Application of human metapneumovirus in preparation of medicine for treating asthma

Abstract

The invention discloses application of human metapneumovirus in preparation of a medicine for treating asthma, and belongs to the technical field of asthma medicines. The human metapneumovirus is used in the medicine for treating asthma, can relieve airway hyperresponsiveness of an asthma patient, reduce expression of MUC5AC, IL-4 and p-STAT6 proteins of the asthma patient, reduce the total cell number, eosinophilic granulocyte number and neutrophil number in BALF, and can effectively treat asthma and relieve asthma symptoms.

Description

Technical Field

[0001] The present application relates to the technical field of asthma drugs, and in particular to the use of a human metapneumovirus in the preparation of drugs for treating asthma. Background Art

[0002] Asthma is the most common chronic respiratory disease in children and is characterized by chronic airway inflammation, mucus hypersecretion, and airway hyperresponsiveness. The inflammatory features of childhood asthma are poorly defined, and disease heterogeneity is poorly described. Excessive airway mucus secretion is a hallmark of the pathophysiology of asthma and contributes to morbidity and mortality in many patients. Asthma results from complex gene-environment interactions, and no definitive treatment currently exists. The goal of treatment is to achieve good asthma control and minimize the risk of symptom exacerbations. This is ideally achieved by preventing chronic symptoms, maintaining lung function, and allowing normal daily activities, so that the child remains "symptom-free." Current drug therapies are effective in stable patients but are less effective in treating severe asthma, and there is no specific treatment for mucus hypersecretion. Therefore, research into mucus hypersecretion in asthma is warranted.

[0003] Human metapneumovirus (hMPV) was first discovered in 2001 by Dutch researchers and isolated from children with lower respiratory tract infections. It is a single-stranded RNA virus with a similar structure to the novel coronavirus and plays a significant role in pediatric respiratory infections. Human metapneumovirus, a member of the pneumovirus subfamily, exhibits a seasonal infection pattern, with symptoms ranging from moderate to severe respiratory illness.

[0004] However, the existing literature has not yet reported whether asthma is related to human metapneumovirus (hMPV). Summary of the Invention

[0005] The present application provides a use of human metapneumovirus in the preparation of a medicament for treating asthma. Human metapneumovirus can be used to treat asthma.

[0006] This application is implemented as follows: In a first aspect, the present application provides a use of human metapneumovirus in the preparation of a medicament for treating asthma.

[0007] Furthermore, the use of human metapneumovirus in the preparation of a drug for treating asthma for alleviating airway hyperresponsiveness.

[0008] Furthermore, the drug is used to reduce the expression of MUC5AC.

[0009] Furthermore, the drug is used to reduce the expression level of p-STAT6 protein.

[0010] Furthermore, the drug is used to reduce the expression of IL-4.

[0011] Furthermore, the drug is used to reduce the total cell count, eosinophil count and neutrophil count in BALF.

[0012] Furthermore, the medicine is an oral preparation, an injection or a spray.

[0013] In a second aspect, the present application provides a drug for treating asthma, which contains human metapneumovirus.

[0014] The use of the human metapneumovirus of the present application in the preparation of a drug for treating asthma. The use of the human metapneumovirus in a drug for treating asthma can reduce airway hyperresponsiveness in asthma patients, reduce the expression of MUC5AC, IL-4 and p-STAT6 proteins in asthma patients, and reduce the total cell count, eosinophil count and neutrophil count in BALF, thereby effectively treating asthma and alleviating asthma symptoms. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.

