Application of PagBAG8 gene in regulation and control of growth and development of poplar

By overexpressing the PagBAG8 gene, the growth and xylem development of poplar trees were regulated, the unclear molecular mechanism of poplar wood formation was solved, and the precise improvement of poplar wood quality was achieved.

CN120648744AActive Publication Date: 2025-09-16ZHEJIANG FORESTRY UNIVERSITY

Patent Information

Application Number
CN202511157858.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-09-16
Estimated Expiration
2045-08-19

AI Technical Summary

Technical Problem

There is a lack of research on the functions of BAG family genes in poplar in the existing technology, the molecular mechanism of wood formation has not yet been clarified, and there is a lack of effective gene regulation methods to improve the quality of poplar wood.

Method used

By overexpressing the PagBAG8 gene, the development of poplar xylem and leaves was regulated. The nucleotide sequence of the PagBAG8 gene (such as SEQ ID NO: 1) was used to construct an overexpression vector. After transforming poplar trees, their growth and xylem development were significantly inhibited, including reducing plant height, ground diameter, internode length, leaf area and cellulose content.

Benefits of technology

It significantly inhibits the growth of poplar trees, regulates the development of xylem, reduces the xylem width, the number of cell layers and the thickness of the fiber cell wall, and reduces the cellulose content, providing a molecular target for genetic engineering to improve the quality of poplar wood, which meets the needs of the industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648744A_ABST
    Figure CN120648744A_ABST
Patent Text Reader

Abstract

The invention discloses application of a PagBAG8 gene in regulation and control of poplar growth and development, and belongs to the technical field of forestry biological genetic engineering. According to the application of the PagBAG8 gene in regulating and controlling growth and development of the poplar, the nucleotide sequence of the PagBAG8 gene is shown as SEQ ID NO: 1, and the method for cultivating the transgenic poplar through the PagBAG8 gene comprises the following steps that the PagBAG8 gene of the poplar is cloned; the PagBAG8 gene is connected to a vector, and an overexpression vector is obtained; transforming the obtained overexpression vector into agrobacterium to obtain an agrobacterium liquid; and infecting poplar leaves with the obtained agrobacterium liquid to obtain a PagBAG8 gene overexpression plant. The invention provides a new choice for regulating and controlling the growth and development of the poplar, and provides a potential target for molecular breeding improvement of the properties of the poplar.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of forestry biological genetic engineering technology, specifically relates to PagBAG8 Application of genes in regulating poplar growth and development. Background Art

[0002] As an important renewable resource, wood plays an irreplaceable role in construction, papermaking, energy, and other fields. Its formation involves a series of complex biological processes, including plant vascular tissue development and secondary cell wall synthesis, and is precisely regulated by multiple genes and molecular mechanisms. The BAG (Bcl-2-associated athanogene) protein family, as highly evolutionarily conserved molecular chaperone cofactors, is widely involved in plant growth and development, stress response, and programmed cell death. Their C-terminal BAG domain can interact with heat shock proteins, while the plant-specific IQ motif can also participate in signal transduction by binding to calmodulin. Their functions have been partially elucidated in model plants such as Arabidopsis thaliana and rice.

[0003] Poplar is an important fast-growing timber species, and research on its wood formation mechanisms is of great significance for forest genetic improvement. Although some key genes involved in wood formation have been identified in poplar, such as SND1 from the NAC family and MYB46 from the MYB family, research on the functions of BAG family genes in poplar remains relatively scarce. Their specific mechanisms of action are still unclear, and the functions of related genes and their molecular regulatory networks remain to be elucidated.

[0004] Therefore, in-depth research on the effects of poplar BAG family genes, especially those highly expressed in xylem, on wood formation and clarifying the key biological processes and interacting proteins regulated by them can provide new theoretical basis for analyzing the molecular mechanism of wood formation and lay the foundation for improving the quality of poplar wood through genetic engineering. Summary of the Invention

[0005] The present invention aims to provide PagBAG8 The application of genes in regulating the growth and development of poplars provides a new option for regulating the growth and development of poplars, and PagBAG8 The gene can specifically regulate the development of poplar xylem and leaves, providing a theoretical basis for the regulatory role in the growth and development of woody plants, and providing potential targets for molecular breeding improvement of poplar traits.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows: PagBAG8 Application of genes in regulating the growth and development of poplars, the PagBAG8 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0007] Preferably, by regulating PagBAG8 The expression level of the gene regulates poplar xylem development and / or leaf development.

