Application of SlCYP90B3 gene in regulation and control of tomato fruit color

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a tomato SlCYP90B3 gene in regulation and control of tomato fruit color, and the nucleotide sequence of the SlCYP90B3 gene is shown as SEQ ID No: 1. According to the invention, the tomato SlCYP90B3 gene is silenced, so that the tomato with higher flavonoid content and richer color is cultivated. The transgenic tomato obtained by the method disclosed by the invention can improve the content of flavonoids in the tomato peel so as to influence the color of the tomato.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of a tomato S1CYP90B3 gene in regulating tomato fruit color. Background Art

[0002] Tomato (Solanum lycopersicum) is one of the world's most important horticultural crops and a model plant for fruit research. Tomato fruit colors range from green to yellow, red to pink, and purple. This diversity in tomato fruit color is primarily attributed to the accumulation of carotenoids in the flesh and flavonoids in the peel. Tomato peel color is primarily yellow or colorless, depending on the content of naringenin chalcone (NarCh) in the peel. The ripening process can be divided into four stages based on the developmental stage of the tomato fruit: Mature Green (MG), Breaker (B), Breaker+3 (P), and Red Ripening (R). As the fruit matures, chlorophyll gradually degrades, while carotenoids and flavonoids accumulate, changing their content and ratio, resulting in different fruit colors at different stages.

[0003] Tomato peel is the primary source of flavonoids, as flavonoid biosynthesis genes are not expressed in the flesh. During tomato fruit ripening, flavonoid biosynthesis structural genes such as CHS1, CHS2, and F3'H begin to express during the color-breaking stage, gradually accumulating flavonoids, reaching their peak concentration during the red ripening stage. Naringenin chalcone is crucial for tomato color. High levels of naringenin chalcone result in a yellow peel, while low levels result in a colorless peel. The yellow peel of red-fleshed tomatoes is due to the accumulation of flavonoids in the peel.

[0004] Flavonoids are a class of polyphenolic compounds produced by plant secondary metabolism and are widely found in food crops such as fruits and vegetables. Flavonoid biosynthesis in plants is regulated by a series of transcription factors. The accumulation of flavonoids on the surface of tomato fruit is primarily controlled by a transcriptional network regulated by SlMYB12, which plays a key role in regulating the production of NarCh in tomato fruit. Genetic knockout of SlMYB12 disrupts NarCh accumulation, resulting in a colorless fruit skin and ultimately a pink fruit appearance.

[0005] Brassinosteroids (BR) are important growth hormones in plants, playing crucial roles in plant growth, vascular differentiation, fruit development, and environmental adaptability. In the BR biosynthesis pathway, DWF4, a member of the cytochrome P450 superfamily, encodes the upstream C-22 hydroxylase. In tomato, the fruit-specific SlCYP90B3 (Solyc02g085360) gene is a key rate-limiting enzyme in the BR biosynthesis pathway. Its nucleotide sequence has been published as SlCYP90B3 (Solyc02g085360) in the Introduction of the paper doi:10.1038 / s41438-020-00383-0.

[0006] The invention of CN110894502A "Tomato SlCYP90B3 gene and its application" states that the gene SlCYP90B3 can improve the resistance of tomato fruit to cold damage.

[0007] It should be noted that the resistance of tomato fruit to cold damage has no correlation with tomato fruit color. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a new use of the S1CYP90B3 gene - regulating the formation of tomato fruit color.

[0009] In order to solve the above technical problems, the present invention provides the use of the SlCYP90B3 gene in regulating tomato fruit color. The nucleotide sequence of the SlCYP90B3 gene is shown in SEQ ID No: 1.

[0010] As an improvement of the application of the present invention: the flavonoids in tomato peel are regulated; the flavonoids are naringenin chalcone.

[0011] Note: In the present invention, the content of naringenin chalcone is used to characterize the flavonoid content. In the tomato variety Ailsa Craig (AC), naringenin chalcone is the dominant flavonoid component.

[0012] As an improvement of the application of the present invention: S1CYP90B3 negatively regulates the biosynthesis of flavonoids in tomato peel, and S1CYP90B3 gene silencing promotes the accumulation of flavonoids in tomato peel.

[0013] As a further improvement of the application of the present invention: S1CYP90B3 affects tomato fruit color, the hue angle is significantly reduced when the S1CYP90B3 gene is overexpressed, and the hue angle is significantly increased when the S1CYP90B3 gene is silenced.

