Genetic molecular marker related to colorectal cancer and having interaction effect with drinking and application of genetic molecular marker

Abstract

The invention discloses a colorectal cancer related genetic molecular marker with an interaction effect with drinking and application of the colorectal cancer related genetic molecular marker. The genetic molecular marker is a combination of rs61355123, rs17624213, rs3791337, rs190489984 and rs2290476. According to the method, the limitation that a traditional genetic model only pays attention to the genetic main effect is broken through, and the multi-gene risk scoring model integrating environmental factors is constructed by recognizing a group of key SNP loci having remarkable interaction with drinking behaviors. The gene-environment collaborative assessment mechanism realizes more accurate risk stratification for drinkers. Clinical test data show that compared with a traditional genetic model, the genetic score of the integrated genetic marker provided by the invention has the following advantages: (1) the prediction accuracy is improved; (2) the clinical practical value is prominent; and (3) the intervention pertinence is enhanced.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and oncology, and specifically relates to a genetic molecular marker associated with colorectal cancer that has an interactive effect with alcohol consumption and its application. The present invention is applied to early risk assessment of malignant tumors and personalized health management, integrating multidisciplinary cross-disciplinary technologies such as human genetics, environmental epidemiology, and bioinformatics, and has important application value in primary prevention and precise screening of tumors. The present invention focuses on the interaction between alcohol exposure and genetic factors. Based on genome-wide association study (GWAS) data and polygenic risk score (PRS) modeling methods, it innovatively constructs a colorectal cancer risk prediction model that integrates drinking behavior characteristics, providing a scientific basis for early identification and precise intervention of high-risk groups for colorectal cancer, and promoting early screening, early diagnosis and precise intervention of colorectal cancer. Background Art

[0002] Colorectal cancer (CRC) is a common digestive system malignancy worldwide. According to statistics, in 2022, there were 1.9261 million new cases and 903,900 deaths from colorectal cancer worldwide, ranking third and second among all cancers, respectively. It is estimated that by 2040, new cases of colorectal cancer will increase to 3.2 million (an increase of approximately 63%), and deaths will increase to 1.6 million (an increase of approximately 73%). In China, colorectal cancer also maintains high morbidity and mortality, ranking second and fourth among all cancers. Therefore, there is an urgent need to identify sensitive and effective biomarkers for the early diagnosis and treatment of colorectal cancer to reduce its health burden.

[0003] The development and progression of colorectal cancer is the result of environmental, genetic, and both environmental and genetic factors. Previous epidemiological studies have found that alcohol consumption, a key unhealthy lifestyle, exhibits a clear dose-response relationship with the risk of colorectal cancer. Compared with non-drinkers, for every 280g increase in average weekly alcohol intake, the risk of colorectal cancer increases by 19% (including a 29% increase in the risk of rectal cancer and a 13% increase in the risk of colon cancer). Notably, significant differences exist in individual sensitivity to the carcinogenic effects of alcohol, suggesting that genetic background plays a key regulatory role.

[0004] In the process of colorectal cancer risk prediction, how to improve the accuracy, sensitivity and individualization of prediction is the technical problem to be solved by the present invention. Existing colorectal cancer risk assessment methods mainly rely on family history, clinical indicators or the detection of a few known genes, and have problems such as insufficient coverage of genetic information and neglect of environment-gene interactions. As a typical multifactorial complex disease, the occurrence of colorectal cancer is not only controlled by a single genetic locus, but also by the combined influence of multiple genetic variations (such as single nucleotide polymorphism sites, SNPs) and their interactions with environmental factors such as drinking. Traditional risk assessment methods are difficult to fully reflect its complex pathogenic mechanism, resulting in large errors in prediction results and limited clinical guidance value. Therefore, there is an urgent need to develop a joint analysis method that integrates polygenic risk scores and environmental exposure factors to systematically assess the comprehensive risk of individual colorectal cancer, thereby solving the technical problems of low specificity and poor practicality of current risk prediction methods. Currently, screening and risk prediction methods for colorectal cancer are relatively limited, primarily due to the following technical bottlenecks: First, commonly used clinical risk assessment tools (such as family history questionnaires and fecal occult blood tests) lack molecular precision, making early warning difficult. Second, existing genetic testing focuses on a small number of known high-penetrance genes (such as APC and MLH1), which have limited predictive value for sporadic colorectal cancer, which accounts for the majority of the population. Third, traditional methods fail to fully consider the interaction between environmental exposures (such as alcohol consumption) and genetic background, resulting in inaccurate risk stratification. Therefore, there is an urgent need to establish an innovative predictive model that integrates polygenic risk scores with environmental exposure factors to overcome key technical bottlenecks such as the insufficient sensitivity and specificity of current colorectal cancer early screening.

