​​mM Tris, 500 mM NaCl, 5 mM EDTA, 10 mM DTT, pH 8.0; and Buffer C: 20 mM Tris, 500 mM NaCl, 10 mM DTT, pH 8.0. Inclusion bodies were washed sequentially with the three buffers.

[0040] C) Inclusion body solubilization: 20 mM Tris, 500 mM NaCl, 10 mM DTT, 8 M UREA, 5 mM imidazole, pH 8.0. This buffer is used to solubilize inclusion bodies. Solubilize overnight at 4°C.

[0041] D) Ni affinity chromatography: A tolerant filler (Ni TED, purchased from Newlon) was used for affinity purification. The target protein was eluted using a gradient of imidazole (20 mM Tris, 500 mM NaCl, 8 M UREA, pH 8.0 + 10 / 50 / 100 / 200 / 500 mM imidazole gradient elution). The specific elution process and conditions are as follows:

[0042] 1) Column equilibration, equilibration buffer: 20 mM Tris, 500 mM NaCl, 8 M UREA, pH 8.0; equilibration volume: 60 ml;

[0043] 2) Sample loading: Sample (cell disruption supernatant / cell disruption pellet / eukaryotic cell supernatant): cell disruption pellet; Sample volume: 250 ml; Number of loadings: 2;

[0044] 3) Triton 114 elution: 60 ml

[0045] 4) Impurity removal, impurity removal buffer: 20mM Tris, 500mM NaCl, 8M UREA, pH 8.0; impurity removal volume: 50ml

[0046] 5) Elution, elution buffer: 20 mM Tris, 500 mM NaCl, 8 M UREA, pH 8.0 + 10 / 50 / 100 / 200 / 500 mM imidazole gradient elution, collect the eluate;

[0047] 6) Run the gel to verify and collect the target protein; the verification results are as follows Figure 3 As shown;

[0048] E) Renaturation: The collected target protein was renatured in PBS, pH 7.4, 1 mM EDTA, 2 mM GSH, 1 mM GSSG, 0.5 M Arginine. The renaturation method used was dilution renaturation with a volume ratio of 1:10.

[0049] F) IEX ion exchange: Buffer A: 20 mM Tris, pH 8.0; Buffer B: 20 ​​mM Tris, 0-500 mM NaCl, pH 8.0; a 60 column volume elution gradient was set in this step, and the sample volume was 330 mL; the salt concentration at equilibrium was set to 0% buffer A, the equilibrium volume was 20 column volumes (one column volume was 5 ml), and the salt concentration during elution was set to 0-100% buffer B (100% buffer B means containing 500 mM NaCl, and so on, 10% buffer B contains 50 mM NaCl), and the elution volume was 60 column volumes (60 CV elution is an improved elution method, the conventional elution is 30 CV elution). Platelet-derived growth factor BB dimer can be completely eluted, as shown in FIG. Figure 4 The purpose of this step is to separate the platelet-derived growth factor BB monomer and platelet-derived growth factor BB dimer (the ion column used is SP Sepharose FF, purchased from Cytiva); the protein sample collected by gradient elution is run on the gel. Under high salt elution conditions, the monomer and dimer can be clearly separated (this series of SDS-PAGE samples are all non-reduced protein samples), as shown in the figure. Figure 4 As shown;

[0050] G) Medium exchange: The platelet-derived growth factor BB dimer protein collected by the ion column is dialyzed into 4 mM HCl to collect the protein, test its purity, and then aliquot and measure its activity;

[0051] 4) Purity test: Prepare two SDS-PAGE loading samples, one for reducing and one for non-reducing, and draw 3 μg of sample for verification. Use Image Lab software to test the purity. The test results show that the purity is ≥98%. Figure 5 shown.

[0052] 5) Activity detection:

[0053] A) Prepare a Balb / 3T3 cell suspension in DMEM + 10% FBS medium, seed 5000 cells / well in a 96-well plate at a volume of 50 μL per well;

[0054] B) Recombinant PDGF BB protein was diluted with DMEM + 5% FBS, starting from 2 μg / mL and diluted five-fold in 9 concentration gradients, with three replicate wells set for each concentration;

[0055] C) After culturing the cells in the 96-well plate for 24 hours, the supernatant was removed from the 96-well cell culture plate, and the protein diluted with culture medium was added to the 96-well cell culture plate at a rate of 100 μL / well, and the cells were cultured for another 48 hours;

[0056] D) After the incubation time is reached, add 10 μL of CCK8 solution to each well and incubate in a 37°C, 5% CO2 incubator for 3-4 hours in the dark.

[0057] E) OD values ​​were measured using a microplate reader at dual wavelengths of OD450-630.

[0058] Activity test results: The biological activity of platelet-derived growth factor BB protein was determined by stimulating the proliferation of 3T3 mouse fibroblasts. The ED50 value was 6.8 ng / mL. Figure 6 shown.

[0059] The above description is only a preferred embodiment of the present invention and does not constitute any formal or substantial limitation to the present invention. It should be noted that ordinary technicians in this technical field can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. A method for preparing platelet-derived growth factor BB, characterized in that: Includes the following steps Step 1) cloning the coding gene of platelet-derived growth factor BB into the prokaryotic expression vector pET28a(+) to construct a recombinant prokaryotic expression vector; Step 2) Transforming the recombinant prokaryotic expression vector constructed in step 1 into the prokaryotic host cell Escherichia coli BL21-CodonPlus-RIPL; Step 3) culturing the prokaryotic host cells of step 2 to express an insoluble fusion protein containing platelet-derived growth factor BB; 4) Step 4) Affinity chromatography is used to purify and separate the fusion protein containing platelet-derived growth factor BB. After renaturation, the dimeric active protein is separated by ion exchange.

2. The preparation method according to claim 1, wherein The gene encoding platelet-derived growth factor BB in step 1) is shown in SEQ ID NO:

1.

3. The preparation method according to claim 1, wherein The step 4) specifically comprises the following steps: Step 4.1) Centrifuging and separating the bacterial cells in the fermentation broth, disrupting the cells, centrifuging, and dissolving the inclusion body precipitate; Step 4.2) The platelet-derived growth factor-BB fusion protein was initially isolated from the dissolved supernatant protein using affinity chromatography; Step 4.3) refolding the isolated platelet-derived growth factor-BB fusion protein; Step 4.4) separating the platelet-derived growth factor monomer and dimer using an ion exchange method, and harvesting the dimer protein; Step 4.5) Buffer system replacement to obtain active dimeric protein.

4. The preparation method according to claim 3, wherein The filler used in the affinity chromatography in step 4.2) is Ni-TED, and the eluent is imidazole solution.

5. The preparation method according to claim 3, wherein in, The step 4.4) is as follows: the protein collected in step 4.3) is concentrated, dialyzed and then passed through an ion exchange column for gradient elution.

6. The preparation method according to claim 5, wherein The ion exchange column is an SP Sepharose FF ion exchange column.

Images