[0016] Figure 1 This is a flowchart of the mouse model modeling of the embodiment of the present application; Figure 2 The results of viral load detection in lung tissues of mice in the hMPV group and OVA+hMPV group; Figure 3 These are the test results of pulmonary resistance values ​​of mice in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 4 This is a statistical chart of the total cell count in the bronchoalveolar lavage fluid of mice in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 5 The statistical graphs show the eosinophil and neutrophil counts in the bronchoalveolar lavage fluid of mice in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 6 HE staining of mouse lung tissues in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 7 Results of serum IgE levels of mice in normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 8The total protein concentration results of mouse lung tissues in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 9 The expression levels of MUC5AC in mice in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 10 IL-4 levels in lung tissue and BALF of mice in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 11 Immunohistochemical staining of mouse lung tissues in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 12 for Figure 11 Scoring results of immunohistochemical staining of mouse lung tissue; Figure 13 Immunofluorescence staining of mouse lung tissues in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 14 for Figure 13 Scoring results of immunofluorescence staining of mouse lung tissue; Figure 15 The results of p-STAT6 protein expression in mice in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 16 for Figure 15 Statistical graph of mouse p-STAT6 protein expression results; Figure 17 Fluorescence staining of the airway of lung tissue of mice in the normal control group, OVA group, hMPV group, and OVA+hMPV group; Figure 18 Statistical graph of the mean fluorescence intensity of the airway of mouse lung tissue in the normal control group, OVA group, hMPV group, and OVA+hMPV group. DETAILED DESCRIPTION

[0017] The embodiments of the present application will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present application and should not be considered as limiting the scope of the present application. In the examples, if specific conditions are not specified, the conditions are carried out according to conventional conditions or manufacturer recommendations. The reagents or instruments used are not specified by the manufacturer and are conventional products that can be purchased commercially.

[0018] Allergic asthma is the most common form of asthma. The characteristic pattern of airway inflammation in patients with allergic asthma includes production of T helper 2 (Th2)-associated cytokines such as interleukins (IL-) 4, 5, and 13 by Th2 cells, activation of innate lymphoid cells (ILC2s) and mast cells, infiltration of eosinophils, and increased production of immunoglobulin E (IgE) by B cells. Elevated IgE is a key feature of asthma, and the interaction of IgE with its high-affinity receptor FceR1 and the subsequent activation of effector cells are key mechanisms in the pathogenesis of allergic asthma.

[0019] The following is a detailed description of the use of the human metapneumovirus in the preparation of a medicament for treating asthma according to the examples of the present application: The present application provides a use of human metapneumovirus in the preparation of a drug for treating asthma. The inventors of the present application established an asthma mouse model and administered human metapneumovirus to the asthma mouse model through nasal drops. The results showed that human metapneumovirus can reduce airway hyperresponsiveness in the asthma mouse model, reduce the expression of MUC5AC, IL-4, and p-STAT6 proteins in the asthma mouse model, and reduce the total cell count, eosinophil count, and neutrophil count in the BALF. Therefore, human metapneumovirus can be used in drugs for the treatment of asthma to effectively treat asthma and alleviate asthma symptoms.

[0020] The drug is in the form of an oral dosage form, an injection, or a spray. In addition to containing human metapneumovirus, the drug may also contain a pharmaceutically acceptable carrier or excipient. The content or concentration of human metapneumovirus in the drug can be set according to actual needs.

[0021] The application of the human metapneumovirus of the present application in preparing a medicament for treating asthma is further described in detail below with reference to the examples.

[0022] Example

[0023] 1. Cell culture The Vero E6 cell line used for virus culture in this example was purchased from ATCC and cultured in a 37°C, 5% CO2 incubator supplemented with 10% FBS cell culture medium. Cell growth was observed under a microscope. Cells were passaged and cryopreserved when they filled 80% of a T75 culture flask.

[0024] 2. Virus culture and concentration The hMPV strain used in this example was constructed using reverse genetics. Virus amplification was usually performed using Vero E6 cells that had been passaged 1-2 times and were in good condition and uncontaminated. The titer was approximately 1×10 6The hMPV virus solution was cultured in a 37°C, 5% CO2 cell culture incubator. The pathological changes of the cells were observed daily, and part of the virus solution was collected for titer detection. Since the virus titer used in the animal nasal drop experiment was high, the virus was collected when the hMPV titer was the highest and purified. The purified virus titer reached 1×10 8 , and then divided and stored in -80℃ refrigerator for use.

