SgRNA targeting METTL1 and application of sgRNA

Abstract

The invention discloses sgRNA (small guide ribonucleic acid) targeting METTL1 and application of the sgRNA, relates to the technical field of biology, and particularly provides two sgRNA sequences, namely, sgRNA-001 (5 '-CAAGTGGAGTTTGCAGACAT-3') and sgRNA-002 (5 '-ATAAGCGGAGCAAAGAACT-3'), and a targeting region of the sgRNA sequences is designed to be combined with an NGG PAM sequence of an METTL1 gene, so that accurate editing of a CRISPR / Cas9 system is ensured. By constructing a recombinant lentiviral vector GV708 containing a U6 promoter, Cas9-FLAG, EGFP (Enhanced Green Fluorescent Protein) and a puromycin resistance gene, efficient delivery and stable expression of sgRNA are realized. Experiments show that the sgRNA can effectively silence METTL1 expression, significantly reduce malignant phenotypes of colon cancer cells by inhibiting m7G modified and mediated tumor-related gene stability and signal pathways, and induce enrichment of CD8 + T cells in a tumor microenvironment to generate a synergistic anti-tumor effect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to an sgRNA targeting METTL1 and applications thereof. Background Art

[0002] Colon cancer is one of the most common malignant tumors. At the time of first diagnosis, approximately 25% of colon cancer patients have metastasis, and the mortality rate due to liver metastasis has now reached more than 80%. Although there are various treatment measures to improve patient prognosis, there is a lack of relatively effective therapeutic targets. M7G modification is one of the more common modifications that occur in RNA such as tRNA, mRNA, and miRNA. In recent years, researchers have used the m7G sequencing method with single-base precision to find that there are also abundant m7G ​​modifications inside mRNA (5'UTR, coding sequence, 3'UTR, and AG-rich regions). The presence of this modification can participate in the physiological and pathological activities of the human body by affecting the stability and translation of mRNA. Studies have confirmed that m7G ​​modification is involved in the occurrence and development mechanism of tumors.

[0003] As a catalytic molecule for m7G modification, METTL1 plays a crucial role in various tumor progression and tumor immunity, influencing multiple regulatory mechanisms, including methylation levels, tumor-related gene stability, and cancer cell signaling pathways. This patent designs sgRNA targeting METTL1, exploring new strategies for inhibiting tumor progression by targeting METTL1.

[0004] Therefore, it is necessary to propose a sgRNA targeting METTL1 and its application to solve the above problems. Summary of the Invention

[0005] The purpose of the present invention is to solve the problem in the prior art of lacking relatively effective targets for colon cancer treatment.

[0006] In order to achieve the above-mentioned purpose, the present invention specifically adopts the following technical solutions:

[0007] An sgRNA targeting METTL1, wherein the nucleotide sequence of the sgRNA is:

[0008] sgRNA-001: 5'-CAAGTGGAGTTTGCAGACAT-3';

[0009] sgRNA-002: 5'-ATAAGCGGAGCAAAGAACTC-3'.

[0010] Furthermore, the targeting region of the sgRNA is designed to be complementary to the METTL1 gene site containing the NGG PAM sequence to ensure specific cutting by the Cas9 protein.

[0011] A recombinant lentiviral vector comprising the above-mentioned sgRNA targeting METTL1, wherein the vector is GV708 and comprises a U6 promoter-driven sgRNA expression cassette.

[0012] Furthermore, the vector also contains Cas9-FLAG, EGFP and puromycin resistance genes.

[0013] A host cell, wherein the recombinant lentiviral vector is integrated into the host cell.

[0014] Application of an sgRNA targeting METTL1 in the preparation of anti-tumor drugs.

[0015] Furthermore, the tumor is colon cancer.

[0016] Furthermore, the drug exerts its effect by inhibiting METTL1 expression and promoting CD8+ T cell infiltration.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The present invention uses a lentiviral delivery system (GV708 vector) to efficiently silence the METTL1 gene, disrupting tumor signaling pathways dependent on m7G modification (such as methylation regulation and oncogene stability), and inhibiting the size of colon cancer tumors.

