Preparation method and application of sepsis encephalopathy model based on HLA II type gene humanized mouse

A septic encephalopathy model was established by intraperitoneal injection of cecal slurry from HLA class II humanized mice. Combined with meropenem treatment and MSS score screening, this solved the problem that existing models cannot accurately simulate the human immune response and provided an efficient platform for septic encephalopathy research and drug screening.

CN120642803APending Publication Date: 2025-09-16SHANGHAI PUBLIC HEALTH CLINICAL CENT

Patent Information

Application Number
CN202510901509.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Existing animal models of septic encephalopathy cannot accurately simulate the human immune response state, lack unified diagnostic standards and effective clinical intervention methods, and lack specific biomarkers, which makes drug development and evaluation difficult.

Method used

HLA class II humanized mice were used to induce sepsis by intraperitoneal injection of cecal slurry, and combined with meropenem treatment to establish a septic encephalopathy model that is more consistent with clinical characteristics. The MSS score screening and comprehensive evaluation system, including clinical scores, serum cytokine detection, hippocampal tissue analysis and behavioral testing, were used.

Benefits of technology

It provides a septic encephalopathy model that is closer to the human immune response state, can stably simulate the pathological process of sepsis, and provides an ideal animal model for studying the pathogenesis of septic encephalopathy and drug screening. It has high sensitivity of serum IL-1β concentration and hippocampal tissue inflammatory cytokine expression, which can accurately evaluate the efficacy of drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120642803A_ABST
    Figure CN120642803A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method and application of a sepsis-related encephalopathy model based on HLA II type gene humanized mice. According to the invention, HLA DP401 / DRA-IA beta- / -transgenic humanized mice are utilized, and the HLAII type gene humanized mouse sepsis model is prepared through mouse cecum seroperitoneal infection (CS) and meropenem intervention. The sepsis encephalopathy model can be comprehensively evaluated through indexes such as clinical score MSS, serum and hippocampal tissue inflammatory cytokine detection, hippocampal tissue microglial cell activation, hippocampal neuron spinous process change, transcriptomics, behavioral change and the like, and the sepsis encephalopathy model can be used for screening therapeutic drugs and therapeutic schedules; the HLA II type gene humanized mouse sepsis-related encephalopathy model provided by the invention can be used for infectious encephalopathy pathogenesis research, new drug research and development and safety evaluation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for preparing a biomedical bacterial infection sepsis and experimental animal infection model, and specifically to a method for preparing a septic encephalopathy model based on HLA class II gene humanized mice and its application, belonging to the technical field of animal medical models. Background Art

[0002] Sepsis refers to life-threatening organ dysfunction caused by an imbalance in the body's response to infection, including multiple organs such as the brain, liver, kidney, lung, and heart. In severe cases, it can even cause multi-organ dysfunction. Sepsis and its related complications have become one of the critical illnesses with the highest morbidity and clinical mortality in intensive care units (ICUs), and are known as "three high" diseases (high morbidity, high mortality, and high treatment costs). Sepsis-associated encephalopathy (SAE) refers to diffuse brain dysfunction caused by the systemic inflammatory response disorder caused by sepsis that spreads to the brain, excluding brain dysfunction caused by primary lesions of the central nervous system (infection, organic changes) or other organ failure (lung, kidney, liver, etc.) (Chung et al., 2020; Catarina et al., 2021).

[0003] SAE is considered one of the first symptoms of sepsis. Studies have shown that 20%-50% of sepsis patients in the ICU have symptoms of delirium. Patients susceptible to SAE can show acute cognitive or emotional dysfunction 36-48 hours before other symptoms of sepsis appear significantly. The mortality rate of SAE patients is significantly increased compared with non-SAE patients (49% VS 26%). Moreover, 10%-58% of survivors will have long-term cognitive or emotional dysfunction, including anxiety, memory, language fluency, and decreased executive function, which seriously affects the quality of life of patients and imposes a heavy burden on individuals, families, and society (Gofton and Young, 2012; Mazeraud et al., 2020).

[0004] However, the pathogenesis of SAE remains incompletely elucidated, lacking unified objective diagnostic criteria, effective clinical interventions, and specific biomarkers. Therefore, the development of drugs and vaccines for SAE is urgent, and animal models and evaluation technologies are urgently needed to evaluate the efficacy and safety of these drugs and study their pathogenesis (Gao and Hernandes, 2021; Catarina et al., 2021a; Tauber et al., 2021).

[0005] Existing research evidence suggests that sepsis, as an infectious disease, can lead to reduced transcription of classical HLA genes. This reduced transcription may affect the production of HLA molecules, thereby affecting the ability to present antigens, leading to a weakened immune response and, in turn, affecting nervous system function (Siegler et al., 2021).

[0006] It is generally believed that HLA class II molecules are regulated by a transactivator (CIITA). LPS, IFNγ, and IL-4 upregulate CIITA expression, while IL-10, NO, and TGFβ downregulate CIITA expression. Peripheral blood CIITA expression levels in patients with sepsis are positively correlated with HLA DRA / DPA1 / DPB1 expression (Siegler et al., 2021; Ting and Trowsdale, 2002). Clinically, HLA DRA expression levels have also been found to correlate with the course and prognosis of sepsis. Genetic polymorphisms (SNPs) in the MHC class II transactivator (CIITA) affect HLA DR expression levels in patients with sepsis, thereby affecting mortality at day 28. IFN-γ administration can increase HLA DR expression levels, thereby improving survival in patients with sepsis (Miatello et al., 2022; Ting and Trowsdale, 2002). In summary, HLA-DR expression levels are reduced in patients with sepsis. HLA-DR expression levels are associated with immune activation, and in patients with sepsis, HLA-DR expression is often downregulated; that is, lower HLA-DR expression levels are associated with greater sepsis severity. mHLA-DR expression levels on monocytes have been considered an important indicator for assessing immune function in patients with sepsis. Downregulated mHLA-DR expression, as detected by flow cytometry, has been recognized as a universal molecular marker for sepsis-induced immunosuppression (Liu et al., 2023; Cajander et al., 2016; Winkler et al., 2017). In addition, detection of mHLA-DR expression has also been successfully used to monitor the efficacy of immunotherapy, including the use of drugs such as interferon-γ (IFN-γ), granulocyte / macrophage colony-stimulating factor (GM-CSF), thymosin α1, and filgrastim, as well as in vitro immune interventions such as immunoadsorption therapy and continuous hemodiafiltration (Joshi et al., 2023; Zhuang et al., 2017).