[0005] In recent years, with the continuous deepening of genome-wide association studies (GWAS), nearly 200 SNPs associated with the risk of colorectal cancer have been discovered, laying an important foundation for the prediction of genetic risk of colorectal cancer. However, there is no clear conclusion on whether there is an interaction between alcohol consumption and genetic factors in the occurrence and development of colorectal cancer. If a group of key genetic loci that have a significant interaction with alcohol consumption can be identified and a genetic score can be constructed on this basis, it will help to accurately identify people at high risk of colorectal cancer among drinkers, thereby achieving early prevention and diagnosis of colorectal cancer. This patent intends to develop a corresponding auxiliary diagnostic kit, which can not only be used for the prediction of genetic risk of colorectal cancer, but also for identifying people at high risk of colorectal cancer among drinkers, providing an effective tool for accurate early warning and personalized prevention and control of colorectal cancer. Summary of the Invention

[0006] The purpose of the present invention is to provide a genetic molecular marker (SNP) related to colorectal cancer and its application that has an interactive effect with alcohol consumption in view of the above research background.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] In a first aspect, the present invention seeks protection for the use of a genetic molecular marker or a substance for detecting the genetic molecular marker in the following (a1) or (a2):

[0009] (a1) Application in the preparation of auxiliary diagnostic products for colorectal cancer that have an interactive effect with alcohol consumption;

[0010] (a2) Application in constructing a multi-gene genetic risk score model for colorectal cancer with an interactive effect with alcohol consumption;

[0011] The genetic molecular marker is a combination of rs61355123, rs17624213, rs3791337, rs190489984 and rs2290476.

[0012] Furthermore, the substance used to detect the genetic molecular marker is at least one of the following (b1)-(b3):

[0013] (b1) specific amplification primers for the genetic molecular markers;

[0014] (b2) specific probe primers for the genetic molecular markers;

[0015] (b3) A reagent comprising the specific amplification primer (b1) and / or the specific probe primer (b2).

[0016] Furthermore, the specific amplification primers described in (b1) comprise the following primer sequences:

[0017] The primer sequences of rs61355123 are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0018] The primer sequences of rs17624213 are shown in SEQ ID NO.5 and SEQ ID NO.6;

[0019] The primer sequences of rs3791337 are shown in SEQ ID NO.9 and SEQ ID NO.10;

[0020] The primer sequences of rs190489984 are shown in SEQ ID NO.13 and SEQ ID NO.14;

[0021] The primer sequences of rs2290476 are shown in SEQ ID NO.17 and SEQ ID NO.18.

[0022] Furthermore, the specific probe primer described in (b2) comprises the following primer sequence:

[0023] The primer sequences of rs61355123 are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0024] The primer sequences of rs17624213 are shown in SEQ ID NO.7 and SEQ ID NO.8;

[0025] The primer sequences of rs3791337 are shown in SEQ ID NO.11 and SEQ ID NO.12;

[0026] The primer sequences of rs190489984 are shown in SEQ ID NO.15 and SEQ ID NO.16;

[0027] The primer sequences of rs2290476 are shown in SEQ ID NO.19 and SEQ ID NO.20.

[0028] Furthermore, the product is a kit or a chip.

[0029] In a second aspect, the present invention claims protection for a colorectal cancer auxiliary diagnosis kit having an interactive effect with alcohol consumption, wherein the auxiliary diagnosis kit is used to detect the aforementioned genetic molecular markers. The auxiliary diagnosis kit is used to detect the genotyping of the genetic molecular markers in the peripheral blood DNA of a subject.

[0030] Furthermore, the auxiliary diagnostic kit includes the aforementioned specific amplification primers and / or the aforementioned specific probe primers.

[0031] Furthermore, the auxiliary diagnostic kit also includes PCR reagents (enzymes and reagents for PCR reactions) as well as standard substances and control substances.

