Application of serum extracellular vesicle virus protein BOLF1 in predicting nasopharyngeal carcinoma metastasis risk and serving as anti-tumor target

By identifying the EBV lytic phase protein BOLF1 in the serum of nasopharyngeal carcinoma patients, constructing a risk scoring model and intervening in its pathway, the problem of efficient prediction and treatment of nasopharyngeal carcinoma metastasis risk was solved, achieving high-sensitivity prediction and effective tumor suppression effects.

CN120668924APending Publication Date: 2025-09-19SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510673846.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-09-19

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0005417200180000011
    Figure HDA0005417200180000011
  • Figure HDA0005417200180000012
    Figure HDA0005417200180000012
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, discloses application of serum extracellular vesicular virus protein BOLF1 in predicting nasopharyngeal carcinoma metastasis risk and serving as an anti-tumor target, and particularly discloses application of a reagent for detecting BOLF1 in preparing a product for predicting the nasopharyngeal carcinoma metastasis risk. Through a 4D-DIA proteomics technology, the EBV lysis period protein BOLF1 is identified in serum EVs of a nasopharyngeal carcinoma patient for the first time, and it is found that the EBV lysis period protein BOLF1 is only specifically enriched in a nasopharyngeal carcinoma metastasis patient. A risk scoring model is constructed based on the BOLF1, and it can be known through an ROC curve of the risk scoring model that the model has high accuracy and sensitivity (AUC = 0.77, significantly superior to 0.61 of EBV DNA), and the risk scoring model can be applied to prediction of nasopharyngeal carcinoma metastasis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of serum extracellular vesicle viral protein BOLF1 in predicting the metastasis risk of nasopharyngeal carcinoma and as an anti-tumor target. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is an epithelial malignancy highly associated with Epstein-Barr virus (EBV) infection. The clinical manifestations of NPC are insidious, resulting in nearly 70% of patients being diagnosed in the locally advanced stage. Of these, 20% to 40% still develop distant metastasis after radical cure, which is the main cause of NPC-related deaths. Therefore, the development of markers that can identify patients at high risk of metastasis early and guide treatment is an urgent need in the current clinical management of NPC.

[0003] Circulating EBV DNA is currently the most widely used prognostic marker. Although it can indicate metastasis 3.5 to 6 months earlier than imaging, its predictive efficacy is limited by tumor heterogeneity (about 30% of patients with metastasis have low EBV DNA levels) and cannot provide functional intervention targets. In recent years, extracellular vesicles (EVs) have great value in liquid biopsy applications due to their ability to carry functional biomolecules (such as proteins and nucleic acids). In nasopharyngeal carcinoma, tumor-associated EVs promote metastasis through the following mechanisms: (1) Angiogenesis: NPC-derived EVs can induce endothelial cell proliferation and angiogenesis by delivering miR-23a / 24p and miR-144; (2) Immune escape: EVs can inhibit anti-tumor immunity by regulating the polarization of tumor-associated macrophages (TAMs); (3) Matrix remodeling: Matrix metalloproteinases (MMPs) carried by EVs can degrade the extracellular matrix, creating conditions for tumor cell invasion and metastasis. Extracellular vesicles, as small vesicles that stably carry a variety of bioactive substances, persist in various body fluids, such as patient serum, and are closely related to the occurrence and development of diseases. However, they are difficult to purify, and there is still a lack of efficient and convenient methods to enrich extracellular vesicles in patient serum.

[0004] EBV-encoded latent proteins (such as LMP1 and LMP2A) and microRNAs (miR-BARTs) have been shown to regulate host cell behavior through EVs, but the functions of its lytic proteins remain unclear. Notably, levels of EBV cleavage products are significantly elevated in the serum of patients with advanced nasopharyngeal carcinoma, suggesting that lytic proteins may participate in tumor progression through EVs.