[0019] 2. This invention reveals for the first time that targeting METTL1 can enhance anti-tumor immune response by promoting CD8+ T cell tumor infiltration. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the lentiviral vector of the present invention.

[0021] Figure 2 The sgMETTL1 lentivirus of the present invention was successfully transfected into the CT26 cell line (MOI=25).

[0022] Figure 3 The sgMETTL1 lentivirus of the present invention was successfully transfected into the MC38 cell line (MOI=100).

[0023] Figure 4 The sgMETTL1 lentivirus of the present invention successfully knocked out METTL1 in the CT26 cell line (M0I=25).

[0024] Figure 5 The sgMETTL1 lentivirus of the present invention successfully knocked out METTL1 in the MC38 cell line (MOI=100).

[0025] Figure 6 The present invention showed that knocking out METTL1 significantly inhibited tumor size.

[0026] Figure 7 The present invention shows that knocking out METTL1 significantly increases CD8+ T cell infiltration (DAPI: blue; CD8+ T cell: red). DETAILED DESCRIPTION

[0027] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0028] See also Figures 1 to 7 , a sgRNA targeting METTL1 and its application,

[0029] Gene Information:

[0030] Target gene name species Gene ID Mettl1 Mouse 17299

[0031] The target sequence was determined for the mRNA of the mouse Mettl1 gene (gene ID: 17299); based on the mRNA sequence of the mouse Mettl1 gene:

[0032]

[0033] A total of two target sequences were designed, and the two target sequences are as follows (Table 1)

[0034] Table 1 sgRNA sequences

[0035] Tag Name sgRNA sequence sgMETTL1-001 CAAGTGGAGTTTGCAGACAT sgMETTL1-002 ATAAGCGGAGCAAAGAACTC

[0036] In addition, the control sequences are as follows (Table 2)

[0037] Table 2 sgNC sequences

[0038] Tag Name sgRNA sequence (5'-3') sgN CGCTTCCGCGGCCCGTTCAA

[0039] 2. Lentiviral vector information (vector map such as Figure 1 ):

[0040] 2.1 Vector Name: GV708

[0041] 2.2 Element sequence: U6-sgRNA-EF1a-Cas9-FLAG-CMV-EGFP-P2A-puro

[0042] 2.3 Cloning site: BsmBI.

[0043] The vector was digested with enzymes (Table 3)

[0044] Table 3 Vector enzyme digestion reaction system

[0045]

[0046] 2.4 Clone Construction Information: Design and synthesize single-stranded primers based on the target sequence (Table 4). Dissolve the synthesized primer pairs in annealing buffer, incubate at 90°C in a water bath for 15 minutes, and cool to room temperature to form double-stranded DNA. Ligate the double-digested, linearized vector and the annealed double-stranded DNA using T4 DNA ligase (Table 5) at 16°C for 1-3 hours, or overnight.

[0047] Table 4 SgRNA primers

[0048]

[0049]

[0050] Table 5 Reaction system

[0051]

[0052] Add 10 μL of the exchange reaction product to 100 μL of competent cells, gently tap the tube several times to mix, and place on ice for 30 minutes. Heat shock the tube at 42°C for 90 seconds, then incubate in an ice-water bath for 2 minutes. Add 500 μL of LB medium and incubate on a shaker at 37°C for 1 hour. Spread an appropriate amount of the bacterial solution evenly on a plate containing the corresponding antibiotic and incubate in an incubator for 12-16 hours. Randomly select 5 clones and inoculate them in an appropriate amount of LB liquid medium containing the corresponding antibiotic. Incubate at 37°C for 12-16 hours, then remove an appropriate amount of the bacterial solution for sequencing. Compare the sequencing results with the target gene sequence. The sequencing results are as follows.