[0007] Compared to HLA-DR, the functions of HLA-DP molecules have been less extensively studied. However, early studies have linked HLA-DP to infectious diseases (e.g., HIV / AIDS, hepatitis B) and immune dysfunction (e.g., berylliosis) (Amicosante et al., 2009; Crux and Elahi, 2017; Hardie et al., 2008). High-throughput gene expression analysis revealed that HLA-DPB1 transcription is attenuated in patients with sepsis and may interact with miR-let-7b-5p and the transcription factor SPIB, contributing to the development and progression of sepsis (Mohsin et al., 2022). A recent single-cell sequencing study also identified HLA-DPB1 as a key gene regulating the development of sepsis (Mo et al., 2024). Furthermore, HLA DP genes are implicated in the regulation of human schistosoma japonicum infection (May et al., 1998). Recent studies have uncovered novel functions for HLA DP molecules. The activating NK cytotoxic receptor NKp44 can interact with some HLA DP molecules, such as DDP401, to trigger NK cell functional immune responses (Niehrs et al., 2019). Combining human intestinal organoids and NK cell co-culture systems, researchers found that the expression level of HLA DP molecules in intestinal epithelial cells (IECs) of patients with ulcerative colitis was significantly upregulated. Compared with HLA-DP301, haplotype HLA-DP401 has a stronger binding ability to NKp44. HLA-DP401-positive IECs can increase NKp44 + NK cell degranulation and tumor necrosis factor production lead to increased IEC death. HLA DP expression is significantly upregulated on CD8+ T cells, and human cytomegalovirus (HCMV) infection significantly upregulates HLADP expression in CD8+ T cells. Human NK cells regulate the expansion of HLADP+CD8+ T cells in an HLA-DP antigen-dependent manner (Padoan et al., 2024).

[0008] Currently, common animal models of septic encephalopathy include lipopolysaccharide (LPS) stimulation, cecal ligation and puncture (CLP), and cecal slurry intraperitoneal infection (CS), each with its own advantages and disadvantages. The LPS method offers the advantages of simple operation and rapid modeling, but the injected component is bacterial endotoxin rather than bacterial cells, making it less effective in simulating clinical symptoms. The CLP method offers the advantages of multi-species infection and simulation of clinical immune responses, but the procedure is complex and results in additional surgical trauma (Rittirsch et al., 2009). The CS method offers the advantages of multi-species infection, simplicity, and the absence of surgical trauma, but its disadvantage is that variability in cecal slurry batches can affect modeling results (Seemann et al., 2017; Cai et al., 2023; Delfrate et al., 2024; Savi et al., 2021). Currently, there is a lack of a small animal model of sepsis-related encephalopathy that closely resembles the human immune response. Summary of the Invention

[0009] The purpose of the present invention is to address the deficiencies of the existing technology and provide a method for preparing a septic encephalopathy model based on HLA class II gene humanized mice and its application. This method is simple to operate, can more accurately simulate the pathological process of septic encephalopathy, and provide an ideal animal model for studying the pathogenesis of septic encephalopathy.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] In the first aspect, the present invention provides a method for preparing a septic encephalopathy model based on HLA class II gene humanized mice, comprising: using HLADP401 / DRA-IAβ - / - Sepsis was induced by intraperitoneal injection of mouse cecal slurry into transgenic humanized mice, and a septic encephalopathy model was successfully established by screening using the MSS score.

[0012] The HLADP401 / DRA-IAβ selected by the present invention - / - The transgenic humanized mice carry the intact human HLA DP401 and HLA DRA genomic regions and have their own MHC class II molecules (IAβ gene) knocked out.

[0013] Preferably, the mouse cecal slurry is derived from 8-12 week old female C57BL / 6 mice.

[0014] Preferably, the method for preparing the mouse cecal slurry comprises the following steps:

[0015] (1) The donor mouse strain required for cecal slurry preparation needs to match the age and strain of the recipient mice. In this invention, 8-12 week old female C57BL / 6 mice are selected;

[0016] (2) Cecal dissection using pre-sterilized tools: After the donor mouse is anesthetized with CO2, the legs of the mouse are fixed to an extruded polystyrene foam board using a 23G needle, with the mouse abdomen facing upward. The abdomen is sprayed with 70% ethanol for disinfection. The abdominal cavity is opened using sterile forceps and scissors, and the cecum is identified and isolated and stored in a sterile culture dish.

[0017] (3) Expressing cecal contents: Use sterile scissors to cut open both ends of the cecum; hold the middle of the cecum with sterile forceps and use flat sterile metal forceps to gently push the cecal contents out of the incision, using a rolling motion and avoiding scraping; collect the contents and place them into a pre-weighed 15 mL centrifuge tube (cecal contents of up to five mice can be pooled into the same tube);

[0018] (4) Dilution of cecal contents: Weigh the centrifuge tube containing the cecal contents and calculate the amount of diluent to be used; it is estimated that each mouse will have an average of 200 mg and a maximum of 300 mg of cecal pulp. For each gram of cecal pulp, add 10 mL of sterile diluent; the diluent is 15% glycerol dissolved in phosphate-buffered saline (PBS), sterilized by autoclaving; add the required amount of pre-cooled sterile PBS (containing 15% glycerol) to the 15 mL centrifuge tube containing the cecal contents according to the above calculation rules;

[0019] (5) Cecal slurry filtration: Place a 15 mL centrifuge tube in a vortex mixer JL-D and vortex for 30 seconds to disperse particles with a diameter greater than 1-3 mm; transfer the suspended cecal slurry to a filtration device (a 50 mL centrifuge tube with a 200-mesh cell sieve) while stirring the contents with a pipette tip for thorough filtration; replace the filtration device between each tube of cecal slurry and collect all the contents into a 50 mL centrifuge collection tube placed on ice;

[0020] (6) While stirring continuously, the slurry was aliquoted into cryovials in 1 ml portions and stored at –80°C until use.

[0021] Preferably, the injection dose of the cecal slurry is 1.25-1.5 mg / g mouse body weight.

[0022] Preferably, the criterion for passing the MSS score screening is: an average clinical MSS score of 14 points or more over 3 days.

