SNP (Single Nucleotide Polymorphism) molecular marker related to brucellosis resistance character of sheep and application of SNP molecular marker

Through whole-genome association analysis and molecular marker-assisted breeding technology, SNP molecular markers related to sheep resistance to brucellosis were screened out, which solved the problem of early diagnosis and breeding of sheep disease resistance traits and achieved efficient breeding and environmental protection.

CN120624684AActive Publication Date: 2025-09-12INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511136670.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-14
Publication Date
2025-09-12
Estimated Expiration
2045-08-14

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively screen and identify molecular markers related to brucellosis resistance in sheep, resulting in difficulties in early diagnosis of the disease and later control, as well as a heavy reliance on the use of antibiotics, which affects environmental and food safety.

Method used

Through whole-genome association analysis, SNP molecular markers related to brucellosis resistance were discovered in the sheep genome, and primer pairs and probes were designed to amplify and detect the molecular markers. Combined with gene chips, molecular marker-assisted breeding was achieved.

Benefits of technology

It has achieved early prediction and efficient breeding of sheep's resistance to brucellosis, reduced dependence on antibiotics, improved breeding efficiency, and protected the environment and food safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624684A_ABST
    Figure CN120624684A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of animal breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to a sheep brucellosis resistance character and application of the SNP molecular marker. The molecular marker comprises nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1, the 101st site of the molecular marker has polymorphism, and the polymorphism is T / C. The invention discloses a molecular marker. The molecular marker is related to the brucellosis resistance character of sheep. The polymorphism detection result of the molecular marker reflects the brucellosis resistant character of the sheep. Therefore, the sheep germplasm resources can be improved based on the correlation between the polymorphism of the molecular marker and the brucellosis resistance character of the sheep, and the molecular marker has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, and in particular to a SNP molecular marker related to sheep brucellosis resistance traits and an application thereof. Background Art

[0002] Brucellosis, caused by bacteria of the genus Brucella, is a typical zoonotic disease. Its clinical manifestations vary widely, primarily encompassing systemic, fluctuating fever and fatigue, as well as significant reproductive system dysfunction, such as testicular and epididymal inflammation in males, and miscarriage or endometritis in females. As a facultative intracellular parasite, Brucella possesses robust immune evasion mechanisms. This biological trait results in an insidious or chronic course of infection, making early diagnosis difficult and control challenging. Brucella melitensis, in particular, exhibits exceptional virulence and infectivity among all strains. As sheep and goats are the primary susceptible hosts to brucellosis, they pose a significant risk to humans, posing a significant threat and economic loss to the sheep industry.

[0003] Single nucleotide polymorphisms (SNPs) are genetic markers caused by variations in a single nucleotide in the genome and are the most common form of genetic variation. These variations can be further categorized as transitions between purines (A / G) or pyrimidines (C / T), as well as transversions between purines and pyrimidines. In modern livestock genetic improvement practices, SNPs have been widely used in genomic analysis as highly effective molecular markers. Using SNP markers, they can accurately identify and differentiate the genotypes of individual animals, providing a powerful tool for understanding the genetic basis of key economic traits such as disease resistance and production efficiency.

[0004] Therefore, screening and identifying molecular markers associated with brucellosis resistance in sheep and applying them to marker-assisted breeding could potentially disrupt the disease's transmission chain at the source. This is a practical manifestation of the strategic concept of "preventing human and animal diseases and controlling the source." Furthermore, the implementation of this strategy can effectively reduce reliance on antibiotics, thereby alleviating environmental pollution and drug residue issues in food safety caused by excessive antibiotic use. In summary, research on the discovery of molecular markers for brucellosis resistance in sheep has significant theoretical value and urgent practical needs. Summary of the Invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a SNP molecular marker related to the brucellosis resistance trait of sheep and application thereof.

[0006] The present invention conducted a whole-genome association analysis on the brucellosis resistance traits of different breeds of sheep, and obtained SNP molecular markers in the sheep genome that are related to the sheep brucellosis resistance traits. Through population verification, it was proved that the SNP molecular markers are significantly correlated with the sheep brucellosis resistance traits, and can be used to detect the level of sheep resistance to brucellosis.

[0007] In a first aspect, the present invention provides a molecular marker, comprising a nucleic acid having a nucleotide sequence as shown in SEQ ID NO. 1, wherein a polymorphism exists at position 101, and the polymorphism is T / C.