[0025] 3. Establishment of hMPV infection and OVA sensitization mouse models Forty 3-4 week old BALB / C female mice were purchased from the Experimental Animal Center of Chongqing Medical University and raised as required. The breeding environment was kept at a constant temperature (24°C) and humidity (55%), with a day and night cycle every 12 hours. According to the research purpose, they were divided into a normal control group (Control group), an asthma group (OVA group), an hMPV infection group (hMPV group), and an asthma and hMPV infection group (OVA+hMPV group) (n=10). The modeling process is as follows: Figure 1 As shown, the normal control group was treated with sterile PBS at each time point in the same manner; the OVA group was sensitized with 500 μg / ml OVA (ovalbumin) solution by intraperitoneal injection on the 1st, 8th, and 15th days. Starting from the 22nd day, the mice were placed in a closed nebulizer chamber and nebulized with 5% OVA nebulizer solution for 15 consecutive days, with nebulization for 30 minutes per day; the hMPV group was sensitized with 1×10 8 The mice were infected with hMPV by intranasal drops for 5 days; the OVA+hMPV infection group was infected with hMPV of the same titer by intranasal drops for the same period of time after the OVA-induced asthma model was established.

[0026] 4. Experimental results testing (1) Extraction and quantitative PCR detection of lung tissue RNA Lung tissue RNA was extracted according to the RNA extraction kit's instructions, and cDNA was synthesized. PCR reverse transcription conditions were: 37°C for 15 minutes; 85°C for 5 seconds. The resulting cDNA was frozen and stored at -20°C. Viral detection was performed using the TaqMan probe assay. Before each test, serial dilutions of the hMPV plasmid were used to determine the hMPV copy number and plot a standard curve.

[0027] hMPV upstream primer sequence: GAGCAATAGCACTCGGTGTTG; Downstream primer sequence: TCACAAATCTTTCAGCTCTCTCAC; Probe sequence: TTGCCAACACACGAACTCCATCCC.

[0028] like Figure 2As shown, viral loads were detected in the lung tissues of mice in the two experimental groups infected with hMPV, indicating that the OVA-induced animal model of hMPV infection was effectively constructed.

[0029] (2) Airway hyperresponsiveness detection Airway hyperresponsiveness (AHR) in each group of mice was assessed within 24 hours of model establishment. Anesthesia was initiated with a 2% pentobarbital solution via intraperitoneal injection, and the skin was disinfected with 75% alcohol. Methacholine (Mech) was serially diluted with a 0.9% NaCl solution to prepare concentrations of 3.125, 6.25, 12.5, 25, and 50 mg / ml. First, the mouse airways were stimulated with a nebulized 0.9% NaCl solution. After stabilization, the data were observed and recorded. Next, 20 L of methacholine at different concentrations (0, 3.125, 6.25, 12.5, 25, and 50 mg / ml) were nebulized for 1 minute, and data were recorded for 4 minutes. The average pulmonary resistance (LR) over the following 2 minutes was used for analysis and served as a proxy for AHR.

[0030] Airway hyperresponsiveness is one of the important signs of asthma and one of the "gold standards" for the successful construction of an asthma model. This application reflects the level of airway hyperresponsiveness in mice by detecting pulmonary resistance (LR). Figure 3 As shown, when tested with 0.9% NaCl solution, baseline pulmonary resistance values ​​were consistent across all groups, all below 1. As the concentration of MCH stimulant increased, the lung LR values ​​in the OVA group increased significantly, with the increases being particularly pronounced at medium- and high-concentrations (12.5, 25, and 50 mg / ml) of MCH stimulation (P < 0.001 compared with the control group). In contrast, the hMPV+OVA group showed a significant decrease in LR compared with the OVA group, primarily at medium- and high-concentrations (12.5, 25, and 50 mg / ml). This suggests that hMPV infection alleviates airway hyperresponsiveness in OVA mice to some extent.

[0031] (3) Collect bronchial alveolar lavage fluid (BALF) for cell counting and cytokine analysis Within 24 hours of animal modeling, unilateral lung lavage was performed with 0.5 ml of pre-chilled sterile PBS three times. The recovered alveolar lavage fluid was centrifuged in a low-temperature centrifuge, and the supernatant was collected for IL-4 and IL-13 analysis. The cell pellet was resuspended in 1 ml of sterile PBS, and 20 µl of the cell suspension was added to a cell counting plate for total cell count. Another 20 µl of the cell suspension was applied to a glass slide and stained with Wright-Giemsa stain. White blood cell differential counts were performed, and 200 morphologically intact nucleated cells were counted per slide in different fields of view.