[0023] Preferably, the following analysis and evaluation of the septic encephalopathy model is also included:

[0024] 1) Weigh and observe the health status of each group of infected mice daily, record the survival status of each group of infected mice, and draw weight curves, survival curves, and clinical score MSS curves every 24 hours;

[0025] Clinical score MSS: The experimental mice were clinically scored based on seven aspects: appearance, autonomous consciousness, autonomous activity, response to stimulation, eyes, respiratory rate, and respiratory quality, with a total score of 28 points;

[0026] 2) ELISA was used to detect serum cytokines TNFα / IL-6 / IL-1β on the first day after model establishment, and real-time quantitative PCR was used to detect the expression levels of inflammatory cytokines in the hippocampus on day 1, including CCL2, CCL3, CXCL10, TNFα, IL-6, and IL-1β;

[0027] 3) Immunofluorescence staining to detect microglial cell (IBA-1) activation in the hippocampus;

[0028] 4) Hippocampal tissue pathology: Golgi staining was used to detect the morphological details of dendritic spines of hippocampal neurons and glial cells on the third and fourteenth days after modeling;

[0029] 5) Obtain the hippocampus for transcriptome sequencing (RNA-Seq) on the third day after modeling, and perform KEGG, GO, and other analyses on the sequencing results; obtain sequence and expression information of all transcripts in the hippocampus tissue on the third day after modeling, and analyze gene expression differences and gene structural variations;

[0030] 6) Behavioral testing: The open field test, elevated cross maze, and Barnes maze were used to evaluate the emotional dysfunction of the model mice on the fourteenth day after modeling.

[0031] In a second aspect, the present invention provides a use of a septic encephalopathy model prepared by the septic encephalopathy model preparation method described in the first aspect in studying the pathogenesis of sepsis-related encephalopathy and / or screening therapeutic drugs for sepsis-related encephalopathy.

[0032] In a third aspect, the present invention provides a method for screening therapeutic drugs for sepsis-related encephalopathy, comprising: A) administering a test drug to a septic encephalopathy model prepared by the septic encephalopathy model preparation method of the first aspect for a period of time in a test group, and detecting a clinical indicator E1 of sepsis-related encephalopathy in the test group; and detecting a clinical indicator E2 of sepsis-related encephalopathy in a control group that does not administer the test drug and has the same other conditions; and B) comparing E1 and E2. If E1 is significantly improved relative to E2, it indicates that the test drug is a potential therapeutic drug for sepsis-related encephalopathy.

[0033] Preferably, the clinical indicators of sepsis-related encephalopathy include one or more of the following 1)-7): 1) MSS clinical score to evaluate the progression of sepsis in real time; 2) ELISA to detect inflammatory cytokines in model serum to evaluate the systemic infection immune response state of the model; 3) QPCR to detect the immune response of hippocampal tissue; 4) immunofluorescence staining to evaluate the activation state of microglia (IBA-1) in the hippocampus; 5) Golgi staining to evaluate the morphological changes of hippocampal neurons and glial cell dendritic spines; 6) transcriptome sequencing to detect changes in hippocampal gene expression; 7) behavioral evaluation of emotional dysfunction in model mice.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) The present invention utilizes HLA DP401 / DRA-IAβ carrying the entire DP401 and DRA large fragment gene loci - / - Genetically humanized mice (expressing functional human HLA class II genes and silencing mouse H2 class II genes) were treated with meropenem through intraperitoneal infection with cecal slurry fluid. A small animal model of sepsis-related encephalopathy that is more consistent with clinical characteristics and a standardized and normalized model comprehensive evaluation system were established, which can provide technical support for the prevention and treatment of major infectious diseases and encephalopathy, as well as new drug development and safety evaluation. The present invention uses survival curves and sepsis clinical scores (MSS) as model evaluation indicators to screen the cecal slurry injection dose and antibiotic (meropenem) intervention time. Combined with the clinical scoring system MSS, the cumulative sum of the MSS scores over the first three days is used as the evaluation criterion for inclusion in sepsis encephalopathy studies, and a stable mouse model of sepsis encephalopathy can be obtained.

[0036] (2) The present invention provides a set of evaluation technology systems for septic encephalopathy models. Through clinical scoring of MSS, detection of inflammatory cytokines in serum and hippocampal tissue, hippocampal microglial activation, hippocampal neuronal spine mutation, transcriptomics, behavioral changes and other technologies, septic encephalopathy models can be comprehensively evaluated for the screening of therapeutic drugs and treatment plans.

[0037] (3) HLADP401 / DRA-IAβ prepared by the present invention - / - The genetically humanized mouse model of septic encephalopathy has a high serum IL-1β concentration, and the hippocampus highly expresses inflammatory cytokines such as CCL2, CCL3, and CXCL10. Transcriptome sequencing revealed abnormal mitochondrial gene expression and severe neuronal damage in the hippocampus. Animal behavioral testing showed that HLA DP401 / DRA-IAβ - / -The genetically humanized mouse septic encephalopathy model has poor learning and memory abilities (Barnes maze) and high anxiety levels (altitude cross maze and open field test). Therefore, this model is close to the human immune response state and can more accurately simulate the clinical pathological process of septic encephalopathy. This invention provides an ideal animal model for studying the pathogenesis of septic encephalopathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 These are the screening results of cecal slurry injection doses: the injection doses were divided into four groups of 0.75 / 1.0 / 1.25 / 1.5 mg / g body weight. A is the MSS score result of sepsis. The 1.25 mg / g and 1.5 mg / g groups produced obvious sepsis symptoms, while the 0.75 and 1.0 mg / g groups had no obvious sepsis symptoms. B is the mouse survival rate statistics. All mice in the 1.25 mg / g and 1.5 mg / g groups died within 48 hours.

[0039] Figure 2 Screening results of antibiotic (meropenem) intervention time: Meropenem (20 μg / g body weight) intervention was divided into two groups, 6-hour intervention group and 12-hour intervention group after CS injection; 6-hour intervention group continued to inject meropenem at intervals of 24 hours after the first 6-hour intervention until D7; 12-hour intervention group continued to inject meropenem at intervals of 24 hours after the first 12-hour intervention until D7; A is the body weight rate of each intervention group; B is the MSS score of each intervention group; C is the survival rate of each intervention group.

[0040] Figure 3 HLADP401 / DRA-IAβ - / - Screening results of transgenic humanized mouse infection scheme: The experiment was divided into two groups: 1.25mg / g+6h meropenem intervention group and 1.25mg / g+12h meropenem intervention group. The experimental mice were HLA DP / DRA-IAβ - / - IAβ - / - , WT; A is the clinical symptom score of MSS in each group of mice; B is the survival rate of each group of mice.

[0041] Figure 4 The expression of serum cytokines TNF-α, IL-6 and IL-1β on the first day after CS model infection.

[0042] Figure 5 The expression of inflammatory cytokines IL-4, IL-10, LCN2, CCL-11, CXCL-10, G-CSF, TNF-α, IL-6, IL-1β, CXCL-2, CCL-2, CCL-3, CXCL-9 and CXCL-1 in hippocampal tissue.

[0043] Figure 6Transcriptome sequencing showed differentially expressed genes in the hippocampus tissues of each group of mice.

[0044] Figure 7 The heat map of differentially expressed genes showed that the differentially expressed genes were mainly concentrated in microtubule proteins Tubb3 / 5 / 4b, mitochondrial genes mt-Nd3 / Nd4l / Co2 / Co3 / COx8b and mitochondrial ATP metabolism-related genes mt-ATP6 / 8.