[0008] Preferably, by overexpressing the PagBAG8 The gene causes the plant to grow and develop slowly, with reduced plant height, ground diameter and internode length, reduced stem xylem width and lower cellulose synthesis.

[0009] Preferably, by overexpressing the PagBAG8 The gene reduces the plant's leaf area and lowers the leaf length-to-width ratio.

[0010] The present invention also provides an overexpression vector for regulating the growth and development of poplar, the overexpression vector comprising the PagBAG8 Gene.

[0011] The present invention also provides a strain for regulating the growth and development of poplars, wherein the strain comprises the overexpression vector.

[0012] The present invention also provides a method for utilizing the PagBAG8 The method for genetically cultivating transgenic poplars comprises the following steps: S1. Cloned poplars PagBAG8 Gene; S2, the PagBAG8 The gene is connected to the vector to obtain an expression vector; S3, transforming the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial liquid; S4, infecting poplar leaves with the Agrobacterium solution obtained in S3, PagBAG8 Gene overexpression plants.

[0013] Preferably, the poplar cloned in S1 PagBAG8 The specific gene operations are: Total RNA was extracted from poplar and reverse transcribed into cDNA as template. PagBAG8 -CDS-F and PagBAG8 -CDS-R was amplified by PCR to obtain PagBAG8 Gene.

[0014] Preferably, the primer PagBAG8 -CDS-F nucleotide sequence is shown in SEQ ID NO.2, the primer PagBAG8 The nucleotide sequence of -CDS-R is shown in SEQ ID NO.3.

[0015] Compared with the prior art, the present invention has the following advantages and technical effects: The present invention discloses PagBAG8 Application of genes in regulating poplar growth and development, overexpression PagBAG8It can significantly inhibit the growth of poplar trees, significantly reduce plant height, ground diameter, internode length and leaf area, and make the leaves more rounded; at the same time, it can effectively regulate the development of xylem, significantly reduce the xylem width, number of cell layers, fiber cell length and wood fiber cell wall thickness, and significantly reduce the cellulose content. PagBAG8 Its key regulatory role in the formation of poplar wood provides specific molecular targets for the precise improvement of poplar wood quality through genetic engineering, helps to cultivate new poplar varieties that meet industry needs, and has important application value.

[0016] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 for PagBAG8 Relative expression levels in different tissues of 84K poplar; Figure 2 for PagBAG8 stem-specific expression analysis; Figure 3 for PagBAG8 subcellular localization; Figure 4 for PagBAG8 Agrobacterium-mediated genetic transformation process, in which Figure 4 A in the figure indicates infected leaves. Figure 4 B in the figure is callus tissue. Figure 4 C in the figure represents adventitious bud differentiation. Figure 4 D in PagBAG8 Overexpression plants, scale bar is 1 cm; Figure 5 for PagBAG8 The identification results of overexpression plants, among which, Figure 5 A in the figure is the result of DNA-PCR agarose gel electrophoresis. Figure 5 B in the figure is the relative expression result of RT-qPCR; Figure 6 for PagBAG8 Phenotypic analysis of overexpression plants, including Figure 6 A in the figure is a 10-week-old soil-grown seedling, and the scale is 10 cm. Figure 6 B in the figure is internode 1 to 20, with a scale of 5 cm. Figure 6 C in the table is the statistical result of plant height, Figure 6 D in is the statistical result of ground diameter; Figure 7 The results of TBO staining are shown in the cross-sections of the 11th internode of the stem of transgenic and WT plants. The scale bar is 500 μm. Figure 8 Statistical results of xylem width and cell layer number of transgenic and WT plants, among which, Figure 8 A in the figure is a cross section of the 11th internode of the stem, with a scale of 200 μm. Figure 8 B is the width of the xylem, n=50, Figure 8 C in is the number of xylem cell layers, n = 100; Figure 9 The electron microscopy results of transgenic and WT plants are shown in Figure 2. Figure 9 A in the figure shows the cell wall at magnifications of 180 times (scale bar = 300 μm) and 800 times (scale bar = 50 μm). Figure 9 B in the figure is the cloud and rain distribution, n=500; Figure 10 This is the staining result of the cross section of the 11th internode of the stem; Figure 11 is the result of fiber separation and cell length measurement, where Figure 11 A in the figure is the microscopic observation result of wood fiber cells and bast fiber cells, the scale bar is 200 μm, Figure 11 B is the length of wood fiber cells, n=500, Figure 11 C in is the length of bast fiber cells, n=300; Figure 12 is the statistical result of the total leaf area and aspect ratio, where Figure 12 A in the figure is the leaf scanning result, and the scale is 5cm. Figure 12 B in the figure is the total leaf area statistics of leaves 1 to 15. Figure 12 C is the average aspect ratio of leaves 1 to 15. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0019] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0020] Source of test materials: 1× TAE running buffer (1 L): 20 mL of 50× TAE stock solution (US EVERBRIGHT #DZ8039) was added to 980 mL of deionized water to make up to 1 L.