[0005] However, current research faces the following major challenges: (1) Technical bottlenecks: Proteomic studies of serum EVs are easily interfered by high-abundance serum proteins, making it difficult to detect viral proteins. Currently, there is no systematic identification study of the viral proteome of nasopharyngeal carcinoma serum EVs; (2) Lack of clinical association: Existing markers lack direct association with metastasis risk stratification, and closed-loop verification from marker discovery to mechanism analysis has not been achieved; (3) Unknown function of EBV lytic phase proteins: Although EBV lytic phase proteins play a key role in viral replication, whether they regulate the tumor microenvironment through EVs has not yet been explored. Summary of the Invention

[0006] The first aspect of the present invention aims to provide a reagent for detecting BOLF1 for use in preparing a product for predicting the risk of nasopharyngeal carcinoma metastasis.

[0007] The second aspect of the present invention aims to provide a system for predicting the risk of nasopharyngeal carcinoma metastasis.

[0008] The third aspect of the present invention aims to provide the use of BOLF1 as an anti-tumor target in the preparation of a drug for treating or preventing nasopharyngeal carcinoma metastasis.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is:

[0010] A first aspect of the present invention provides use of a reagent for detecting BOLF1 in the preparation of a product for predicting the metastasis risk of nasopharyngeal carcinoma.

[0011] In some embodiments of the present invention, the reagent includes a reagent for detecting BOLF1 at the gene or protein level.

[0012] In some embodiments of the present invention, the reagent for detecting BOLF1 includes a reagent for detecting BOLF1 by enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunoprecipitation, immunoblotting, high performance liquid chromatography, capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence, colloidal gold immunoassay, fluorescence immunochromatography, surface plasmon resonance, PCR, immuno-PCR, or biotin-avidin technology.

[0013] In some embodiments of the present invention, the reagent is a reagent for detecting BOLF1 by immuno-PCR technology.

[0014] Immuno-polymerase chain reaction (PCR) is a highly sensitive method used for detecting a variety of trace antigens, using PCR to amplify target signals. The inventors developed their extracellular vesicle target detection method based on this experimental technique.

[0015] In some embodiments of the invention, the reagents include streptavidin-linked DNA and qPCR primers.

[0016] In some embodiments of the present invention, the nucleotide sequence of the DNA linked to streptavidin is shown in SEQ ID NO: 3.

[0017] In some embodiments of the present invention, the nucleotide sequences of the qPCR primers are shown in SEQ ID NOs: 1-2.

[0018] In some embodiments of the present invention, the product includes a reagent, a kit, or a detection system.

[0019] In some embodiments of the present invention, the sample to be tested is serum from a nasopharyngeal carcinoma patient.

[0020] A second aspect of the present invention provides a system for predicting the risk of nasopharyngeal carcinoma metastasis, comprising:

[0021] Data collection module: collects patient samples, detects the expression level of BOLF1 in the extracellular vesicles of the serum of nasopharyngeal carcinoma patients to be tested, and outputs the expression level data to the model calculation module;

[0022] Model calculation module: calculate the patient's risk score,

[0023] The risk score calculation formula is as follows: risk score = 1.15 × 2^(28-CT-BOLF1)-0.06;

[0024] The output prediction module predicts the risk of nasopharyngeal carcinoma metastasis of nasopharyngeal carcinoma patients based on the calculated risk score of nasopharyngeal carcinoma patients.

[0025] In some embodiments of the present invention, the prediction criteria are: comparing the risk score with a threshold; if the risk score is higher than the threshold, the risk of nasopharyngeal carcinoma metastasis is high; if the risk score is lower than the threshold, the risk of nasopharyngeal carcinoma metastasis is low.

[0026] In some embodiments of the present invention, the threshold value is 18.34 ng / mL.

[0027] A third aspect of the present invention provides use of a BOLF1 pathway intervention agent in the preparation of a medicament for treating or preventing nasopharyngeal carcinoma metastasis.

[0028] In some embodiments of the present invention, the BOLF1 pathway intervention agent includes a STAT3 inhibitor (such as Napabucasin).