[0045] Figure 8 The results of KEGG cluster analysis showed that the functions of differentially expressed genes were significantly enriched in Parkinson's disease, prion disease, oxidative phosphorylation, and mitochondrial dysfunction.

[0046] Figure 9 The results of immunofluorescence staining.

[0047] Figure 10 This is the result of Golgi staining.

[0048] Figure 11 These are the results of the high-altitude cross maze test on day 14 of the SAE model in mice.

[0049] Figure 12 The results of the Barnes maze test on day 14 of the SAE model in mice.

[0050] Figure 13 These are the results of the open field test on day 14 of the SAE model in mice. DETAILED DESCRIPTION

[0051] To make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0052] Unless otherwise specified, the instruments, reagents, and materials used in the following examples are all conventional instruments, reagents, and materials available in the prior art and can be obtained through regular commercial channels. The experimental methods and detection methods used in the following examples are all conventional experimental methods and detection methods available in the prior art, unless otherwise specified, and are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0053] Example 1 Preparation of cecal slurry

[0054] Cecal dissection was performed on 6-8 week old female C57BL / 6 mice using pre-sterilized and chilled tools. In a biosafety cabinet, use flat sterile metal forceps to push the cecal contents through the incision. Collect the contents and place them into a pre-weighed 15 mL centrifuge tube. Weigh and calculate the amount of PBS (containing 15% glycerol) to be added to the cecal contents. An estimated 200-300 mg of cecal slurry will be obtained per mouse. Dilute the cecal slurry by adding 10 mL of sterile PBS per gram. Vortex the cecal slurry and filter it through a 200-mesh sieve. Mix the filtered slurry with constant stirring and aliquot 1 mL into cryovials for storage at -80°C.

[0055] Example 2 Construction and identification of transgenic mice

[0056] HLADP / DRA-IAβ used in the present invention - / - Transgenic humanized mice were developed in-house in our laboratory. The detailed preparation method is based on the previously published literature from our laboratory (Li F, Niu B, Liu L, et al. Characterization of genetically humanized mice with transgenic HLADP401 or DRAbut deficient inendogenous murine MHC class II genes upon Staphylococcus aureus pneumonia. Anim Models Exp Med. 2023; 00:1-13. doi:10.1002 / ame2.12331).

[0057] To confirm the status of the transgenic fragment in humanized mice, PCR amplification was performed on each F1 generation mouse using the following primers:

[0058] HLA-DPA1-F: CAGACGCATAGACCAACAGG (SEQ ID NO: 1);

[0059] HLA-DPA1-R: CAGGCTCCTGGGAAACA (SEQ ID NO: 2);

[0060] HLA-DPB1-F: TACCCAGGCAGCATTCAA (SEQ ID NO: 3);

[0061] HLA-DPB1-R: AAGGACAGACCCAGGTTTAGT (SEQ ID NO: 4);

[0062] HLA-DOA-F: CGCAGCAGAGCCATCAACG (SEQ ID NO: 5);

[0063] HLA-DOA-R: AGGGCACGAAGGGCAGGTAG (SEQ ID NO: 6);

[0064] HLA-DRA-F: TGGCAAAGAAGGAGACGG (SEQ ID NO: 7);

[0065] HLA-DRA-R: CCAGTGCTTGAGAAGAGGC (SEQ ID NO: 8);

[0066] HLA-DPA2-F: CCATTCTCCATCTTCTCCTT (SEQ ID NO: 9);

[0067] HLA-DPA2-R: CCTCCTCTGCTGTCCTAA (SEQ ID NO: 10);

[0068] Hotspot DPA1-F: CAGGAGCCACAGGAGTAT (SEQ ID NO: 11);

[0069] Hotspot DPA1-R: AGCATTAACAGCACATAGGT (SEQ ID NO: 12);

[0070] H2-Ab1-Wildtype-F: CTCTACACCCCCAACACACC (SEQ ID NO: 13);

[0071] H2-Ab1-Wildtype-R: AGTGAGCGAGCACAGACAAG (SEQ ID NO: 14);

[0072] H2-Ab1-Mutant-F: CTCTACACCCCCAACACACC (SEQ ID NO: 15);

[0073] H2-Abl-Mutant-R: TCGCCTTCTTGACGAGTTCT (SEQ ID NO: 16).

[0074] Example 3 Preparation of Septic Encephalopathy Model

[0075] Select C57BL / 6 and HLA-DP / DRA-IAβ mice around 8 weeks old - / - Mice, weighing 20-25 g, were acclimated for 1 week.

[0076] Cecal slurry (CS) was thawed at 37°C, mice were weighed, thoroughly mixed with a 23-gauge needle, and injected intraperitoneally (ip). The model group was injected with a dose of 0.75-1.5 mg / g body weight, and the control group was injected with an equal volume of normal saline according to body weight. Meropenem was administered 6-12 hours after CS injection at a dose of 20 μg / g body weight. After 6 hours, antibiotics were injected once a day for 7 consecutive days. The mice were monitored once a day for 7 days after CS injection, weighed, and clinically scored. The screening results were as follows: Figures 1 to 3 As shown, Figure 1 This is the screening result of cecal slurry injection dose. The injection dose was divided into four groups: 0.75 / 1.0 / 1.25 / 1.5 mg / g body weight. The sepsis MSS score results showed that the 1.25 mg / g and 1.5 mg / g groups could produce obvious sepsis symptoms, while the 0.75 and 1.0 mg / g groups had no obvious sepsis symptoms. Figure 1 As shown in A; all mice in the 1.25 mg / g and 1.5 mg / g groups died after 48 hours. Figure 1 As shown in B. Figure 2 The results of the screening of antibiotic (meropenem) intervention time were as follows: the meropenem (20 μg / g body weight) intervention was divided into two groups; the 6-hour intervention group was continuously injected with meropenem at intervals of 24 hours until D7; the 12-hour intervention group was continuously injected with meropenem at intervals of 12 hours until D7; the results showed that the weight recovery of the 6-hour intervention group was slower after D3, while the weight recovery of the 12-hour intervention group was faster after D3. Figure 2 As shown in A; within 3 days, the average MSS score of the 6-hour intervention group was lower than that of the 12-hour intervention group, and the MSS score of the 12-hour intervention group remained at a high level within 3 days. Figure 2 As shown in B; the 7-day survival rate of the 6-hour intervention group was 50%, and the 7-day survival rate of the 12-hour intervention group was 20%. Figure 2 As shown in C. Figure 3 HLA DP / DRA-IAβ - / - Screening results of transgenic humanized mouse infection scheme. The experiment was divided into two groups: 1.25mg / g+6h meropenem intervention group and 1.25mg / g+12h meropenem intervention group. The experimental mice were HLADP / DRA-IAβ - / - IAβ - / - , WT; A is the clinical symptom score of MSS in each group of mice; B is the survival rate of mice in each group. The results showed that compared with WT, 6h intervention rapidly reduced HLADP / DRA-IAβ - / - Clinical symptom scores of MSS in mice; and IAβ - / - Compared with mice, HLADP / DRA-IAβ - / - Mice maintained more severe clinical symptoms after 12 hours of intervention, indicating that HLA DP / DRA-IAβ- / - Mice regained susceptibility to sepsis and were more sensitive to antibiotic intervention than WT mice, and IAβ - / - The mice had a more rapid immune response after infection.