[0021] 1% agarose gel: Add 0.5 g agarose powder (Bioweste Agarose) to 50 mL 1× TAE solution and heat in a microwave until completely melted. Add 1 μL nucleic acid dye (GelRed, Vazyme) and mix well. Pour into a mold, insert a comb to leave holes for sample loading, and let cool before use.

[0022] GUS buffer (1 L) formula: Mix 97.5 mL of 0.2 M NaH2PO4, 152.5 mL of 0.2 M Na2HPO4, 2 mL of 0.2% Triton-100, 20 mL of 100 mM K3Fe(CN)6, and 20 mL of 100 mM K4Fe(CN), dilute to 1 L with deionized water, and store at 4°C in the dark.

[0023] GUS staining solution recipe: Add 0.05218 g X-Gluc (dissolved in DMSO to make a 1 mM solution) to 100 mL of GUS buffer and use immediately.

[0024] Tobacco suspension formula (100 mL): 1 M MES 1 mL, 1 M MgCl2 1 mL, 20 μM AS, dilute to 100 mL with deionized water, ready for use.

[0025] Formula for WPM suspension (1 L): WPM 2.4 g, MES 0.5 g, 2,4-D 1 mg / L, KT 0.1 mg / L, sucrose 20 g, 100 μM AS, adjust the pH to 5.9 with NaOH solution, sterilize at 121°C for 20 min, and add 100 μM acetosyringone after cooling to 40°C.

[0026] LB medium (1 L): Tryptone (OXOID #LP0042) 10 g, yeast extract (OXOID #LP0021) 5 g, sodium chloride (NaCl, Shanghai Test) 5 g, solid LB medium also needs to be supplemented with agar powder 7.8 g (Agar, Shanghai Biotech #A505255), and the volume is adjusted with deionized water. Sterilize in an autoclave at 121°C for 20 min.

[0027] Formula for 1 / 2MS rooting medium (1 L): MS 519 2.2 g, MES 0.5 g, NAA 0.05 mg / L, IBA 0.02 mg / L, sugar 20 g, dilute to 1 L with deionized water, adjust the pH to 5.9 with NaOH solution, add agar powder 7.8 g, sterilize in an autoclave at 121°C for 20 min, cool to 40°C, and then add 200 mg of Timentin.

[0028] Formula of co-culture medium (1 L): WPM L449 2.4 g, MES 0.5 g, sugar 20 g, dilute to 1 L with deionized water, adjust the pH to 5.9 with NaOH, add 3.2 g of plant gel, sterilize in an autoclave at 121°C for 20 min, and add 100 μM acetosyringone after cooling to 40°C.

[0029] Formula of differentiation screening medium (1 L): WPM L449 2.4 g, MES 0.5 g, NAA 0.1 mg / L, 6-BA 0.5 mg / L, sugar 20 g, dilute to 1 L with deionized water, adjust the pH to 5.9 with NaOH solution, add 3.2 g of phytogenin, sterilize in an autoclave at 121°C for 20 min, cool to 40°C, and add 200 mg of timentin, 1.5 mg of hygromycin, or 1.5 mg of G418.

[0030] Formula of callus induction medium (1 L): WPM L449 2.4 g, MES 0.5 g, 2,4-D 2 mg / L, NAA 0.1 mg / L, KT 0.1 mg / L, sugar 20 g, add water to 1 L, adjust the pH to 5.9 with NaOH solution, add phytagel 3.2 g, and sterilize in an autoclave at 121°C for 20 min.