[0014] Description: Naringenin chalcone is yellow. The higher the naringenin chalcone content, the darker the yellow. Hue angle is also an indicator of color: the yellower the tomato, the larger the hue angle; the redder the tomato, the smaller the hue angle.

[0015] The present invention also provides a method for regulating tomato fruit color using the S1CYP90B3 gene. By silencing the tomato S1CYP90B3 gene, tomatoes with higher flavonoid content and richer color are cultivated.

[0016] In the present invention, the protein encoded by gene S1CYP90B3 has the amino acid sequence shown in SEQ ID NO: 2.

[0017] Transgenic tomatoes produced using the method of the present invention can improve the flavonoid content in tomato peels, thereby affecting tomato color. Flavonoid content measurements revealed that the S1CYP90B3 gene negatively regulates flavonoid biosynthesis in tomato peels. By silencing the S1CYP90B3 gene in tomatoes, it is possible to cultivate tomato materials with higher flavonoid content and richer color, which has promising applications in improving the sensory and nutritional quality of tomatoes.

[0018] It should be noted that the SlCYP90B3 gene (Solyc02g085360) is a rate-limiting enzyme in BR biosynthesis. The mechanism by which BR biosynthesis genes regulate tomato flavonoid biosynthesis is currently unknown. Therefore, those skilled in the art are unaware of the relationship between SlCYP90B3 (Solyc02g085360) and flavonoids. Consequently, the role of SlCYP90B3 in regulating tomato flavonoid biosynthesis has not been reported to date. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The specific embodiments of the present invention are further described in detail below with reference to the accompanying drawings.

[0020] Figure 1 The naringenin chalcone content in the peel of SlCYP90B3 gene overexpression and gene silenced strains and wild-type tomato.

[0021] Figure 2 It is the expression level of the flavonoid regulatory gene SlMYB12 in the peel of SlCYP90B3 gene overexpression and gene silencing strains and wild-type tomato.

[0022] Figure 3 It is the expression level of flavonoid structural genes SlCHS1, SlCHS2, and SlF3'H in the peel of SlCYP90B3 gene overexpression and gene silencing strains and wild-type tomato.

[0023] Figure 4 The hue angle of the peel of SlCYP90B3 gene overexpression and gene silenced strains and wild type tomato at the red ripening stage. DETAILED DESCRIPTION

[0024] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0025] 1. Obtaining the full-length sequence of the tomato SlCYP90B3 gene:

[0026] Refer to SlCYP90B3 (Solyc02g085360) in the Introduction of the published paper doi:10.1038 / s41438-020-00383-0.

[0027] The nucleotide sequence of the gene S1CYP90B3 is shown in SEQ ID No: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 2.

[0028] 2. Construction of tomato SlCYP90B3 gene overexpression vector:

[0029] The SlCYP90B3 overexpression vector was constructed using pGWB17 as the final vector to construct the pGWB17-SlCYP90B3 vector with a CaMV35S recombinant overexpression promoter. Reference can be made to the published patent: CN110894502B "Tomato SlCYP90B3 gene and its application" pGWB17-35S::SlCYP90B3.

[0030] The details are as follows: Use LR reaction to transfer the target fragment (i.e., the sequence described in SEQ ID No: 1) from the pQB-V3 initial vector to the pGWB17 final vector. II Enzyme mix (ThermoFisher) kit was used, following the instructions in the kit instructions. After the reaction, the pGWB17-SlCYP90B3 plasmid was transformed into competent E. coli DH5α cells. Screening was performed using the spread method, and colony PCR was used to identify recombinant pGWB17 plasmids carrying the target fragment. Sequencing was then performed and confirmed. Sequencing results were analyzed using DNAMAN software. This resulted in the pGWB17-SlCYP90B3 vector harboring the CaMV35S recombinant overexpression promoter.

[0031] 3. Construction of RNAi silencing vector for tomato SlCYP90B3 gene:

[0032] Refer to the transgenic plant construction in the method details in the published paper doi:10.1038 / s41438-020-00383-0.

[0033] Specifically, the RNAi silencing vector, pHANNIBAL, was used as the original vector. Through PCR and enzyme digestion, a CaMV35S promoter-driven SlCYP90B3 hairpin silencing unit was constructed. A 477-bp fragment of the SlCYP90B3 cDNA was selected as the RNAi silencing fragment. Finally, the RNAi-SlCYP90B3 was integrated into the plant binary vector pBIN19 using the shared restriction sites Sac I and Spe I of the original vector pHANNIBAL and the intermediate vector pBIN19, resulting in RNAi-SlCYP90B3.