[0077] 24 hours after infection, blood was collected from the inner canthus of the eye, and serum was isolated to measure systemic inflammatory cytokine secretion in the mice. Simultaneously, the hippocampus of the mice was sampled 24 hours after infection to measure changes in neuroinflammatory markers in the hippocampus. 72 hours after infection, the brains of the mice were harvested, rinsed with saline, and fixed in 4% paraformaldehyde for storage. Frozen sections were then prepared for immunofluorescence analysis.

[0078] Example 4 Sepsis clinical score

[0079] MSS score

[0080] The experimental mice were clinically scored in seven aspects: appearance, autonomous consciousness, autonomous activity, response to stimulation, eyes, respiratory rate, and respiratory quality, with a total score of 28 points. The average clinical score of 14 points or more over 3 days was considered to be induced by severe sepsis, and the group was enrolled for subsequent septic encephalopathy analysis. The results are shown in Figure 2 and Figure 3 .

[0081] Example 5 ELISA method to detect the expression of inflammatory factors in mouse serum

[0082] (1) Sample collection and storage: For serum samples, allow the blood to coagulate naturally for 20 minutes at room temperature. Centrifuge at 1000 × g for 10 minutes at 4°C. Then, aliquot the supernatant into small EP tubes and store at -20°C. If precipitation occurs during storage, centrifuge again to avoid repeated freezing and thawing.

[0083] 1. Reagents back to temperature: First, place the test kit and the sample to be tested at room temperature 30 minutes before the experiment. If crystals appear in the concentrated washing solution, place it in a 37°C warm bath until all crystals are dissolved.

[0084] 2. Prepare the washing solution: Calculate the volume of the diluted washing solution in advance, then dilute the 20x concentrated washing solution to 1x application solution with double distilled water or deionized water. Store the unused concentrated washing solution in a 4°C refrigerator.

[0085] 3. Serial dilution of the standard: Add 1 ml of Standard / Sample Diluent (SR1) to the lyophilized standard. Let stand for 15 minutes to dissolve completely, then gently mix (concentration is 2000 pg / ml). Then dilute to the following concentrations: 2000, 1000, 500, 250, 125, 62.5, 31.25, and 0 pg / ml. Any unused reconstituted standard solution (2000 pg / ml) should be discarded or aliquoted into single-use quantities as needed and stored at -80°C.

[0086] 4. Biotinylated antibody working solution: Calculate the required amount for the test in advance, dilute the 100x antibody concentrate to 1x working solution with detection diluent (SR2) (mix thoroughly before dilution), and add to the reaction well within 30 minutes.

[0087] 5. Enzyme conjugate working solution: Prepare the required amount for each test. Use enzyme conjugate diluent (SR3) to dilute 40

[0088] Dilute the 1x concentrated enzyme conjugate into a 1x working solution (centrifuge before dilution) and use within 30 minutes.

[0089] 6. Shake off the liquid in the wells of the ELISA plate, pat dry on thick absorbent paper, add 300ul / well of washing solution using a wash bottle, let it stand for 30 seconds, then shake off the liquid in the wells of the ELISA plate, pat dry on thick absorbent paper, and wash the plate 5 times.

[0090] (2) Detection steps:

[0091] 30 minutes before the experiment, remove the test kit and return to room temperature. Before adding standards / samples, wash the plate three times and spin dry. Add 100 μl of standard and test sample to the reaction wells, seal the plate, incubate in a 37°C incubator for 90 minutes, tap the plate and wash the plate four times; add 100 μl of biotinylated antibody working solution to the reaction wells, seal the plate, incubate in a 37°C incubator for 60 minutes, tap the plate and wash the plate four times; add 100 μl of enzyme conjugate working solution to the reaction wells, seal the plate, incubate in a 37°C incubator for 30 minutes, tap the plate and wash the plate five times; add 100 μl of chromogenic substrate to the reaction wells, seal the plate, and develop the color at 37°C in the dark for 15 minutes; add 50 μl of stop solution, and immediately measure the OD value at 450 nm using a microplate reader (within 5 minutes).

[0092] (3) Result judgment:

[0093] 1. Measure the OD value using a microplate reader at a wavelength of 450 nm. Select dual-wavelength detection with a reference wavelength of 630 nm. Subtract the OD value measured at 630 nm from the OD value measured at 450 nm.

[0094] 2. Calculate the average OD value of standards and samples: the OD value of each standard and sample should be subtracted from the OD value of the zero well.

[0095] 3. Use the standard concentration as the horizontal axis and the absorbance OD value as the vertical axis to draw a standard curve using software. The protein content in the sample can be converted into the corresponding concentration from the standard curve through the corresponding OD value.

[0096] Serum cytokine test results Figure 4 As shown, the results showed that HLADP / DRA-IAβ - / - The serum IL-1β concentration was high, and the TNF-α concentration was also higher than that of the other groups. - / - In mice with PD-L1 background, DP / DRA genes can synergistically upregulate the expression levels of IL-1β and TNF-α.

[0097] Example 6 RT-qPCR detection of inflammatory cytokine expression in mouse hippocampus

[0098] (1) Collection of mouse brain tissue

[0099] Infected mice were sacrificed by cervical dislocation. The heads were dissected open, the brains harvested, and the hippocampus removed. The harvested tissues were washed in PBS to remove blood. The washed tissues were then stored in Trizol solution until ready for use.

[0100] (2) RNA extraction

[0101] Tissue RNA was extracted using the Full-Formula Gold RNA Mini Kit (ER101-01). Refer to the kit instructions for detailed procedures. After extraction, RNA was dissolved in sterile DEPC-free water and the concentration was determined. RNA samples were stored at -80°C until further use.

[0102] (3) RNA reverse transcription into cDNA

[0103] RNA was reverse transcribed into cDNA using the Yisheng Reverse Transcription Kit (11123ES60). Refer to the kit instructions for detailed steps. After reverse transcription, the cDNA sample was diluted 1.5-fold with double-distilled water and set aside.