[0031] In the present invention, unless otherwise specified, the materials, reagents, enzymes, competent cells, plasmids, and instruments used are conventional experimental materials in the field and can be purchased through commercial channels.

[0032] Example 1 Total RNA was extracted from 84K poplar and cDNA was obtained using a reverse transcription kit. PCR amplification was performed using the designed specific primers. PagBAG8 The full-length gene sequence was obtained and the PCR product was cloned into a vector to construct an overexpression vector. The correctness of the overexpression vector was verified by bacterial testing and sequencing. The cloning primers were PagBAG8 -CDS-F and PagBAG8 -CDS-R. PagBAG8 The nucleotide sequence of the gene is shown in SEQ ID NO.1. PagBAG8 -CDS-F nucleotide sequence is shown in SEQ ID NO.2, PagBAG8 The nucleotide sequence of -CDS-R is shown in SEQ ID NO.3.

[0033] SEQ ID NO.1: 。

[0034] SEQ ID NO.2: GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGAAAAGCTCAACTTCAAAAGGTACAG。

[0035] SEQ ID NO.3: GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGTCAAACAGCTCCCAGTCC.

[0036] Add the required polymerase chain reaction components to a 100 μL PCR tube, using 84K poplar cDNA as the cloning template for PCR amplification. The PCR protocol was as follows: initial denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds; annealing at 72°C for 15 seconds; extension at 55°C for 2 minutes; 30 cycles; and a final extension at 72°C for 5 minutes. After amplification, the PCR product was used for subsequent analysis.

[0037] Reaction system: 2× Phanta Flash Master Mix 10 μL; PagBAG8 -CDS-F (10 μM) 0.5 μL; PagBAG8 -CDS-R (10 μM) 0.5 μL; cDNA template 1 μL; sterile water is added to 20 μL.

[0038] After PCR product amplification, the amplified product was recovered by agarose gel electrophoresis to obtain PagBAG8 To identify the CDS fragment of a gene, a 1% agarose gel was prepared with 1× TAE and inserted into a medium-hole comb. 4 μL of 6× Loading Buffer (Novagen, P022-01, Nanjing) was added to the PCR reaction system. After the agarose gel solidified, 5 μL of DL2000 DNA Marker (Novagen, MD102-01, Nanjing) was spotted. 20 μL of the PCR reaction solution was spotted into each well for agarose gel electrophoresis. The gel was observed under a UV transilluminator, and the position and size of the DNA bands were recorded. The amplified fragments were then excised and recovered and stored at -20°C until further use.

[0039] Will obtain PagBAG8 The gel-recovered product of the gene was subjected to BP ligation reaction with the intermediate vector pDONR207. E. coli DH5α competent cells were used to obtain the plasmid. The constructed pDONR207- PagBAG8 The Escherichia coli stably expressed by the vector has Gen resistance.

[0040] BP reaction system: PagBAG8 Gel recovery product 1-7 μL (150 ng); pDONR207 vector 1 μL (150 ng); BPClonase TM II Mix 2 μL; add TE buffer to 10 μL.

[0041] pDONR207- was obtained by BP reaction. PagBAG8After the plasmid was obtained, it was subjected to LR ligation reaction with the final vector pK2GW7-eYGFP and reacted at room temperature (25°C) for 1 hour before being used for transformation E. coli DH5α competent cells, obtained 35S:: PagBAG8 The constructed pK2GW7-eYGFP vector stably expresses Spec-resistant Escherichia coli.

[0042] LR reaction system: pDONR207- PagBAG8 Vector 1-7 μL (150 ng); pK2GW7-eYGFP vector 1 μL (150 ng); LR Clonase TM II Mix 2 μL; add TE buffer to 10 μL.

[0043] The correctly sequenced eYGFP- PagBAG8 The plasmids were stored at -20°C for subsequent Agrobacterium genetic transformation.

[0044] Plasmid extraction and sequencing: Positive monoclonal colonies were picked and inoculated into LB liquid medium containing the appropriate antibiotics. Culture was shaken at 37°C overnight. Extraction was performed using a plasmid extraction kit (Welling, NG218S) according to the manufacturer's instructions. Plasmid concentration and quality were determined and stored at -20°C until needed.

[0045] Agrobacterium GV3101 transformation: Transformation of Agrobacterium: The extracted correct plasmid was added into Agrobacterium GV3101 competent cells (purchased from Shanghai Weidi Biological Company, refer to the instruction manual for specific operations).