[0008] The nucleotide sequence shown in SEQ ID NO.1: GGCATGCACTGATATAGGGTGAAGGCTTTGGAGTCACTTTTATTAGCTGGCTGACTCAACGTGCTTGAGAGTATCTATGATTTCATGTATGTATGATGTAYGTTCACATATTTTGCCCAATTTAAATTGGATTATCTAGCTTTTCAGTATCAATATACAGAAATTCCTTACATATTCTGAATATGAACACTATTGATTGCA.

[0009] Where Y represents T or C (according to the internationally accepted IUPAC-IUBMB standard).

[0010] Specifically, the polymorphic site of the aforementioned molecular marker is located at position 106808175 of chromosome 4 of the reference genome version number Oar_v4.0, and the polymorphism is T / C.

[0011] In a second aspect, the present invention provides a primer pair for amplifying the aforementioned molecular markers. The primer pair can be designed using conventional methods. A skilled artisan can design primer pairs (including primer pairs or KASP primer combinations) of varying lengths based on existing primer design rules and primer design software (e.g., Primer) for amplifying the aforementioned molecular markers.

[0012] Furthermore, the present invention provides probes for amplifying the aforementioned molecular markers. The prior art already has mature technical guidance and means for designing probes for molecular markers, and probes designed based on the existing technical guidance are within the scope of protection of the present invention.

[0013] Furthermore, the present invention provides a gene chip comprising the probe. The prior art also has mature gene chip design methods, which can include the above probe alone or combine the above probe with other probes to prepare a gene chip for molecular marker-assisted breeding.

[0014] In a third aspect, the present invention provides a primer pair comprising the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] SEQ ID NO.2: 5'-GCAGAGAACGTGAATGCTGTG-3'; SEQ ID NO. 3: 5'-ACTCCTGTCTACCTAGAGGCA-3'.

[0016] The primer combination described above can achieve efficient amplification and genotyping for the above molecular markers.

[0017] In a fourth aspect, the present invention provides a kit comprising the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned gene chip.

[0018] In a fifth aspect, the present invention provides the use of SNP sites as targets in any of the following: (1) Predicting or detecting the brucellosis resistance of sheep, or preparing a reagent for predicting or detecting the brucellosis resistance of sheep; (2) Identifying or breeding sheep breeds with high resistance to brucellosis, or preparing reagents for identifying or breeding sheep breeds with high resistance to brucellosis; (3) Molecular marker-assisted breeding for brucellosis resistance in sheep; (4) Improvement of sheep breeds related to brucellosis resistance traits; (5) Improvement of sheep germplasm resources; The SNP site is located at position 106808175 of chromosome 4 of the reference genome version number Oar_v4.0, and the polymorphism is T / C.

[0019] The targets described in the present invention include existing conventional methods and reagents for detecting nucleotides, such as gene sequencing, designing primers for amplification, designing probes for targeted detection, and the like.

[0020] In a sixth aspect, the present invention provides the use of the aforementioned molecular marker detection reagent, or the aforementioned primer pair, or the aforementioned gene chip, or the aforementioned kit in any of the following: (1) Predicting or detecting the brucellosis resistance of sheep, or preparing a reagent for predicting or detecting the brucellosis resistance of sheep; (2) Identifying or breeding sheep breeds with high resistance to brucellosis, or preparing reagents for identifying or breeding sheep breeds with high resistance to brucellosis; (3) Molecular marker-assisted breeding for brucellosis resistance in sheep; (4) Improvement of sheep breeds related to brucellosis resistance traits; (5) Improvement of sheep germplasm resources.

[0021] In a seventh aspect, the present invention provides a method for identifying sheep brucellosis resistance traits, comprising: The sheep samples to be tested are tested for polymorphism of the aforementioned molecular markers, and the brucellosis resistance of the sheep to be tested is determined based on the genotype test results.

[0022] Furthermore, the detection method includes one or more of PCR amplification, gene sequencing, molecular probes, liquid phase capture or mass spectrometry.

[0023] Furthermore, the brucellosis resistance trait of the sheep to be tested is determined according to the genotype detection result, including: genotype TT corresponds to a low brucellosis resistance trait, and genotypes CC and TC correspond to a high brucellosis resistance trait.