[0104] (4) Real-time fluorescence quantitative PCR

[0105] Tissue mRNA levels were measured using the Yisheng Real-Time Fluorescence Quantitative PCR Kit (11201ES08). For detailed steps, refer to the kit instructions. The names and sequences of the quantitative PCR primers are as follows:

[0106] TNF-α-QPCR-F: GGAACTGGCAGAAGAGGCA (SEQ ID NO: 17);

[0107] TNF-α-QPCR-R:CCACAAGCAGGAATGAGAGAGA(SEQ ID NO:18)?

[0108] IL-1β-QPCR-F:CACCCTGCAGCTGGAGAGT(SEQ ID NO:19)?

[0109] IL-1β-QPCR-R:GACAAACCGCTTTTCCATCTTC(SEQ ID NO:20)?

[0110] IL-4-QPCR-F:TCAGCAACGAGACA(SEQ ID NO:21)!

[0111] IL-4-QPCR-R:GTGGACTTGGACTCATTCA(SEQ ID NO:22)?

[0112] IL-6-QPCR-F:TACCACTCCCAACAGACC(SEQ ID NO:23):

[0113] IL-6-QPCR-R:TTTCCACGATTTCCCAGA(SEQ ID NO:24):

[0114] IL-10-QPCR-F:GAGCAGGTGAAGAGGTGATT(SEQ ID NO:25)?

[0115] IL-10-QPCR-R:TCCAGCAGACTCAATACAC(SEQ ID NO:26)?

[0116] CCL-2-QPCR-F:TGCGCTGACTCCAAAGAGAC(SEQ ID NO:27)?

[0117] CCL-2-QPCR-R:CTCGATGTGGCTACTTGGCA(SEQ ID NO:28)?

[0118] CCL-3-QPCR-F:CAGCGAGTACCAGTCCCTTT(SEQ ID NO:29)?

[0119] CCL-3-QPCR-R:GCGCTGAGAAGACTTGGTTG(SEQ ID NO:30)?

[0120] CCL-11-QPCR-F:CTGCTCACGGTCACTTCCCTT(SEQ ID NO:31)?

[0121] CCL-11-QPCR-R:TCTTTGCCCAACCTGGTCTT(SEQ ID NO:32);

[0122] CXCL-1-QPCR-F:ACCCAAACCGAAGTCATAGC(SEQ ID NO:33);

[0123] CXCL-1-QPCR-R:TGGGGACACCTTTTAGCATC(SEQ ID NO:34);

[0124] CXCL-2-QPCR-F:AGTTTGCCTTGACCCTGAAG(SEQ ID NO:35);

[0125] CXCL-2-QPCR-R:CTTTGGTTCTTCCGTTGAGG(SEQ ID NO:36);

[0126] CXCL-9-QPCR-F:GGCAGGTTTGATCTCCGTTC(SEQ ID NO:37);

[0127] CXCL-9-QPCR-R:GGAGTTCGAGGAACCCTAGT(SEQ ID NO:38);

[0128] CXCL-10-QPCR-F:TTGAGATCATTGCCACGAT(SEQ ID NO:39);

[0129] CXCL-10-QPCR-R:CTCTGCTGTCCATCCATC(SEQ ID NO:40);

[0130] G-CSF-QPCR-F:CCTGGAGCAAGTGAGGAAGATC(SEQ ID NO:41);G-CSF-QPCR-R:CGCTGGAAGGCAGAAGTGAA(SEQ ID NO:42);

[0131] LCN2-QPCR-F:ATATGCACAGGTATCCTCAG(SEQ ID NO:43);

[0132] LCN2-QPCR-R:GAAACGTTCCTTCAGTTCAG(SEQ ID NO:44);

[0133] MMP-2-QPCR-F: CCCTGATAACCTGGATGCC (SEQ ID NO: 45);

[0134] MMP-2-QPCR-R: ACTTCACGCTCTTGAGACTTTG (SEQ ID NO: 46); MMP-9-QPCR-F: GGACCCGAAGCGGACATT (SEQ ID NO: 47);

[0135] MMP-9-QPCR-R: TGCCCAGCGACCACAACT (SEQ ID NO: 48);

[0136] TIMP-2-QPCR-F:CGCTTAGCATCACCCAGAA (SEQ ID NO: 49);

[0137] TIMP-2-QPCR-R:GTGACCCAGTCCATCCAGAG (SEQ ID NO: 50);

[0138] Col-4-QPCR-F: TGGGTGGCGGAGTTTGTG (SEQ ID NO: 51);

[0139] Col-4-QPCR-R: TGTTAGCGAAGTAGTGGCAGGTA (SEQ ID NO: 52);

[0140] The results of cytokine and chemokine expression level detection were as follows Figure 5 As shown, the results showed that HLA DP401 / DRA-IAβ - / - Multiple inflammatory cytokines were highly expressed in the hippocampus, including TNF-α, IL-1β, CCL2, CCL3, CXCL-10, etc., indicating that the introduction of DP401 and DRA genes synergistically upregulated the expression levels of these inflammatory cytokines.

[0141] Example 7 Immunofluorescence staining of IBA-1

[0142] Mice were anesthetized using Avertin and perfused transcardially with PBS followed by 4% paraformaldehyde (PFA). The brains were fixed in 4% PFA for 24 hours at 4°C, cryoprotected in 30% sucrose PBS solution, and stored at -80°C. Coronal 20 μm sections were prepared on a freezing microtome (Leica CM1860), and the sections were incubated in 3% Triton-X100 in PBS for 10 minutes, followed by 3 5-minute washes with PBS; the sections were placed in a humidified chamber and blocked with 5% BSA for 2 hours at room temperature. The first antibody was incubated in 5% BSA dilution at 4°C overnight. The sections were washed 3 times in PBS and incubated with fluorescent secondary antibodies of the corresponding sources for 2 hours at room temperature. The sections were placed in a dark place, the cell nuclei were stained with DAPI for 30 minutes, and the sections were mounted with 50% glycerol, stored in the dark, and confocal fluorescence images were taken. The fluorescence intensity of IBA-1 was analyzed using ImageJ. The results of IBA-1 immunofluorescence staining are shown in Figure 2. Figure 9 As shown, the results showed that the activation of microglial IBA-1 was significant; compared with the WT blank group, the number and branches of microglia in the model group were significantly increased, but the degree of increase was not significant. - / - The mouse model group was weaker than the WT model group. The reduced expression of tubulin and aggravated mitochondrial dysfunction in humanized mice may affect the degree of microglial activation.