[0032] In the third aspect, the present invention claims protection for a method for constructing a multi-gene genetic risk scoring model for colorectal cancer that has an interactive effect with drinking. The method constructs a colorectal cancer risk prediction model that integrates drinking behavior characteristics by screening a group of genetic molecular markers related to the auxiliary diagnosis of colorectal cancer that have an interactive effect with drinking. The genetic molecular markers are a combination of rs61355123, rs17624213, rs3791337, rs190489984 and rs2290476.

[0033] This study, by constructing a polygenic risk prediction model based on genotype data and alcohol exposure, improves the accuracy and reliability of disease prediction, addresses the limitations of existing methods in clinical translational applications, and meets the practical needs of precise tumor prevention and control. Compared with traditional genetic models, the genetic score described in this study can more accurately identify individuals at high risk for colorectal cancer among alcohol users, enabling more targeted disease prediction and intervention strategies.

[0034] In a fourth aspect, the present invention seeks to protect genetic molecular markers related to auxiliary diagnosis of colorectal cancer that have an interactive effect with alcohol consumption, which are a combination of rs61355123, rs17624213, rs3791337, rs190489984 and rs2290476.

[0035] Combining all the above technical solutions, the advantages and positive effects of the present invention are as follows:

[0036] Compared with traditional genetic models, the genetic score described in this invention can significantly improve the accuracy of identifying individuals at high risk for colorectal cancer among alcohol drinkers. Based on this technological breakthrough, the present invention provides specific primer combinations targeting the aforementioned SNP markers and their use in the preparation of an auxiliary diagnostic kit for alcohol-related colorectal cancer. By integrating alcohol exposure factors with genetic risk scores, this kit achieves more accurate risk group stratification, more targeted disease prediction, and more personalized intervention strategy development. It is particularly suitable for accurate screening of alcohol drinkers, early identification of high-risk individuals, and the development of personalized prevention plans.

[0037] The present invention conducts a case-control study of colorectal cancer, collects peripheral blood samples from colorectal cancer patients and healthy controls, extracts DNA, and detects its SNP site information. On this basis, statistical methods such as multivariate logistic regression analysis are used to adjust for potential confounding factors such as age and gender, systematically screen out SNP sites significantly associated with the risk of colorectal cancer, and further identify a group of key genetic variation sites that have significant interactions with drinking behavior. Based on the above screening results, a polygenic risk score (PRS) is constructed to assess the risk of colorectal cancer in individuals drinking under different genetic backgrounds. Ultimately, based on the identified genetic molecular markers, a set of auxiliary diagnostic kits for alcohol-related colorectal cancer was developed. It can be used to identify high-risk individuals with a higher susceptibility to colorectal cancer among drinkers, improve the ability to predict and accurately intervene in colorectal cancer early, and has good application prospects and promotion value.

[0038] To address key technical issues such as insufficient accuracy in colorectal cancer risk prediction, lack of environmental-genetic interaction assessment, and lack of multi-factor integrated assessment tools, this paper systematically studies the technical solution of "joint modeling of polygenic risk scores and alcohol exposure." The technical breakthroughs were achieved primarily through the following stages:

[0039] The present invention notes that existing colorectal cancer risk assessment methods mostly focus on a single clinical indicator or a few high-penetrance genes, and fail to effectively integrate the interaction between polygenic genetic background and environmental exposure. Based on in-depth analysis of GWAS data and long-term research accumulation, it was found that: 1) the genetic susceptibility to colorectal cancer has a significant polygenic characteristic; 2) alcohol consumption, as an important environmental factor, has significant individual differences in its carcinogenic effect; 3) based on the latest prospective cohort study evidence, environmental pollutants (such as PM) 2.5 The interaction between SNPs and genetic variation has been shown to significantly influence the risk of colorectal cancer. This finding provides an important theoretical basis for the construction of a polygenic risk score model that integrates environmental exposure characteristics. Therefore, this paper proposes to jointly model colorectal cancer-associated SNPs with alcohol exposure characteristics to construct an environmental-genetic interaction risk assessment system.