[0024] Taking the aforementioned primer pair as an example, the 175th position in the amplification result corresponds to the polymorphic site, thereby enabling the identification of the brucellosis resistance trait of the sheep to be tested. In fact, in addition to this, the molecular marker polymorphism can also be directly detected by any method including gene sequencing, molecular probes, liquid phase capture, or mass spectrometry (all conventional methods in the art).

[0025] In an eighth aspect, the present invention provides a method for improving the brucellosis resistance of sheep, comprising: In the sheep breeding process, offspring with the aforementioned molecular marker genotype of CC or TC are selected for breeding.

[0026] The brucellosis described in the present invention is brucellosis caused by Brucella infecting sheep.

[0027] The present invention has the following beneficial effects: The present invention discloses a molecular marker associated with sheep brucellosis resistance. This molecular marker can relatively accurately detect the level of resistance to brucellosis in sheep, enabling early prediction of sheep brucellosis resistance, regardless of the sheep's age, sex, and other limitations. The molecular marker provided by the present invention can be used for detecting sheep brucellosis resistance and for molecular marker-assisted breeding. This is of great significance for the prevention and screening of sheep susceptible to brucellosis, effectively improving breeding efficiency, and is also of great significance for the development and utilization of the excellent economic characteristics of superior sheep breeds, as well as the protection and rational use of breed resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction will be given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure 1 This is the expanded population verification result of the SNP molecular marker disclosed in Example 2 of the present invention in the sheep population, wherein, represents p<0.05, Represents p < 0.01. DETAILED DESCRIPTION

[0030] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0031] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.

[0032] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0033] Example 1 Screening of SNP molecular markers associated with sheep brucellosis resistance In this example, a method uses a sheep population, an infected host of brucellosis, as a sample to develop SNP molecular markers associated with sheep resistance to brucellosis using genome-wide association analysis (GWAS). The specific steps are as follows: (1) Blood collection and serological testing.

[0034] Blood samples were collected from 50 Texel sheep raised under the same conditions. Competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA), and fluorescence polarization assay (FPA) were used to detect serum Brucella antibody concentrations. The test results were used as indicators of resistance to sheep brucellosis and as phenotypic data for GWAS analysis.

[0035] (2) Total DNA extraction, genome resequencing and quality control.

[0036] The blood DNA samples of the above 50 sheep were subjected to whole-genome resequencing with a sequencing depth of 20×. The sequencing data were subjected to sequence alignment and quality control. The number of effective SNPs after quality control was 22,833,320.

[0037] (3) Use whole genome association analysis technology to screen SNP sites associated with sheep brucellosis resistance traits.

[0038] Genome-wide association analysis was performed using GEMMA (Version 0.95) software and MLM (y=γCov+Xβ+Zα+Wμ+e) as the model, with cELISA value as the phenotype; GEMMA (Version 0.95) software and MLM (y=γCov+Xβ+Zα+Wμ+e) as the model, with iELISA value as the phenotype; and GEMMA (Version 0.95) software and MLM (y=γCov+Xβ+Zα+Wμ+e) as the model, with FPA value as the phenotype.

[0039] (4) Screening of SNP sites significantly associated with sheep brucellosis resistance traits.

[0040] By comparing the top 500 SNPs in the three GWAS results, the present invention finally obtained a SNP molecular marker that was significantly associated with the sheep's anti-brucellosis trait, whose physical location was based on position 106808175 of chromosome 4 of the sheep reference genome Oar_v4.0.

[0041] The above-mentioned SNP molecular marker corresponds to the sequence shown in SEQ ID NO.1, wherein the polymorphic site is located at the 101 bp, and the polymorphism is T or C.

[0042] Example 2 Application of SNP molecular markers associated with sheep brucellosis resistance traits In this example, a method is used to expand the population validation of the SNP molecular markers associated with the sheep brucellosis resistance trait developed in Example 1, as follows: (1) Primer design Based on the information of sheep genomic DNA sequence, a pair of primers was designed as follows: Forward primer F 5′-GCAGAGAACGTGAATGCTGTG-3′.

[0043] Reverse primer R 5′-ACTCCTGTCTACCTAGAGGCA-3′.

[0044] Used to amplify the nucleotide fragment where the SNP to be tested is located.

[0045] (2) Collect blood samples from the sheep to be tested and determine the serum antibody concentration Jugular vein blood was collected from 135 unvaccinated sheep (Texel, East Frisen, Suffolk, and White Suffolk) from a farm naturally infected with Brucella. Serum Brucella antibody concentrations were measured using competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA), and fluorescence polarization assay (FPA).