[0143] Example 8 Hippocampal Golgi staining

[0144] Golgi staining was used to analyze the morphology of pyramidal neurons in the hippocampal CA region. A gelatin-chromium sulfate potassium solution was heated to 37°C until liquid, then immersed in the solution and dried to prepare gelatin slides. Mouse brain tissue was collected and fixed in fixative for at least 48 hours. The mouse brain tissue was cut into 2-3 mm thick blocks, rinsed with saline, and placed in Golgi stain in the dark for 14 days, with the stain changed during this period. The tissue was then rinsed in distilled water and immersed in 80% glacial acetic acid overnight. After softening, it was rinsed with distilled water and placed in 30% sucrose. The tissue was cut into 100-micron sections using an oscillating microtome and mounted on gelatin slides, protected from light overnight. The dried tissue slides were then treated with concentrated ammonia for 15 minutes, rinsed in distilled water for 1 minute, treated with acid film fixative for 15 minutes, rinsed in distilled water for 3 minutes, and mounted with glycerol-gelatin after drying. Finally, microscopic examination, image acquisition and analysis were performed. A panoramic multi-layer scan using a digital slide scanner was used to obtain a panoramic image of the brain tissue. The results showed that the neurons and dendritic spines were black with a light yellow background. The dendritic morphology was reconstructed and analyzed. The selected cells must meet the following criteria: (1) located in the pyramidal cell layer of the hippocampal CA region; (2) distinguishable from surrounding cells; (3) the dendrites were not truncated or broken; (4) the cells were well filled in the entire dendrite. The third-order branches with a length of 20-50 microns and a distance of 50-150 microns from the CA1 pyramidal cell soma were selected for analysis. The classification of dendritic spines is as follows: 1. Slender type: less than 1.5 microns in length and no swelling; 2. Mushroom type: the diameter of the spine head swelling is greater than 0.6 microns; 3. Short and thick type: length / width less than 1.0 microns and no swelling. During the experiment, it should be noted that the Golgi stain is highly toxic and the operation must be strictly protected from light.

[0145] Golgi staining results Figure 10 The results showed that compared with the control group, the hippocampal neurons were sparsely and unevenly distributed, with a reduced number and an increased axonal breakage ratio after cecal slurry CS infection. - / - group and HLADPDR-IAβ - / - The incidence of axonal disruption in both groups was more severe (higher proportion of axonal disruption). On day 14 after infection, the degree of recovery was: C57BL / 6>HLADP / DRA-IAβ - / - >IAβ - / - .

[0146] Example 9 Transcriptome Sequencing

[0147] This study used a series of bioinformatics methods to analyze samples. First, RNA integrity was assessed using the Agilent 2100 Bioanalyzer system to ensure sample quality. Subsequently, transcriptome sequencing libraries were constructed, including non-strand-specific and strand-specific libraries. Non-strand-specific libraries were prepared by enriching mRNA from total RNA using poly-T oligonucleotide magnetic beads, followed by fragmentation, first- and second-strand cDNA synthesis, end repair, A-tail addition, adapter ligation, fragment selection, amplification, and purification. Strand-specific libraries used dUTP instead of dTTP in second-strand cDNA synthesis to preserve strand information. After library construction, quantification was performed using Qubit and real-time PCR, and fragment size distribution was determined using a bioanalyzer.

[0148] During the sequencing phase, different libraries are mixed based on effective concentration and target data volume before Illumina sequencing. Sequencing works by using a sequencing-by-synthesis (SBS) process, where fluorescently labeled dNTPs, DNA polymerase, and adapter primers are added to the sequencing flow cell for amplification. The sequencer then captures the fluorescent signal and converts it into sequence information.

[0149] For bioinformatics analysis, the raw data (fastq format) were first processed using fastp software to remove reads containing adapters, poly-N, and low-quality reads to obtain high-quality clean reads. Q20, Q30, and GC content were then calculated. Subsequently, Hisat2 v2.0.5 was used to construct a reference genome index and align paired-end clean reads to the reference genome. Hisat2 generates a spliced-connection database based on gene model annotation files, resulting in better alignment than other non-spliced ​​alignment tools.

[0150] Gene expression levels were quantified using featureCounts v1.5.0-p3 to calculate the number of reads per gene, and the FPKM value was calculated based on gene length and read counts. FPKM takes into account the effects of sequencing depth and gene length on read counts and is currently the most commonly used method for estimating gene expression levels. For differential expression analysis, for samples with biological replicates, the DESeq2R package (1.20.0) was used for analysis, and a negative binomial distribution model was used to determine differentially expressed genes. The Benjamini and Hochberg method was used to adjust the P value to control the false discovery rate. For samples without biological replicates, the edgeR R package (3.22.5) was used for analysis, and the read counts were adjusted by scaling the normalization factor to eliminate differences in sequencing depth between samples. A P value ≤ 0.05 and |log2(foldchange)| ≥ 1 were set as the threshold for significant differential expression.

[0151] Differential gene enrichment analysis was performed using the clusterProfiler R package for GO enrichment analysis, with GO terms with a corrected P value less than 0.05 considered significantly enriched. KEGG pathway enrichment analysis was also performed using the clusterProfiler R package to assess the enrichment of differentially expressed genes in biological pathways based on the KEGG database.

[0152] Transcriptome sequencing results Figures 6-8 As shown, transcriptome sequencing showed that HLADP / DRA-IAβ - / - There are more differentially expressed genes in the hippocampus. - / - Model mice and IAβ - / - Compared with the model mice, there are 373 differentially expressed genes. - / - Compared with model mice and C57BL / 6 mice, there were 382 differentially expressed genes, such as Figure 6 The results of the differentially expressed gene heat map showed that the differentially expressed genes were mainly concentrated in microtubule proteins Tubb3 / 5 / 4b, mitochondrial genes mt-Nd3 / Nd4l / Co2 / Co3 / COx8b and mitochondrial ATP metabolism-related genes mt-ATP6 / 8, such as Figure 7 As shown. KEGG cluster analysis results showed that differential gene functions were significantly enriched in Parkinson's disease, prion disease, oxidative phosphorylation, and mitochondrial dysfunction, such as Figure 8 shown.

[0153] Example 10 Behavioral testing

[0154] Behavioral analysis was performed 14 days after CS modeling when the surviving mice recovered from systemic disease symptoms.

[0155] (1) Elevated plus maze (EPM): An elevated plus maze was used, 100 cm above the ground, containing two opposing open arms and two closed arms (31×5.8 cm), as well as a crossover area (5.8×5.8 cm). The mouse was placed in the crossover area, facing an open arm, and its movement trajectory was tracked for 5 minutes. After each trial, the elevated plus maze was cleaned with 70% ethanol to ensure consistent experimental conditions. The results are shown in Figure 2. Figure 11 As shown, the high altitude cross maze reflects HLA DP / DRA-IAβ - / - group and IAβ - / - The group had less activity frequency, time and distance in the open arms, and showed HLA DP / DRA-IAβ - / - The anxiety level of the group was higher than that of the other two groups, with a significant difference.