[0040] The effectiveness of this technical solution was verified through the following experimental design: Based on colorectal cancer population data collected from hospitals in Jiangsu Province and other regions between 2010 and 2016, a total of 1,311 cases and 783 controls were included. All subjects provided complete alcohol consumption information and genome-wide genotyping data. Using GWAS analysis, a weighted PRS model incorporating alcohol consumption characteristics was constructed and evaluated using internal cross-validation.

[0041] The technical solution of this study is based on environmental-genetic interaction analysis, and has successfully developed a prediction system that can be used for personalized risk assessment of colorectal cancer. It breaks through the limitations of traditional methods that lack consideration of multi-gene effects and environmental factors, and provides innovative technical support for precise tumor prevention and control.

[0042] The core innovation of this invention lies in its ability to transcend the limitations of traditional genetic models, which focus solely on main genetic effects. By identifying a set of key SNPs that significantly interact with drinking behavior, a polygenic risk scoring model is constructed that integrates environmental factors. This gene-environment synergistic assessment mechanism enables more precise risk stratification of drinkers.

[0043] Clinical trial data show that compared with traditional genetic models, the genetic score integrating genetic markers provided by the present invention has the following advantages:

[0044] (1) Improved forecast accuracy;

[0045] (2) Outstanding clinical practical value;

[0046] (3) The intervention is more targeted. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Schematic diagram of the evaluation of the genetic risk prediction model for the interaction between colorectal cancer incidence and alcohol consumption provided by an embodiment of the present invention; wherein: A: ROC curve diagram for predicting colorectal cancer risk based on genetic score, AUC: area under the ROC curve; B: forest plot of the association analysis between alcohol consumption and colorectal cancer risk under different genetic scores. DETAILED DESCRIPTION

[0048] The present invention will be further described below with reference to the following examples. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above disclosed technical content to make equivalent embodiments with equivalent variations. Any modification or equivalent variation of the following examples made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0049] Example 1

[0050] 1. Collect research subjects:

[0051] (1) Cases of colorectal cancer confirmed by pathology, excluding samples without drinking information;

[0052] (2) healthy controls, excluding samples without drinking information;

[0053] This study is based on data from a colorectal cancer population collected from hospitals in Jiangsu Province and other regions between 2010 and 2016. A total of 1,311 colorectal cancer cases and 783 healthy controls were included to identify risk loci. Model evaluation was performed using internal cross-validation. All subjects provided complete alcohol consumption information and whole-genome genotyping data, laying the foundation for subsequent genetic analysis and model development.

[0054] 2. Genotype detection and site screening:

[0055] A genome-wide association analysis was conducted to initially identify genetic variants associated with colorectal cancer risk. Furthermore, an interaction factor for alcohol consumption was introduced, and a logistic regression model with an alcohol consumption interaction term was used for screening analysis. Five SNPs were ultimately identified that showed significant interactions with colorectal cancer risk in the context of alcohol consumption. The specific steps involved were as follows:

[0056] 1. Extraction of peripheral blood genomic DNA by phenol-chloroform method:

[0057] Following conventional methods, 20-50 ng / μL DNA can usually be obtained, with a purity (ratio of UV 260OD to 280OD) of 1.6-2.0.

[0058] 2. Whole-genome SNPs detection:

[0059] (1) Whole-genome DNA samples were collected from 1,311 cases and 783 controls;

[0060] (2) Genotyping was performed using the Illumina Human 660W-Quad Chips genotyping array. The specific steps are as follows:

[0061] Preparation of lysate: Prepare 40 portions of 219.72 g sucrose, 2.02 g magnesium chloride, and 20 mL Triton X-100, and dilute to 2000 mL with Tris-HCl solution.

[0062] Add lysis buffer to the peripheral blood in a 2 mL cryotube and mix thoroughly by inversion.

[0063] To remove red blood cells: Fill a 5 mL centrifuge tube to the 4 mL mark with lysis buffer, mix thoroughly, centrifuge at 4000 rpm for 10 minutes, and discard the supernatant. Add 4 mL of lysis buffer to the pellet, mix thoroughly again, wash once, and centrifuge at 4000 rpm for 10 minutes. Discard the supernatant.

[0064] Prepare the extract: every 300 mL contains 122.5 mL of 0.2 M sodium chloride, 14.4 mL of 0.5 M ethylenediaminetetraacetic acid, 15 mL of 10% (g / 100 mL) sodium lauryl sulfate, and 148.1 mL of double-distilled water.