[0029] The beneficial effects of the present invention are:

[0030] This study, using 4D-DIA proteomics technology, identified the EBV lytic phase protein BOLF1 in serum EVs from nasopharyngeal carcinoma patients for the first time and found that it was specifically enriched only in patients with nasopharyngeal carcinoma metastasis. A risk scoring model was constructed based on BOLF1. The ROC curve of the risk scoring model showed that the model had high accuracy and sensitivity (AUC = 0.77, significantly better than 0.61 for EBV DNA) and could be applied to the prediction of nasopharyngeal carcinoma metastasis. This discovery will stratify the prognostic risk of nasopharyngeal carcinoma patients, provide precise therapeutic intervention in advance, and improve the prognosis of these patients with "high metastatic potential."

[0031] Further intervention in the downstream pathway of BOLF1 and blocking its tumor metastasis mechanism mediated by EVs significantly inhibited the invasion and metastasis ability of nasopharyngeal carcinoma cells, suggesting that BOLF1 is a potential target for the treatment of nasopharyngeal carcinoma metastasis and provides a direction for the development of new anti-tumor drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Figure 1: Quality control of purified serum EVs from NPC. (A) Representative transmission electron microscopy (TEM) images of serum-derived EVs. Scale bar, 200 nm. (B) Size distribution analysis of serum-derived EVs using nanoparticle tracking analysis (NTA). (C) Western blot analysis of negative marker proteins (calnexin) and positive marker proteins (CD9, TSG101, and HSP70) in serum EVs. (D) Heat map showing the expression levels of nine common EV marker proteins (Hsc70, HSP90AB1, Alix, CD9, HSP90AA1, FLOT2, CD81, CD63, and TSG101) and one negative marker protein (calnexin) identified by mass spectrometry in different serum-derived EV samples.

[0033] Figure 2 Figure 2 is a Venn diagram showing the distribution of EB proteins in EVs of NPC serum in the non-metastatic group and the metastatic group after treatment.

[0034] Figure 3 Figure 1 shows the detection and localization of BOLF1. (A) shows the standard curve for BOLF1 detection using iPCR. (B) shows Western blot analysis demonstrating the specificity of the BOLF1 antibody in Vector / BOLF1. (C) shows STORM imaging of BOLF1 within EVs from NPC serum. EVs were stained with anti-CD63 (green) and anti-BOLF1 (red) antibodies. Scale bars are 2 μm and 100 nm, respectively.

[0035] Figure 4Figure 2 shows the diagnostic and prognostic value of BOLF1-EVs in nasopharyngeal carcinoma metastasis prediction and survival analysis. A represents the area under the receiver operating characteristic curve (AUROC) for differentiating between M0 (no metastasis) and M1 (distant metastasis) nasopharyngeal carcinoma patients. The AUROC for BOLF1 was 0.77, superior to 0.61 for EBV-DNA and 0.58 for N stage. P values ​​were calculated using the DeLong's test. B represents the Kaplan-Meier survival curve comparing distant metastasis-free survival (DMFS) between nasopharyngeal carcinoma patients with high and low BOLF1 expression. Statistical significance was assessed using the log-rank test (P = 0.0026).

[0036] Figure 5 In vivo experiments validated the potential of BOLF1 as an anti-tumor target. Figure A shows a representative bioluminescent image of mice captured at week 2. Figure B shows the fluorescence signal of tumor growth in each group of mice (n = 8). Data are presented as mean ± SEM, and statistical significance was analyzed using two-way ANOVA. Figure C shows a representative image of the primary footpad tumor and metastatic popliteal lymph nodes. Figure D shows the metastasis rate of the popliteal lymph nodes. Figure E shows the Kaplan-Meier survival curves for the four groups of mice. Figure F shows a Western blot analysis showing changes in STAT3, p-STAT3 (Ser727), SPP1, and LDHA protein levels in mouse tumors. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below through specific examples.

[0038] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0039] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0040] product.

[0041] Explanation of terms:

[0042] Epstein-Barr virus (EBV): A human herpes virus that is closely related to the occurrence of various malignant tumors (such as nasopharyngeal carcinoma, lymphoma, etc.).