[0046] 84K Poplar Genetic Transformation: PagBAG8 After the overexpression vector was transferred into the Agrobacterium tumefaciens GV3101 strain, the 84K poplar genetic transformation experiment was conducted. Healthy, strong, and sterile leaves of 84K tissue culture seedlings were used as material. Overexpression plants were obtained by infecting the leaves with the target gene via the Agrobacterium-mediated leaf disc method.

[0047] Agrobacterium-mediated transformation of Populus silergoniae 84K (1) Preparation of bacterial liquid: Pick a single colony of Agrobacterium, inoculate it into LB liquid medium containing the corresponding antibiotics, and culture it at 28℃ with shaking overnight until the OD 600 The value was 0.5. Centrifuge at 4000 rpm for 5 min, discard the supernatant, and resuspend the bacteria in a triangular flask with WPM suspension. The OD value of the resuspended bacteria was 0.5. 600 =0.6, set aside.

[0048] (2) Infection and co-cultivation: Use a sterile blade to create wounds along the veins of fresh leaves. Then, place the wounded leaves in the resuspended bacterial solution and completely infect them for 15 minutes. Gently shake the bacterial solution during infection to ensure sufficient contact between the leaves and Agrobacterium. After infection, remove the leaves and place them on sterile filter paper. Blot the surface bacterial solution dry and prepare for the next step.

[0049] Drain the bacterial suspension from the leaf blade and spread it flat on a co-culture plate. Incubate in the dark for approximately two days. Observe the leaf edges for the appearance of colonies to ensure the effectiveness of the co-culture, but avoid large areas of bacterial plaque. Transfer the co-cultured leaf blade to differentiation medium and change the medium every three weeks for approximately six weeks to induce adventitious buds to differentiate.

[0050] (3) Rooting culture of adventitious buds. Cut the adventitious buds and inoculate them into 1 / 2 MS rooting medium with corresponding resistance. Culture them under light for 7-15 days until the adventitious buds take root. After one month of growth, they can be used for tissue culture seedling subculture and transgenic plants can be screened and identified.

[0051] The transformed tissue culture seedlings were inoculated into 1 / 2MS rooting medium for growth. PagBAG8 The overexpression vector is fused with fluorescent protein, and strong green fluorescence can be observed under ultraviolet irradiation. This feature can be used to preliminarily identify 35S:: PagBAG8 Whether the overexpression vector has been integrated into the 84K genome. Select the tissue culture seedlings with fluorescence and number them in sequence as OE#1, OE#2, OE#3, etc., and perform identification at the DNA and RNA levels.

[0052] DNA extraction and detection: DNA was extracted according to the CTAB method; RNA was extracted according to the Biofit RNA extraction kit.

[0053] RNA reverse transcription: RNA reverse transcription was performed using the Evo M-MLV reverse transcription kit (#AG11728). Genomic DNA was removed from the extracted RNA sample and then reverse transcribed to synthesize cDNA.

[0054] gDNA removal reaction system: 5×gDNA Clean Reaction Mix 2μL; Total RNA 1000ng; RNase-free water is added to 10μL, and the reaction is continued at 42℃ for 2min.

[0055] Reverse transcription reaction system: 10 μL of the reaction mixture from the previous step; 4 μL of 5× Evo M-MLV RT Reaction Mix; 6 μL of RNase-free water. Incubate at 37°C for 15 min; then at 85°C for 5 s, then cool to 4°C.

[0056] The cDNA obtained above was subjected to quantitative PCR analysis. Before the quantitative PCR reaction, the cDNA was designed by NCBI website. PagBAG8 Specific fluorescent quantitative primers were used to control the amplified sequence length within the range of 150 bp-250 bp, and UBQ quantitative reaction was used as a control for the experimental results.

[0057] The quantitative primer sequences are shown in SEQ ID NO.4-SEQ ID NO.7.

[0058] UBQ-F: SEQ ID NO. 4: 5'-GACTTTGACCGGAAAGACCA-3'.

[0059] UBQ-R: SEQ ID NO. 5: 5'-GGAGACGAAGGACAAGGTGA-3'.

[0060] PagBAG8 -Quantitative-F: SEQ ID NO. 6: 5'-GCAGAGAAGGATTGAGGTTC-3'.