[0065] DNA extraction: Add 1 mL of extraction solution and 8 μL of proteinase K to the obtained precipitate, shake thoroughly on a shaker to mix, and incubate in a 37°C water bath overnight.

[0066] Protein removal: Add 1 mL of saturated phenol and mix thoroughly. Centrifuge at 4000 rpm for 10 minutes. Transfer the supernatant to a fresh 5 mL centrifuge tube. Add an equal volume of chloroform and isoamyl alcohol (chloroform:isoamyl alcohol = 24:1, v / v) to the supernatant. Mix thoroughly. Centrifuge at 4000 rpm for 10 minutes. Transfer the supernatant to two 1.5 mL centrifuge tubes.

[0067] DNA precipitation: Add 60 μL of 3 M sodium acetate to the supernatant, and add an equal volume of ice-cold anhydrous ethanol to the supernatant. Shake gently up and down until a white flocculent precipitate is visible. Centrifuge at 12,000 rpm for 10 minutes.

[0068] DNA washing: Add 1 mL of ice-cold anhydrous ethanol to the precipitate, centrifuge at 12,000 rpm for 10 min, discard the supernatant, and finally evaporate to dryness in a clean and dry environment.

[0069] Measured concentration: Typically 20-50 ng / μL DNA is obtained, with a purity (ratio of UV 260OD to 280OD) of 1.6-2.0.

[0070] Whole-genome scanning: Whole-genome scanning was performed on Illumina Human Omni ZhongHua Bead Chips.

[0071] (3) The data were imputed with genotypes using IMPUTE2 software;

[0072] (4) By fitting logistic regression analysis, the distribution differences of each genotype in colorectal cancer cases and controls in the data set were compared.

[0073] 3. Single SNP TaqMan MGB probe genotyping:

[0074] (1) Whole-genome DNA samples were collected from 1,311 cases and 783 controls;

[0075] (2) Design specific amplification primers and probe primers for a single SNP;

[0076] (3) PCR amplification reaction.

[0077] The specific steps are as follows:

[0078] Probes and primers were designed for the five screened SNPs, all of which met the requirements for probes and primers and could be successfully typed.

[0079] The primers were diluted to a 10-fold working concentration, and the probes were diluted to a 20-fold working concentration.

[0080] Prepare a 5 μL real-time PCR reaction system: Each aliquot includes 1.25 μL of sterile double-distilled water, 2.5 μL of 1× qPCR Mix (THUNDERBIRD Probe qPCR Mix, purchased from TOYOBD), 0.25 μL each of upstream and downstream primers (1 pmol / μL), 0.125 μL of FAM probe (0.25 pmol / μL), 0.125 μL of HEX probe (0.25 pmol / μL), 0.125 μL of 1.25× ROX solution (0.25 pmol / μL), and 0.5 μL of DNA template (10 ng / μL). Primer sequences are shown in Table 2.

[0081] The prepared real-time PCR reaction system was added to a 384-well plate (AXYGEN) and sealed.

[0082] SNPs typing: Place the sealed 384-well plate on an ABI PRISM 7900HT fluorescence quantitative PCR instrument for typing. The experimental procedure is as follows:

[0083] 1) 95°C for 2 min to activate the enzyme;

[0084] 2) 95°C for 15 seconds to denature the DNA;

[0085] 3) 60°C, 60 s, annealing and extension of primers and probes, for a total of 40 cycles.

[0086] Genotyping was performed using SDS 2.4 software. Blue and red represent two different homozygotes, respectively, green represents heterozygotes, gray represents negative control (NTC), and × represents typing failure.

[0087] 3. Construction and evaluation of genetic risk prediction models:

[0088] (1) Five SNPs closely associated with colorectal cancer incidence and alcohol consumption were identified based on the above strategy, including rs61355123, rs17624213, rs3791337, rs190489984, and rs2290476;

[0089] (2) Using the existing regression coefficients as weights, a weighted genetic risk score model PRS was constructed, and the area under the ROC curve of the model was 64.6% ( Figure 1 -A), therefore, based on the SNPs with interactive effects screened out above, a genetic risk score was constructed to identify high-risk individuals for colorectal cancer in the drinking population, which can better predict the genetic risk of the disease.