[0032] The experimental results showed that compared with the normal control group, the total number of cells in the BALF of mice in the OVA group and hMPV group was significantly increased, and P < 0.01, which was consistent with the basic characteristics of the asthma model; while the total number of cells in the hMPV-infected OVA mice (OVA+hMPV group) was lower than that in the OVA group ( Figure 4 Compared with the normal control group, the number of eosinophils and neutrophils in mice in the OVA and hMPV groups increased, but the increase was most obvious in the OVA group, which is consistent with the basic characteristics of the asthma model. The degree of cell increase in OVA mice infected with hMPV was lower than that in the OVA group ( Figure 5 ).

[0033] (4) Lung tissue pathology examination After the mice were treated, the left upper lobe of the lung was placed in paraformaldehyde solution, fixed for 24 hours, dehydrated and embedded in paraffin. After solidification, the excess paraffin on the surface was cut off using a coarse cut (20 μm thick), and then continuously fine cut (4 μm). The cut tissue was placed on a slide and dried in a 60°C oven overnight to facilitate HE staining, immunohistochemical analysis and immunofluorescence analysis.

[0034] HE staining of mouse lung tissues showed the following results: Figure 6 As shown, airway observation revealed significant morphological changes in the OVA group, with marked thickening of tracheal smooth muscle, goblet cell hyperplasia, and the highest airway mucus secretion. Numerous inflammatory cell infiltration, primarily composed of eosinophils, neutrophils, and lymphocytes, was observed, along with alveolar wall disruption and a more severe pulmonary inflammation. In the OVA+hMPV group, bronchial ciliary structure was more intact than in the OVA group, and mucus secretion was increased compared to the control and hMPV groups, but lower than in the OVA group. Alveolar wall infiltration was patchy, with some inflammatory cell infiltration, primarily eosinophils, and a milder inflammatory response than in the OVA group. This suggests that hMPV inhibits the progression of inflammatory responses in asthma.

[0035] (5) Enzyme-linked immunosorbent assay Serum IgE is often used as one of the routine detection indicators for asthma patients. This application uses enzyme-linked immunosorbent assay (ELISA) to measure the serum IgE level in mice. Figure 7 As shown, serum IgE levels in both the hMPV and OVA groups increased significantly compared with the control group (P < 0.01), with the OVA group showing the greatest increase. However, serum IgE levels in the OVA+hMPV group decreased compared with the OVA group, with the difference being statistically significant (P < 0.01). [OVA group vs. control group: (37.64 ± 3.57) vs. (9.42 ± 1.65); OVA group vs. OVA+hMPV group: (37.64 ± 3.57) vs. (13.83 ± 7.6), n = 6].

[0036] Chronic inflammatory response is also one of the typical characteristics of asthma, and total protein can reflect the degree of inflammation in lung tissue. Figure 8 As shown, total protein in BALF was detected in the OVA group, with the highest concentration compared to the control group (P < 0.05). Notably, the total protein concentration of OVA in the OVA+hMPV group after hMPV infection was significantly lower than that in the OVA group (P < 0.05). [OVA group vs. Control group: (1.55 ± 0.32) vs. (0.18 ± 0.07); OVA group vs. OVA+hMPV group: (1.55 ± 0.32) vs. (0.62 ± 0.28), n = 4]. This suggests that hMPV suppresses the inflammatory response in asthma.

[0037] (6) The mRNA levels of the MUC5AC gene and its transcriptional inhibitor FOXA2 were detected using mouse lung tissue.

[0038] GAPDH was used as an endogenous control, and the relative expression of MUC5AC, FOXA2, IL-4, and IL-13 genes in lung tissues was quantified by standard techniques.

[0039] MUC5AC upstream primer sequence: CACCAACAGCCCCCATCTT; Downstream primer sequence: GCAGGAATCGCAGTTTTTGTC.