[0046] (3) Extraction of genomic DNA from the sheep blood sample to be tested The genomic DNA from the sheep blood samples was extracted using the solution method.

[0047] (4) Using genotyping technology to extract SNP markers from the genome to be tested Based on the primer design in this Example (1), genotyping detection was performed on the SNP molecular markers related to sheep resistance to brucellosis developed in Example 1.

[0048] (5) Compare whether there are significant differences in disease resistance among different genotypes Genotyping of the polymorphic SNP markers in the 135 sheep populations identified three genotypes (i.e., two homozygous and one heterozygous). Significant differences in mean values ​​for brucellosis resistance (cELISA, iELISA, and FPA) were tested using one-way analysis of variance (ANOVA) using SPSS.

[0049] The results are as follows Figure 1 As shown, three genotypes of "TT", "TC" and "CC" were distinguished in the tested sheep population, and the iELISA mean values ​​of sheep individuals with "TC" and "CC" genotypes were significantly lower than that with "TT" genotype, indicating that sheep individuals with "TC" and "CC" genotypes were more resistant to brucellosis than those with "TT" genotype. This also shows that "TC" and "CC" are the dominant genotypes of disease-resistant sheep, and the SNP molecular markers provided by the present invention have high accuracy in identifying anti-brucellosis traits.

[0050] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A molecular marker, characterized in that The molecular marker includes a nucleic acid having a nucleotide sequence as shown in SEQ ID NO. 1, wherein a polymorphism exists at position 101, and the polymorphism is T / C.

2. A primer pair, characterized in that: The primer pair is used to amplify the molecular marker according to claim 1.

3. The primer pair according to claim 2, characterized in that The primer pair includes the nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.

3.

4. A gene chip, characterized in that The gene chip comprises probes for detecting the molecular markers according to claim 1.

5. A kit, characterized in that It comprises the molecular marker according to claim 1, or the primer pair according to claim 2 or 3, or the gene chip according to claim 4.

6. Application of SNP sites as targets in any of the following: (1) Predicting or detecting the brucellosis resistance of sheep, or preparing a reagent for predicting or detecting the brucellosis resistance of sheep; (2) Identifying or breeding sheep breeds with high resistance to brucellosis, or preparing reagents for identifying or breeding sheep breeds with high resistance to brucellosis; (3) Molecular marker-assisted breeding for brucellosis resistance in sheep; (4) Improvement of sheep breeds related to brucellosis resistance traits; (5) Improvement of sheep germplasm resources; The SNP site is located at position 106808175 of chromosome 4 of the reference genome version number Oar_v4.0, and the polymorphism is T / C.

7. Use of the molecular marker detection reagent according to claim 1, or the primer pair according to claim 2 or 3, or the gene chip according to claim 4, or the kit according to claim 5 in any of the following: (1) Predicting or detecting the brucellosis resistance of sheep, or preparing a reagent for predicting or detecting the brucellosis resistance of sheep; (2) Identifying or breeding sheep breeds with high resistance to brucellosis, or preparing reagents for identifying or breeding sheep breeds with high resistance to brucellosis; (3) Molecular marker-assisted breeding for brucellosis resistance in sheep; (4) Improvement of sheep breeds related to brucellosis resistance traits; (5) Improvement of sheep germplasm resources.

8. A method for identifying the brucellosis resistance of sheep, characterized in that: include: The sheep sample to be tested is tested for the polymorphism of the molecular marker as claimed in claim 1, and the anti-brucellosis trait of the sheep to be tested is determined according to the genotype test result.

9. The method according to claim 8, characterized in that The brucellosis resistance trait of the sheep to be tested is determined according to the genotype detection result, including: genotype TT corresponds to a low brucellosis resistance trait, and genotypes CC and TC correspond to a high brucellosis resistance trait.

10. A method for improving the resistance of sheep to brucellosis, characterized in that: include: In the sheep breeding process, the offspring are selected to breed sheep whose molecular marker genotype is CC or TC as claimed in claim 1.

Citation Information

Patent Citations

  • Sheep SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in detection of anti-brucellosis character of sheep

    CN117051132A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to resistance to sheep brucellosis and application of SNP molecular marker

    CN117070643A

  • Sheep single nucleotide polymorphism (SNP) molecular marker and use thereof in detecting resistance to brucellosis in sheep

    US20250122583A1