[0061] PagBAG8 -Quantitative-R: SEQ ID NO. 7: 5'-CCATTTGGTCGTCACCGAT-3'.

[0062] The quantitative PCR reaction program was as follows: 95°C for 1 min; 95°C for 10 s; 57°C for 10 s, and 72°C for 20 s, for 45 cycles; the melting curve was determined from 65°C to 95°C. Each reaction was repeated 4 times. The data reliability was analyzed based on the melting curve and amplification curve. Methods were used to calculate the expression level of target genes.

[0063] Real-time fluorescence quantitative PCR reaction system: 2×SYBR Green Pro Taq HS Premix 5 μL; Primer F (10 μM) 0.2 μL; Primer R (10 μM) 0.2 μL; cDNA template 1 μL; sterile water added to 10 μL.

[0064] Subcellular localization: Construction of subcellular localization vector The pMDC43-GFP green fluorescent protein tag was constructed by the Gateway method. PagBAG8The vector was used for subcellular localization experiments, where the Gateway linker sequence included a forward linker (SEQ ID NO. 2) and a reverse linker (SEQ ID NO. 3). The Gateway experiment included BP and LR reactions, as described above. The constructed vector was transformed into Agrobacterium GV3101 (pSoup-p19) (purchased from Shanghai Weidi Biological Company, for specific operations, refer to the instructions). The Agrobacterium cells were suspended in suspension solution to OD600 = 1.0 and injected into the back of nuclear marker tobacco leaves. After incubation in the dark for 1 day and then in the light for 2 days, pMDC43- PagBAG8 The vector was transiently expressed in tobacco. After culture, the distribution of green fluorescence signals in the leaves was observed under a laser confocal microscope. The nuclear marker-type tobacco cell nuclei emitted red fluorescence under the RFP channel.

[0065] The test results are as follows: PagBAG8 Tissue-specific expression pattern analysis, the results are as follows Figure 1 shown.

[0066] Depend on Figure 1 It can be seen that PagBAG8 The gene expression levels in different tissues of 84K poplar were different. The expression level in stem tissue was higher than that in other tissues, especially in the 5th to 11th internodes of the stem, and the expression level in the root was the lowest.

[0067] PagBAG8 The results of stem-specific expression analysis are as follows Figure 2 shown.

[0068] Depend on Figure 2 It can be seen that PagBAG8 The expression level in xylem was higher, indicating that the gene was more active in the vascular tissue of poplar. This result further confirmed PagBAG8 The gene may play an important role in poplar xylem and affect the formation of poplar wood.

[0069] PagBAG8 Subcellular localization analysis results Figure 3 shown.

[0070] Depend on Figure 3 It can be seen that the green fluorescence signal is obviously concentrated in the nucleus and cytoplasm, which is highly coincident with the position of the nucleus marker, indicating that PagBAG8 Proteins mainly function in the nucleus and cytoplasm. PagBAG8 As a molecular chaperone protein, its main function is to assist proteins in correct folding, assembly, transport and degradation, mediate the correct assembly of other proteins, and play an important role in maintaining protein homeostasis.

[0071] PagBAG8 Identification and analysis of overexpressing plants, 84K poplar genetic transformation process as follows Figure 4 shown.

[0072] Depend on Figure 4 It can be seen that the genetic transformation process includes four main steps: tissue infection, induction of differentiation and budding, resistance screening, and rooting culture. 84K leaves and callus tissues are infected with Agrobacterium, and adventitious buds are induced to grow on the differentiation medium. The fluorescent adventitious buds are inoculated into the rooting medium for growth to obtain new stable genetically modified plants.

[0073] PagBAG8 Identification of overexpressing plants and RT-qPCR quantitative analysis, the results are as follows Figure 5 .

[0074] The genomic DNA of the fluorescent strain was extracted and PCR reaction was performed to amplify the specific fragment. The wild type 84K was used as a negative control, and the 35S:: PagBAG8 The vector plasmid is a positive control, and the target fragment size is about 1000 bp. It is used to detect whether 35S:: PagBAG8 Vector sequence ( Figure 5 A in Figure ). Further analysis of these 10 overexpressed PagBAG8 The positive transgenic plants of the gene were analyzed at the transcriptional level. Figure 5 B in the above table, select the three strains with the highest expression levels PagBAG8 -OE#32, PagBAG8 -OE#61, PagBAG8 -OE#63.