[0156] (2) Barnes maze (BM): A circular platform with a diameter of 120 cm was used, mounted on a rotatable stand, 100 cm above the ground, and continuously illuminated by two light sources (900–1000 lux). The maze contained 18 holes of equal size, pseudo-randomly distributed. During the training phase (days 1–3), an escape box was placed under one hole, while the other holes were empty. The location of the escape box remained unchanged for each mouse. After each trial, the maze was cleaned with 70% ethanol. During the training phase, mice were placed in an opaque metal cylinder located in the center of the maze for 60 seconds. Thereafter, mice were allowed to explore the maze for 3 minutes and then gently guided to the escape box, where they could stay for 2 minutes. Mice were videotaped and recorded using an animal behavior video analysis system for 3 minutes or until they entered the escape box. During the testing phase (day 4), all holes were empty and mice were videotaped for 2 minutes to assess the time and distance spent in the target quadrant (where the escape box was previously located). Results are shown in Figure 2. Figure 12 As shown, the Barnes maze showed HLA DP / DRA-IAβ - / - The mice had the longest latency, moved less around the target hole, and showed significant deficits in learning and memory abilities.

[0157] (3) Open field test (OF): A homemade square box (50×50 cm) was used, and the light intensity decreased from the center to the periphery (200 lux to 120 lux). The open field was divided into a central area (25×25 cm) and a peripheral area. Mice were allowed to explore freely in the open field for 5 minutes, while the animals were videotaped and tracked (using an animal behavior video analysis system, Cyons Bio, Jiangsu, China). After each trial, the open field was cleaned with 70% ethanol. The results are shown in Figure 2. Figure 13 As shown, the open field test results showed that HLA DP / DRA-IAβ - / - The activity of the mouse group was significantly weaker than that of the other three groups, and the activity of the center was HLA DP / DRA-IAβ - / - group and IAβ - / - The group was weaker and showed HLADP / DRA-IAβ - / - The symptoms of the two groups were severe, with significant differences, HLADP / DRA-IAβ - / - Mouse group (and IAβ - / - group) had a higher level of anxiety than the other two groups.

[0158] The above description is only a preferred embodiment of the present invention and does not constitute any formal or substantial limitation to the present invention. It should be noted that ordinary technicians in this technical field can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. A method for preparing a septic encephalopathy model based on HLA class II gene humanized mice, characterized in that: include: Utilizing HLADP401 / DRA-IAβ - / - Transgenic humanized mice were injected intraperitoneally with mouse cecal slurry to induce sepsis, and a septic encephalopathy model was successfully established by screening using the MSS score.

2. The method for preparing a septic encephalopathy model according to claim 1, wherein: The mouse cecal slurry was derived from 8-12 week old female C57BL / 6 mice.

3. The method for preparing a septic encephalopathy model according to claim 1, wherein: The injection dose of the cecal slurry is 1.25-1.5 mg / g mouse body weight.

4. The method for preparing a septic encephalopathy model according to claim 1, wherein: The criteria for passing the MSS score screening are: an average clinical MSS score of 14 points or more over 3 days.

5. The method for preparing a septic encephalopathy model according to claim 1, wherein: The following analyses and evaluations of the septic encephalopathy model are also included: 1) Weigh and observe the health status of each group of infected mice daily, record the survival status of each group of infected mice, and draw weight curves, survival curves, and clinical score MSS curves every 24 hours; 2) ELISA was used to detect serum cytokines TNFα / IL-6 / IL-1β on the first day after model establishment, and real-time quantitative PCR was used to detect the expression levels of inflammatory cytokines in the hippocampus on day 1, including CCL2, CCL3, CXCL10, TNFα, IL-6, and IL-1β; 3) Immunofluorescence staining to detect microglial cell (IBA-1) activation in the hippocampus; 4) Hippocampal tissue pathology: Golgi staining was used to detect the morphological details of dendritic spines of hippocampal neurons and glial cells on the third and fourteenth days after modeling; 5) Obtain the hippocampus for transcriptome sequencing (RNA-Seq) on the third day after modeling, and perform KEGG, GO, and other analyses on the sequencing results; obtain sequence and expression information of all transcripts in the hippocampus tissue on the third day after modeling, and analyze gene expression differences and gene structural variations; 6) Behavioral testing: The open field test, elevated cross maze, and Barnes maze were used to evaluate the emotional dysfunction of the model mice on the fourteenth day after modeling.

6. Use of the septic encephalopathy model prepared by the septic encephalopathy model preparation method according to any one of claims 1 to 5 in studying the pathogenesis of sepsis-related encephalopathy and / or screening therapeutic drugs for sepsis-related encephalopathy.

7. A method for screening drugs for treating sepsis-related encephalopathy, characterized in that: include: A) in a test group, a septic encephalopathy model prepared by the septic encephalopathy model preparation method according to any one of claims 1 to 5 is administered a test drug for a period of time, and a clinical indicator E1 of sepsis-related encephalopathy in the test group is detected; and in a control group that does not administer the test drug and has the same other conditions, a clinical indicator E2 of sepsis-related encephalopathy in the control group is detected; and B) E1 and E2 are compared. If E1 is significantly improved relative to E2, it indicates that the test drug is a potential therapeutic drug for sepsis-related encephalopathy.

8. The method according to claim 7, characterized in that The clinical indicators of sepsis-related encephalopathy include one or more of the following 1)-7): 1) MSS clinical score to evaluate the progression of sepsis in real time; 2) ELISA to detect inflammatory cytokines in the model serum to evaluate the systemic infection immune response status of the model; 3) QPCR to detect the immune response of hippocampal tissue; 4) Immunofluorescence staining to evaluate the activation status of microglia (IBA-1) in the hippocampus; 5) Golgi staining to evaluate the morphological changes of hippocampal neurons and glial cell dendritic spines; 6) transcriptome sequencing to detect changes in hippocampal gene expression; 7) behavioral evaluation of emotional dysfunction in model mice.

Citation Information

Patent Citations

  • Application of catalpol in medicine for treating sepsis-related encephalopathy

    CN116236495A

  • Application of CCR5hi innate immune memory cell in preparation of immunotherapy drug for treating sepsis

    CN119896727A

  • Immune-privileged nerve cell differentiated from induced pluripotent stem cell and use thereof

    WO2024251119A1

Cited By

  • Method, equipment, medium and program product for evaluating treatment effect of levosimendan on sepsis-related encephalopathy

    CN121260526A