[0034] The 477 bp fragment used for gene silencing is:

[0035] TTCTAGGTTGGGTTCTGAAGAATTCAAATCTCTCAAAAGAGCAAATTCTTGATTTGCTACTGAGTTTGCTCTTTGCTGGCCATGAAACTTCATCAGTAGCAATAGCTCTGTCTATTTTCTTACTCGAAAGCTGTCCTGCTGCTGTTCAACAATTAACAGAAGAGCACTTGGAGATTTCCCGGGCAAAAAAACAGTCAGGAGAAACAGAATTAAATTGGGATGACTACAAGAAAATGGA ATTCACCCAATGTGTTATTAATGAGACTCTAAGACTTGGGAATGTAGTGAGGTTTCTGCACAGGAAAGCTGTGAAAGATGTTCGATATAAAGGTTATGATATTCCATGTGGATGGAAAGTGTTGCCGGTGATTTCAGCAGCGCATTTAGATCCTTCACTTTTCGACCGACCTCACGACTTTGATCCTTGGAGATGGCAGAACGCAGAAGAGTCGCCTTCAGGTAAAGGAGGAAGCACAG

[0036] 4. Study on flavonoid content in transgenic tomato peel

[0037] Ailsa Craig (AC) tomato was used as the wild-type, designated WT. Agrobacterium tumefaciens strain LBA4404 was transformed with either the pGWB17-SlCYP90B3 vector or the RNAi-SlCYP90B3 plasmid. Tomato cotyledons were infected. Tissue culture seedlings were obtained through callus induction, resistance differentiation, and rooting. Transgenic plants were verified by PCR and RT-PCR. T2 seeds were sown on a medium containing kanamycin (50 mg / L) and germinated to generate transgenic lines overexpressing SlCYP90B3.

[0038] Note: Seeds that meet the separation ratio of lateral roots to non-lateral roots on a kanamycin (50 mg / L) medium of 3:1 and whose gene expression level increases by more than twofold are considered overexpressed, while genes that decrease by more than onefold are considered gene silenced. Two overexpression lines with high gene transcription levels, 90-OE-4 and 90-OE-5, and two gene silenced lines with low gene transcription levels, 90-RNAi-9 and 90-RNAi-10, were selected as research subjects.

[0039] Wild-type and SlCYP90B3 transgenic lines were grown in the same greenhouse at the Huajiachi Vegetable Base, Zhejiang University. Fruit reached the green ripening stage (MG) 35 days after anthesis marking. Three days after the green ripening stage, the fruit tips turned red, marking the break color stage (B), and seven days after the break color stage, marking the red ripening stage (B+7). Whole fruit peel samples were collected from the SlCYP90B3-overexpressing transgenic line SlCYP90B3-OE, the gene-silenced line SlCYP90B3-RNAi, and wild-type tomato WT fruits when they reached the red ripening stage.

[0040] After grinding the peel sample with liquid nitrogen, approximately 1 g of the powder was extracted with 3 ml of 50% methanol. Ultrasonic extraction was performed for 30 minutes (power supply voltage 220 V, operating frequency 53 kHz, power consumption 350 W, temperature 4°C). The sample was centrifuged at 12,000 rpm for 15 minutes. The supernatant was filtered through a 0.22 μm nylon membrane filter and analyzed by HPLC. Flavonoids were analyzed on a Shimadzu HPLC instrument using an SPD-M20A diode array detector and a C18 column (5 μm particle size, 4.6 mm x 250 mm, Elite Analytical Instruments Co., Ltd., Dalian, China). The mobile phases were (A) water and (B) acetonitrile, and gradient elution was performed as follows: Solution B 80%-80% (5 min), Solution B 80%-55% (15 min), Solution B 55%-55% (6 min), Solution B 55%B to 0% (4 min), Solution B 0%-0% (5 min), Solution B 0%-80% (1 min), Solution B 80%-80% (9 min). The flow rate was 1.0 mL / min, the column temperature was 25°C, and the detection wavelength was 370 nm. The content was calculated using the external standard method using a naringenin chalcone standard (Sigma, St Louis, MO, USA). The results are expressed in μg g -1 The unit is FW (fresh weight).

[0041] The naringenin chalcone content in the peel of tomato of SlCYP90B3 gene overexpression and gene silenced lines and wild type Figure 1 The results showed that the naringenin chalcone content in the S1CYP90B3 gene overexpression line was significantly lower than that in the wild type, while the naringenin chalcone content in the S1CYP90B3 gene silenced line was significantly higher than that in the wild type. This indicates that S1CYP90B3 gene silencing promotes the accumulation of flavonoids in tomato peel.