[0075] Example 2 Poplar PagBAG8 Gene function verification, the specific experimental plan is as follows: After about three weeks of rooting, transplant the seedlings into nutrient soil and continue growing for another 8-10 weeks. Water the soil every three days to maintain good growth conditions, keeping them consistent across all groups.

[0076] Determination of growth indicators of transgenic and WT plants: After the plants were cultured and grown in the greenhouse for 8 to 10 weeks, phenotypic measurements were performed and recorded, including plant height, ground diameter, and number of internodes.

[0077] Observation of stem tissue sections of transgenic and WT plants: The cross sections of the cut stems were stained with 0.1% toluidine blue (TBO) solution, 1% phloroglucinol solution and whitening agent (CFW), and observed with a Leica DM6 B upright fluorescence microscope, and photographed and recorded.

[0078] Scanning electron microscopy observation: A Hitachi desktop scanning electron microscope TM4000 was used to observe tissue sections and fresh leaves, and photos were taken under low-power and high-power microscopes to obtain photos for comparative analysis.

[0079] Fiber cell isolation: Take the 12th internode stem segment of the plant for fiber isolation, peel off the epidermis and lignified stem segment, cut into small pieces and put into a 2mL centrifuge tube, add an appropriate amount of isolation liquid and react in a metal bath at 60℃ for 48h. After the bark and stem segment are completely dissociated into flocs, centrifuge at low speed to pour out the isolation liquid, wash with deionized water 2-3 times to remove the remaining isolation liquid, then add deionized water to suspend the fiber cells for observation and observe under a microscope.

[0080] Cell wall composition analysis: Fresh plant samples were stripped of bark, labeled, and oven-dried at 80°C for 72 hours until constant weight was achieved. The dried stem segments were then thoroughly ground into a powder using a ball mill and sieved for sample collection. Cellulose content was determined using the anthrone method, and the final content was determined using an enzyme-labeled assay. Cellulose content was determined using the Mengxi Biotechnology M1733B kit. Refer to the kit instructions for the specific test protocol.

[0081] The xylem width, number of cell layers, fiber cell length and other data were measured using ImageJ software based on the tissue section photos.

[0082] The test results are as follows: PagBAG8 The phenotypic analysis results of transgenic plants are as follows Figure 6 shown.

[0083] Depend on Figure 6 It can be seen that the overexpression lines PagBAG8- OE#61 and PagBAG8- The plant height of OE#63 was significantly smaller than that of WT, decreasing by 20.5% and 15.5% respectively. The ground diameter of the overexpression strain was significantly smaller than that of WT, with an average decrease of 23.0% and 16.1% respectively. PagBAG8 It plays an important role in the growth of poplar trees. PagBAG8 It inhibits the growth of poplar plants, causing them to be noticeably shorter and thinner.

[0084] PagBAG8 Analysis of stem tissue sections of transgenic plants showed the following results: Figure 7 shown.

[0085] Depend on Figure 7 It can be seen from TBO staining observation and comparison that the stem diameters of the overexpression lines OE#61 and OE#63 are smaller than that of the WT. The results of the above plant phenotypic analysis show that the overexpression lines are shorter and thinner than the WT, which is consistent with the section results.

[0086] The structural differences between different strains are as follows Figure 8 As shown in Figure A, by measuring the xylem width and the number of xylem cell layers at the 11th internode of the stem, it was found that the xylem width of the overexpression lines OE#61 and OE#63 was significantly smaller than that of the WT, decreasing by 27.0% and 13.3%, respectively; the number of xylem cell layers was also less than that of the WT, decreasing by 26.7% and 20.4%, respectively ( Figure 8 B and Figure 8 C in ).

[0087] The electron microscopy results are as follows Figure 9 As shown in A. Figure 9 As shown in Figure B, the cell wall thickness of the overexpression lines OE#61 and OE#63 was significantly less than that of WT, with the average values ​​reduced by 29.1% and 46.5%, respectively.

[0088] The results showed that PagBAG8 The stems of the overexpression lines were thinner than those of the WT, the width of the xylem was narrower, and the number of wood fiber cell layers was less. Scanning electron microscopy revealed that the thickness of the wood fiber cell walls of the overexpression lines was reduced. PagBAG8 Inhibiting the growth and development of xylem cells in poplar stems may affect the formation of poplar wood.