[0043] Extracellular vesicles (EVs): Nanoscale vesicles secreted by cells that carry bioactive molecules such as proteins and nucleic acids and participate in intercellular communication.

[0044] 4D-DIA (Four-Dimensional Data-Independent Acquisition): A high-resolution mass spectrometry technique used for proteomic analysis.

[0045] LASSO-Cox model: A statistical method that combines LASSO regression and Cox proportional hazards model to screen prognostic markers and construct risk score models.

[0046] Receiver Operating Characteristic Curve (ROC) curve is used to evaluate the performance of diagnostic or predictive models. The closer the area under the curve (AUC) value is to 1, the better the model performance.

[0047] Immuno-polymerase chain reaction (iPCR): A highly sensitive detection method that combines immunology and PCR technology and is used for the detection of trace antigens.

[0048] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0049] Example 1 Marker Screening

[0050] Determining the proteome composition of extracellular vesicles in patients with high metastatic risk nasopharyngeal carcinoma:

[0051] The inventors used ultracentrifugation combined with a qEV device to isolate extracellular vesicles (EVs) from serum (from four non-metastatic patients, four patients with previously untreated locally advanced nasopharyngeal carcinoma with distant metastases, and four healthy individuals, all obtained from the specimen bank of the Sun Yat-sen University Cancer Center). Transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) were used to characterize serum EVs from NPC. Western blot analysis was used to detect marker proteins in serum EVs (negative marker protein calnexin, positive marker proteins CD9, TSG101, and HSP70). Heatmaps were used to visualize the expression levels of nine common EV marker proteins (Hsc70, HSP90AB1, Alix, CD9, HSP90AA1, FLOT2, CD81, CD63, and TSG101) and one negative marker protein (calnexin) in different serum-derived EV samples. 4D-DIA and LC-MS / MS were used to characterize the exosome proteome.

[0052] Transmission electron microscopy of serum-derived EVs Figure 1 Middle A, size distribution of serum-derived EVs. Figure 1 In Figure B, Western blot analysis of negative marker proteins (calnexin) and positive marker proteins (CD9, TSG101, and HSP70) of serum EVs is shown in Figure 1C. The heat map shows the mass spectrometry results as shown in Figure 1C. Figure 1 Middle D.

[0053] By analyzing the exosome proteome, 11 EBV proteins were screened, among which BOLF1 was specifically enriched in serum EVs of patients with metastatic nasopharyngeal carcinoma ( Figure 2 ), suggesting that BOLF1 can be used as a biomarker to predict the risk of nasopharyngeal carcinoma metastasis.

[0054] Example 2 Marker Efficacy Test

[0055] A polyclonal antibody targeting the BOLF1Δ3956-1234 epitope was prepared by immunizing rabbits. ELISA validation showed that the antibody had good binding activity ( Figure 3 Middle A), Western blot confirmed that it can specifically recognize recombinant BOLF1 protein (about 135kDa) ( Figure 3 Middle B).

[0056] Using STORM super-resolution imaging technology, we confirmed that BOLF1 is localized inside EVs ( Figure 3 Middle C).

[0057] Using iPCR, the researchers examined BOLF1-EV levels in the serum of 325 patients with locally advanced nasopharyngeal carcinoma (samples were obtained from the specimen bank of the Sun Yat-sen University Cancer Center). Because these patients are at risk of developing metastases after treatment, the inventors followed them for a median of 55 months to investigate whether BOLF1 could serve as a biomarker for predicting nasopharyngeal carcinoma metastasis risk.