[0090] 4. Preparation of auxiliary diagnostic kit for alcohol-related colorectal cancer:

[0091] Develop an auxiliary diagnostic kit for alcohol-related colorectal cancer. This kit can enable early identification and targeted intervention for individuals at high risk of colorectal cancer among drinkers, providing an effective tool for personalized colorectal cancer prevention and control.

[0092] The diagnostic kit is comprised of the screened SNPs (rs61355123, rs17624213, rs3791337, rs190489984, and rs2290476). The diagnostic reagents include primers and probes specific for the SNP genetic markers; commonly used PCR reagents, such as Taq enzyme, dNTP mix, and deionized water; as well as standards and controls.

[0093] 5. Statistical Analysis

[0094] The additive logistic regression model was used to analyze the strength of the association between SNPs and the risk of early-onset colorectal cancer, while adjusting for confounding variables (such as sex and age).

[0095] The PRS risk prediction model is fitted by calculating the PRS score. The basic steps include:

[0096] (1) The three genotypes of each SNP were quantitatively scored, such as the wild homozygous type was "0", the heterozygous type was "1", and the homozygous mutant type was "2", and the effect scores of all sites were adjusted to positive association;

[0097] (2) The weight coefficient of each SNP is the regression coefficient obtained in the logistic regression model, and the constructed equation is: PRS = rs61355123 × (-1.469) + rs17624213 × (-1.154) + rs3791337 × (-0.983) + rs190489984 × 1.130 + rs2290476 × (-0.893).

[0098] 6. Risk Stratification

[0099] (1) PRS was divided into three categories: low, medium, and high according to the risk tertiles;

[0100] (2) To evaluate whether the association between alcohol consumption and colorectal cancer risk is different under different genetic scores.

[0101] All statistical analyses were performed using PLINK 1.9 and R 4.2.3 software.

[0102] Result description:

[0103] Genome-wide SNP scanning and TaqMan probe genotyping ultimately identified five SNPs significantly associated with colorectal cancer and alcohol consumption: rs61355123, rs17624213, rs3791337, rs190489984, and rs2290476. Among these, rs190489984 was positively associated with colorectal cancer, while rs61355123, rs17624213, rs3791337, and rs2290476 were negatively associated (Table 1).

[0104] Table 1. Five colorectal cancer risk SNPs that interact with alcohol consumption

[0105] SNP chromosome number <![CDATA[Physical location a > Major / minor alleles Minor allele frequency <![CDATA[OR b ]]> <![CDATA[95% CI b ]]> <![CDATA[P b ]]> rs61355123 2 36853734 A / G 0.059 0.23 0.12-0.43 4.51E-06 rs17624213 2 113933247 T / G 0.115 0.32 0.20-0.50 1.38E-06 rs3791337 2 113945455 T / C 0.154 0.37 0.25-0.57 4.93E-06 rs190489984 14 46470323 C / T 0.247 3.10 1.93-4.96 2.54E-06 rs2290476 19 55597369 G / C 0.455 0.41 0.29-0.58 4.79E-07

[0106] a Based on NCBI genome build 37 (hg19); b Interaction results were adjusted for age and sex.

[0107] Table 2. SNP locus typing primer information

[0108] SEQ ID Primer name sequence 1 rs61355123-F CCAATCAGATATTAGGTCATCAACAGA 2 rs61355123-R GGTAGAAATGAAAAATTGGAGAGAGAA 3 rs61355123-PG FAM-AAAATAATAGACGAGGCCGAA-MGB 4 rs61355123-PA VIC-AAATAATAGACGAGGCCAAA-MGB 5 rs17624213-F AGCCTTCATACCTTTTCCATAGGA 6 rs17624213-R GTCTCTGTTTCCCTTTTTGAGCTT 7 rs17624213-PG FAM-AGCGTTTGCTTGCTGAG-MGB 8 rs17624213-PT VIC-AGCGTTTTCTTGCT-MGB 9 rs3791337-F GGTGACTTCTCACTGCCTCTTGA 10 rs3791337-R TCTGTTAGCTTCTGTTGTGCTTCTC 11 rs3791337-PT FAM-TGAACACTACATAATGC-MGB 12 rs3791337-PC VIC-TCATGAACACTACACAAT-MGB 13 rs190489984-F CAAAGAGAATAAAATACCTAGGAATCCAA 14 rs190489984-R AGCAGTGATTTGTAGTCCTCCTTGA 15 rs190489984-PT FAM-TTACAAGGGATGTGAAGG-MGB 16 rs190489984-PA VIC-TACAAGGGACGTGAAGG-MGB 17 rs2290476-F GTTCAGAGCCTGTCTGCAGCTA 18 rs2290476-R CGGGACGTACTGGAGGTTAGAG 19 rs2290476-PG FAM-CTGGCTAATTCGTG-MGB 20 rs2290476-PC VIC-CTGGCTAATTCCTGC-MGB