[0089] PagBAG8 Effects on wood formation, results such as Figure 10 shown.

[0090] Depend on Figure 10 It can be seen that the fibers and ducts of the overexpression lines were lighter in color and showed weaker signals, while stronger signals were observed in the fibers and ducts of the WT plants.

[0091] The fiber separation process was carried out on the 12th internode of poplar stems. Figure 11 shown.

[0092] The dissociated wood fiber cells and bast fiber cells were used for fiber observation and analysis. The cell length was measured. The number of wood fiber cells was 500 and the number of bast fiber cells was 300. Figure 11 As shown in A. Figure 11 B and Figure 11 As shown in C, compared with WT, the lengths of wood fiber cells and phloem fiber cells in overexpression lines OE#61 and OE#63 were significantly reduced, with the average lengths of wood fiber cells decreasing by 5.5% and 11.2%, and the average lengths of phloem fiber cells decreasing by 4.2% and 12.0%, respectively.

[0093] PagBAG8 Effects on leaf development. Figure 12 shown.

[0094] Scanning electron microscopy was used to observe the morphology and size of leaf epidermal cells. Figure 12 As shown in A. Figure 12 As shown in B, the total leaf area of ​​the overexpression lines OE#61 and OE#63 was significantly reduced compared with the WT, by 47.7% and 50.1%, respectively. The average length-to-width ratio of 15 leaves was calculated, and the results showed that the length-to-width ratio of the overexpression lines was smaller than that of the WT, and the overall shape of the leaves appeared more rounded ( Figure 12 C in ).

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. PagBAG8 The application of genes in regulating the growth and development of poplars is characterized by: described PagBAG8 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that Through regulation PagBAG8 The expression level of the gene regulates poplar xylem development and / or leaf development.

3. The application according to claim 2, characterized in that: By overexpressing the PagBAG8 The gene causes the plant to grow and develop slowly, with reduced plant height, ground diameter and internode length, reduced stem xylem width and lower cellulose synthesis.

4. The application according to claim 2, characterized in that: By overexpressing the PagBAG8 The gene reduces the plant's leaf area and lowers the leaf length-to-width ratio.

5. An overexpression vector for regulating the growth and development of poplar, characterized in that: The overexpression vector comprises the PagBAG8 Gene.

6. A strain for regulating the growth and development of poplars, characterized in that: The strain comprises the overexpression vector according to claim 5.

7. A method of using the method according to claim 1 PagBAG8 A method for genetically breeding transgenic poplars, characterized in that: The following steps are involved: S1. Cloned poplars PagBAG8 Gene; S2, the PagBAG8 The gene is connected to the vector to obtain an expression vector; S3, transforming the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial liquid; S4, infecting poplar leaves with the Agrobacterium solution obtained in S3, PagBAG8 Gene overexpression plants.

8. The method according to claim 7, characterized in that: The poplar clones described in S1 PagBAG8 The specific gene operations are: Total RNA was extracted from poplar and reverse transcribed into cDNA as template. PagBAG8 -CDS-F and PagBAG8 -CDS-R was amplified by PCR to obtain PagBAG8 Gene.

9. The method according to claim 7, characterized in that: The primers PagBAG8 -CDS-F nucleotide sequence is shown in SEQ ID NO.2, the primer PagBAG8 The nucleotide sequence of -CDS-R is shown in SEQ ID NO.3.

Citation Information

Patent Citations

  • Key gene PeWOX11b for adventitious root development of poplar and application of key gene PeWOX11b

    CN102586272A

  • Sorghum E3 ubiquitin ligase SbBAG4 gene, recombined vector thereof and expression method of gene

    CN109913478A

  • Gene PagCRF8 for regulating and controlling development of leaves and stems of poplar and application of gene PagCRF8

    CN117286152A

  • Gene for regulating and controlling plant type development of poplar and application of gene

    CN117568361A

  • Gene PagGRF12a for regulating and controlling development of leaves and stems of poplar and application of gene PagGRF12a

    CN118726383A

Cited By

  • Application of PagSCL28a gene in regulation and control of growth and development of poplar

    CN120924593A

  • Application of PagUBC10a gene in regulation and control of growth and development of poplar

    CN120944960A

  • Poplar PagTAL3 protein and application of coding gene thereof

    CN121472183A