[0058] To evaluate the clinical prognostic value of BOLF1-EVs, the inventors used a mixture of extracellular vesicle marker antibodies (CD63, CD81, CD9) and BOLF1 rabbit polyclonal antibodies to coat a 96-well PCR plate. It is worth noting that the inventors compared multiple PCR plate products and screened out the product with the best antigen adsorption capacity, the Bio-Rad #HSR9905 reaction plate; 400 μL of patient serum (325 nasopharyngeal carcinoma patients) was collected, centrifuged at 10,000g for 30 minutes at 4°C, and 200 μL of supernatant was taken and added to the above reaction plate for overnight incubation to capture extracellular vesicles in the patient serum sample; the next day, the serum was discarded, the reaction plate was patted dry, and 1% Triton was added. The cells were incubated on ice with X-100 (diluted in PBS) for 1 h to permeabilize the extracellular vesicles (EVs), followed by incubation at room temperature for 4 h to capture the antigens after lysis. A biotinylated human monoclonal antibody to BOLF1 was added to the PCR plate coated with serum EVs antigen and incubated overnight at 4°C. The next day, the plate was blocked with 1% BAS, washed, and then biotinylated BOLF1 antibody was added, followed by incubation at 37°C for 2 h. After thorough washing to remove unbound BOLF1 antibody, streptavidin-conjugated biotinylated BOLF1 antibody was added. Finally, the streptavidin protein was labeled with bio-DNA (final concentration 5 pM). A qPCR reaction system using the bio-DNA as a template was prepared (Table 1) and added to the plate wells for PCR amplification (reaction procedure: 98°C for 20 s; 98°C for 10 s, 55°C for 5 s, 72°C for 5 s, 35 cycles). The fluorescence signal of the DNA product was detected to quantify the target protein BOLF1 signal. A risk score formula was constructed using the LASSO-Cox model: score = 1.15 × 2^(28-CT-BOLF1) - 0.06, expressed in ng / mL. This score was compared with a threshold of 18.34 ng / mL. Scores above the threshold indicated a high risk of NPC metastasis, while scores below the threshold indicated a low risk.

[0059] Table 1 PCR reaction system

[0060]

[0061] The upstream and downstream primers in Table 1 are as follows: F-5'-GAATTCGAGCTCGGTACCCGG-3' (SEQ ID NO: 1), R-5'-AAGGCGATTAAGTTGGG-3' (SEQ ID NO: 2).

[0062] The nucleotide sequence of bio-DNA is: 5'-Biotin-GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGC AAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTT-3' (SEQ ID NO: 3).

[0063] The present invention detected the BOLF1-EVs levels in the serum of 325 patients with nasopharyngeal carcinoma, and divided the patients into a high-risk group (BOLF1 concentration ≥ 18.34 ng / mL) and a low-risk group (BOLF1 concentration < 18.34 ng / mL) with 18.34 ng / mL as the critical value. After a median follow-up of 55 months, the predictive efficacy of BOLF1 concentration grouping was evaluated with distant metastasis as the clinical endpoint. The receiver operating characteristic (ROC) curve analysis showed that the area under the curve (AUC) of BOLF1-EVs for predicting nasopharyngeal carcinoma metastasis was 0.77, which was significantly better than the currently commonly used EBV-DNA marker in clinical practice (AUC = 0.62). ( Figure 4 In addition, survival analysis showed that patients with low BOLF1-EVs expression had significantly better distant metastasis-free survival (DMFS) than those with high BOLF1-EVs expression ( Figure 4 Middle B). This suggests that detecting BOLF1 expression in EVs can effectively predict the risk of nasopharyngeal carcinoma metastasis.

[0064] Example 3 Anti-tumor target verification

[0065] In vivo experiments were performed to validate the potential of BOLF1 as an anti-tumor target. A STAT3 inhibitor (Napabucasin) was used to interfere with the BOLF1 pathway and observe its effects on the invasion and metastasis of nasopharyngeal carcinoma cells.