[0109] Note: F: Forward Primer, upstream primer; R: Reverse Primer, downstream primer; FAM and HEX: fluorescence signals of different alleles.

[0110] The above description is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with this technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered by the scope of protection of the present invention.

Claims

1. Use of a genetic molecular marker or a substance for detecting the genetic molecular marker in the following (a1) or (a2): (a1) Application in the preparation of auxiliary diagnostic products for colorectal cancer that have an interactive effect with alcohol consumption; (a2) Application in constructing a multi-gene genetic risk score model for colorectal cancer with an interactive effect with alcohol consumption; The genetic molecular marker is a combination of rs61355123, rs17624213, rs3791337, rs190489984 and rs2290476.

2. The use according to claim 1, characterized in that The substance used to detect the genetic molecular marker is at least one of the following (b1) to (b3): (b1) specific amplification primers for the genetic molecular markers; (b2) specific probe primers for the genetic molecular markers; (b3) A reagent comprising the specific amplification primer (b1) and / or the specific probe primer (b2).

3. The use according to claim 2, characterized in that The specific amplification primers described in (b1) comprise the following primer sequences: The primer sequences of rs61355123 are shown in SEQ ID NO.1 and SEQ ID NO.2; The primer sequences of rs17624213 are shown in SEQ ID NO.5 and SEQ ID NO.6; The primer sequences of rs3791337 are shown in SEQ ID NO.9 and SEQ ID NO.10; The primer sequences of rs190489984 are shown in SEQ ID NO.13 and SEQ ID NO.14; The primer sequences of rs2290476 are shown in SEQ ID NO.17 and SEQ ID NO.

18.

4. The use according to claim 2, characterized in that The specific probe primer described in (b2) comprises the following primer sequence: The primer sequences of rs61355123 are shown in SEQ ID NO.3 and SEQ ID NO.4; The primer sequences of rs17624213 are shown in SEQ ID NO.7 and SEQ ID NO.8; The primer sequences of rs3791337 are shown in SEQ ID NO.11 and SEQ ID NO.12; The primer sequences of rs190489984 are shown in SEQ ID NO.15 and SEQ ID NO.16; The primer sequences of rs2290476 are shown in SEQ ID NO.19 and SEQ ID NO.

20.

5. The use according to claim 1, characterized in that The product is a kit or a chip.

6. A colorectal cancer auxiliary diagnostic kit having an interactive effect with alcohol consumption, characterized in that: The auxiliary diagnostic kit is used to detect the genetic molecular markers described in claim 1.

7. The colorectal cancer auxiliary diagnosis kit having an interactive effect with alcohol consumption according to claim 6, characterized in that: The auxiliary diagnostic kit comprises the specific amplification primers described in claim 3 and / or the specific probe primers described in claim 4.

8. The auxiliary diagnostic kit for colorectal cancer having an interactive effect with alcohol consumption according to claim 6 or 7, characterized in that: The auxiliary diagnosis kit also includes reagents for PCR and standard and control substances.

9. A method for constructing a polygenic genetic risk scoring model for colorectal cancer with an interactive effect with alcohol consumption, characterized in that: This method constructs a colorectal cancer risk prediction model that integrates drinking behavior characteristics by screening a group of genetic molecular markers related to auxiliary diagnosis of colorectal cancer that have an interactive effect with drinking; the genetic molecular markers are a combination of rs61355123, rs17624213, rs3791337, rs190489984 and rs2290476.

10. Genetic molecular markers associated with auxiliary diagnosis of colorectal cancer with interactive effects with alcohol consumption, characterized in that: The genetic molecular marker is a combination of rs61355123, rs17624213, rs3791337, rs190489984 and rs2290476.

Images