[0053] 3. Lentiviral plasmid sequencing (sequencing results)

[0054]

[0055]

[0056] sgMETTL1-002 CACCGATAAGCGGAGCAAAGAACTC

[0057] HEK293T cells were used as packaging cells. After trypsinization, they were seeded into 10cm culture dishes and the experiment was performed 48 hours later. DNA solution was prepared: 20μg of GV / CV vector plasmid, 15μg of pHelper 1.0 vector plasmid, and 10μg of pHelper 2.0 vector plasmid. The total volume of the transfection system was adjusted to 1mL and incubated at room temperature for 15 minutes. After adding the DNA solution to the cells and culturing for 6-8 hours, fresh medium was replaced. After culturing for 48 hours, the supernatant was collected and the virus solution was concentrated by ultracentrifugation. After obtaining the virus titer, the target cells were transfected:

[0058] Comparison result description: the test is OK.

[0059] Virus titer test results:

[0060] Tag Name Titer (TU / mL) LV-METTL1-sgRNA-001 7.00E+08 LV-METTL1-sgRNA-002 1.00E+09

[0061] 4. Construction of Stable Knockout Cell Lines

[0062] Mouse colon cancer cells MC38 and CT26 were used as target cells for lentiviral infection (MC38-MOI=100; CT26-MOI=25), and GFP+ positive cells were detected using a fluorescence microscope ( Figure 1 、 2 ), Western blot experiments were used to detect the knockout of METTL1 (anti-METTL1, Wuhan Tri-Tac, Cat No. 14994-1-AP) in target cells ( Figure 4 、 Figure 5 )

[0063] 4.1 Target cells: Mouse colon cancer cells MC38 and CT26.

[0064] 4.2 Transfection MOI value:

[0065] a) MC38 - MOI=100.

[0066] b) CT26-MOI=25.

[0067] 4.3 Detection methods:

[0068] a) Fluorescence detection of GFP-positive cells.

[0069] b)Western blot.

[0070] 4.4 Experimental results:

[0071] a) Fluorescence detection of GFP-positive cells (indicating successful infection) Figure 2 、 Figure 3 ).

[0072] b) sgMETTL1 lentivirus successfully knocked out METTL1 in CT26 and MC38 cell lines ( Figure 4 、 Figure 5 ).

[0073] 5. Knockout of METTL1 inhibits tumor size and improves anti-tumor effects

[0074] 5.1 Target animals: C57BL / 6 mice, 6-week-old males.

[0075] 5.2 Grouping: sgNC, sgMETTL1-001, sgMETTL1-002, 3 mice in each group.

[0076] 5.3 Experimental Results

[0077] a) Knockout of METTL1 significantly inhibited tumor size ( Figure 6 ).

[0078] b) Knockout of METTL1 significantly increased the infiltration of CD8+ T cells ( Figure 7 ).

[0079] In addition, sgRNA targeting METTL1 can also be used to prepare anti-tumor drugs, such as colon cancer, which work by inhibiting METTL1 expression and promoting CD8+ T cell infiltration.

[0080] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. The scope of patent protection of the present invention shall be based on the claims. Any equivalent structural changes made using the description and drawings of the present invention should also be included in the scope of protection of the present invention.

Claims

1. A sgRNA targeting METTL1, characterized by: The nucleotide sequence of the sgRNA is: sgRNA-001: 5'-CAAGTGGAGTTTGCAGACAT-3'; sgRNA-002: 5'-ATAAGCGGAGCAAAGAACTC-3'.

2. The sgRNA targeting METTL1 according to claim 1, characterized in that The targeting region of the sgRNA was designed to be complementary to the METTL1 gene site containing the NGG PAM sequence.

3. A recombinant lentiviral vector comprising the sgRNA targeting METTL1 according to claim 1, characterized in that The vector is GV708, which contains a sgRNA expression cassette driven by the U6 promoter.

4. The recombinant lentiviral vector according to claim 3, characterized in that The vector also contains Cas9-FLAG, EGFP and puromycin resistance genes.

5. A host cell, characterized in that The host cell is integrated with the recombinant lentiviral vector according to claim 3 or 4.

6. Use of the sgRNA targeting METTL1 according to claim 1 in the preparation of anti-tumor drugs.

7. The use according to claim 6, characterized in that The tumor is colon cancer.

8. The use according to claim 6, characterized in that The drug works by inhibiting METTL1 expression and promoting CD8+ T cell infiltration.

Images