[0042] 5. Study on the expression of flavonoid genes in transgenic tomato peel

[0043] The peels of WT, SlCYP90B3-OE, and SlCYP90B3-RNAi fruits were sampled at the color-breaking stage, RNA was extracted, and reverse transcribed into cDNA. The gene expression levels were detected by RT-qPCR.

[0044] The primers corresponding to the flavonoid-regulated gene SlMYB12 were F: AGCTTGTGATAGTGCCATGGAA, R: CTCGAGTCTTGGCCATTCGATA;

[0045] The primers corresponding to the flavonoid structural gene SlCHS1 were F: GGCTTACATTCCACTTACTC, R: GAGAGTTCCAGTCAGATATACC;

[0046] The primers corresponding to the flavonoid structural gene SlCHS2 were F:TTAGCTGAGAACAACAAGGG, R:CCAACCATACTATCCAAATGAG;

[0047] The primers corresponding to the flavonoid structural gene SlF3′H were F: GCTTTAGATGACTTCCGCC, R: GTTCCTCTGATTCTCCAACTC;

[0048] The primers corresponding to the internal reference gene Actin are F:CCTCAGCACATTCCAGCAG, R:CCACCAAACTTCTCCATCCC.

[0049] Real-time fluorescence quantitative PCR was performed using the SYBR Green PCR Master Mix kit, with Actin as the internal reference gene. –ΔΔCT Relative gene expression was calculated using the real-time fluorescence quantitative PCR method. The reaction system consisted of 20 μL of SYBR Green Master Mix, 1 μL of each primer, and 9 μL of a mixture of template DNA and sterile ultrapure water. The reaction procedure was 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec.

[0050] The results are as follows Figure 2 and Figure 3 As stated. Figure 2 The results showed that the expression level of the flavonoid-regulated gene SlMYB12 was significantly decreased in SlCYP90B3-OE and significantly increased in SlCYP90B3-RNAi. Figure 3 The results showed that the expression levels of flavonoid structural genes SlCHS1, SlCHS2, and SlF3'H were significantly decreased in SlCYP90B3-OE, but significantly increased in SlCYP90B3-RNAi. Figure 2 and Figure 3 The following conclusions can be drawn: SlCYP90B3 can inhibit the accumulation of flavonoids by inhibiting the expression of flavonoid regulatory genes and structural genes.

[0051] Description: SlMYB12 is a regulatory gene of the flavonoid pathway, and SlCHS1, SlCHS2, and SlF3'H are structural genes of the flavonoid pathway, which all play a positive regulatory role in the accumulation of flavonoids.

[0052] 6. Research on the color of genetically modified tomatoes

[0053] Color analysis was performed on WT, SlCYP90B3-OE, and SlCYP90B3-RNAi tomato fruits at the red ripe stage. L, a, and b values ​​were measured using a 3nh spectrophotometer (SN: 41000735). Color change was assessed by changes in hue angle, which indicates color saturation. Hue angle values ​​were calculated using the following formula: Hue angle = tan -1 (b / a)(a>0)or 180+tan -1 (b / a)(a<0).

[0054] The results are as follows Figure 4 According to Figure 4 It can be seen that the hue angle of SlCYP90B3-RNAi increased significantly, and the gene silenced line finally showed an orange phenotype, indicating that SlCYP90B3 gene silencing can improve the color of tomato fruit while increasing the content of flavonoids.

[0055] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples and is subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention are considered to be within the scope of protection of the present invention.

Claims

1. Application of the S1CYP90B3 gene in regulating tomato fruit color, characterized by: The nucleotide sequence of the S1CYP90B3 gene is shown in SEQ ID No:

1.

2. The use according to claim 1, characterized in that: Flavonoids regulating tomato peel.

3. The use according to claim 2, characterized in that: The flavonoid is naringenin chalcone.

4. The use according to any one of claims 1 to 3, characterized in that: SlCYP90B3 negatively regulates the biosynthesis of flavonoids in tomato peel.

5. The use according to claim 4, characterized in that: SlCYP90B3 gene silencing promotes the accumulation of flavonoids in tomato peel.

6. The use according to any one of claims 1 to 5, characterized in that: The SlCYP90B3 gene can affect tomato fruit color.

7. The use according to claim 6, characterized in that: The hue angle was significantly decreased when the SlCYP90B3 gene was overexpressed, and significantly increased when the SlCYP90B3 gene was silenced.

8. A method for regulating tomato fruit color using the SlCYP90B3 gene.

Images