[0066] 12 NGS mice and 30mL of macrophages derived from human peripheral blood were used to verify the anti-tumor metastasis value of targeting the BOLF1 pathway. The specific experimental process is as follows: Six-week-old female NOD / SCID mice were selected and adaptively raised for one week in the SPF-level animal experimental center of the Sun Yat-sen University Cancer Center (temperature 22±1°C, humidity 50±5%, 12-hour light and dark cycle). All animal experiments strictly followed the protocol approved by the Experimental Animal Ethics Committee of the Sun Yat-sen University Cancer Center (approval number: L102012023110N). During the experiment, sterilized bedding and drinking water were regularly replaced, and the health status of the animals was observed daily. Primary macrophages differentiated by GM-CSF were mixed with HK1-Luc cells (stable expression of luciferase) in a ratio of 1:3. After confirming that the cell viability was >95% by trypan blue staining, the cells were adjusted to 2×107 cells / mL (HK1 cells 1.5×10 6 + Macrophages 0.5×10 6 Mice were anesthetized with 1-2% isoflurane, and 50 μL of the cell suspension was slowly injected into the center of the right hind footpad (approximately 2 mm in depth) using a 29G insulin needle. After injection, gentle pressure was applied to stop bleeding and the cells were disinfected with iodine. A control group (n=5 / group) received an equal volume of PBS. Treatment began on day 3 post-inoculation, with weekly intraperitoneal injections of EVs from different sources and STAT3 inhibitors. Every three days, 150 mg / kg of D-luciferin potassium salt was injected intraperitoneally. Bioluminescence signals were acquired 10 minutes later using an IVIS Spectrum system (exposure time: automatic mode, field of view = 12.5), and tumor burden was quantified using Living Image software. After 14 days of intervention, mice were sacrificed by cervical dislocation, and specimens were collected.

[0067] In vivo experiments verified the potential of BOLF1 as an anti-tumor target. Figure 5 As shown in the results, it is suggested that inhibiting the downstream pathway of BOLF1 can significantly inhibit the invasion and metastasis of nasopharyngeal carcinoma cells, confirming the potential of BOLF1 as an anti-tumor target.

[0068] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. Application of reagents for detecting BOLF1 in the preparation of products for predicting the risk of nasopharyngeal carcinoma metastasis.

2. The use according to claim 1, characterized in that The reagents include reagents for detecting BOLF1 at the gene or protein level; Preferably, the reagent for detecting BOLF1 includes a reagent for detecting BOLF1 by enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunoprecipitation, immunoblotting, high performance liquid chromatography, capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence, colloidal gold immunoassay, fluorescence immunochromatography, surface plasmon resonance, PCR, immuno-PCR or biotin-avidin technology.

3. The use according to claim 2, characterized in that The products include reagents, test kits, test strips, chips, and detection systems.

4. The use according to any one of claims 1 to 3, characterized in that The sample tested is extracellular vesicles from the serum of a nasopharyngeal carcinoma patient.

5. The use according to claim 2, characterized in that The reagent is a reagent for detecting BOLF1 by immuno-PCR technology; Preferably, the reagents include streptavidin-linked DNA and qPCR primers; Preferably, the nucleotide sequence of the streptavidin-linked DNA is as shown in SEQ ID NO: 3; Preferably, the nucleotide sequences of the qPCR primers are shown in SEQ ID NOs: 1-2.

6. A system for predicting the risk of nasopharyngeal carcinoma metastasis, comprising: Data collection module: collects patient samples, detects the expression level of BOLF1 in the extracellular vesicles of the serum of nasopharyngeal carcinoma patients to be tested, and outputs the expression level data to the model calculation module; Model calculation module: calculate the patient's risk score, The risk score calculation formula is as follows: risk score = 1.15 × 2^(28-CT-BOLF1)-0.06; The output prediction module predicts the risk of nasopharyngeal carcinoma metastasis of nasopharyngeal carcinoma patients based on the calculated risk score of nasopharyngeal carcinoma patients.

7. The system according to claim 6, characterized in that The prediction judgment standard is: comparing the risk score with a threshold value, if it is higher than the threshold value, the risk of nasopharyngeal carcinoma metastasis is high, and if it is lower than the threshold value, the risk of nasopharyngeal carcinoma metastasis is low.

8. The system according to claim 7, characterized in that The threshold value is 18.34 ng / mL.

9. Application of BOLF1 pathway intervention agents in the preparation of drugs for treating or preventing nasopharyngeal carcinoma metastasis.

10. The use according to claim 9, characterized in that The BOLF1 pathway intervention agent includes a STAT3 inhibitor.