[0040] FOXA2 upstream primer sequence: GACCCCAAGACATACCGACG; Downstream primer sequence: GGCTTCCTTCAGTGCCAGTT.

[0041] IL-4 upstream primer sequence: CTTCCAAGGTGCTTCGCATA; Downstream primer sequence: GATGAATCCAGGCATCGAAA.

[0042] IL-13 upstream primer sequence: CTGAGCAACATCACACAAGACC; Downstream primer sequence: AATCCAGGGCTACACAGAACC.

[0043] MUC5AC is the major mucin detected in high amounts in the sputum of asthmatic patients. Figure 9Results showed that MUC5AC expression increased after hMPV infection (hMPV group) or OVA treatment (OVA group) compared to the normal control group, with the greatest increase in the OVA group. MUC5AC expression levels in all treatment groups were statistically significant compared to the control group (P < 0.01). However, hMPV infection significantly decreased MUC5AC mRNA levels in OVA mice (OVA+hMPV group), with P < 0.01 between the two groups. FOXA2, a transcriptional repressor of MUC5AC, showed an mRNA expression trend that was roughly opposite to that of MUC5AC, with the lowest expression in the OVA group. This suggests that hMPV inhibits MUC5AC expression in asthmatic mice.

[0044] In addition, IL-4 was associated with the production of MUC5AC, a mucin in the airways of asthmatic mice. The IL-4 levels in lung tissue and BALF were detected. Figure 10 The results showed that the mRNA level and concentration of IL-4 in BALF of OVA mice infected with hMPV (OVA+hMPV group) were increased compared with those in the hMPV group and normal control group. However, compared with the OVA group, hMPV infection significantly reduced the expression of IL-4 in OVA mice, and this difference was statistically significant (P<0.01).

[0045] (7) Immunohistochemical evaluation of MUC5AC expression in the lungs of hMPV- and OVA-treated mice. Immunohistochemical staining and immunofluorescence staining were performed on the lung tissues of mice in each group. The fluorescence expression of MUC5AC was observed by laser confocal microscopy and statistical analysis was performed.

[0046] like Figure 11 and Figure 12 As shown, immunohistochemical staining results showed that the OVA group had the strongest positive staining intensity, a brown color, indicating the strongest MUC5AC expression and the highest IHC score (P < 0.01). In contrast, the positive staining in the hMPV-infected group became lighter, suggesting decreased MUC5AC expression and lower IHC scores. These differences were statistically significant compared to the control group, confirming that hMPV infection reduced OVA-induced airway mucus protein MUC5AC secretion. Compared to the OVA group, P < 0.01 was observed.

[0047] like Figure 13 and Figure 14As shown, immunofluorescence staining results showed that the OVA group had the strongest fluorescence expression, indicating the highest expression of MUC5AC. However, after hMPV infection, the fluorescence intensity in the OVA group was significantly weakened. Compared with the control group, the differences in the mean fluorescence intensity of each group were statistically significant (P < 0.05). Furthermore, the difference in airway MUC5AC expression between the OVA group and the OVA+hMPV group was analyzed, and P < 0.05, further confirming that hMPV infection reduced the expression of the airway mucus protein MUC5AC in OVA mice.

[0048] (8) Extraction and detection of total protein from lung tissue and Western blotting For every 100 mg of lung tissue, add 1 ml of RIPA and 1 liter of a mixture of protease and phosphatase inhibitors (1000×). Add magnetic beads and homogenize using a tissue homogenizer at 20 Hz for 6 minutes until the protein is fully lysed before collection. Determine protein concentration using the BCA assay. Add the appropriate volume of Loading Buffer (5×) to the protein, vortex to mix, and boil the protein in a metal bath (100°C for 10 minutes). Aliquot and store at -80°C.

[0049] Prepare protein samples and select precast gels with a concentration of 4-12% for the experiment. Equal amounts of protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. The membranes were blocked with 5% nonfat dry milk and then incubated with a primary antibody dilution (1:1000) at 4°C for over 12 hours. Following primary antibody incubation, the membranes were incubated with a secondary antibody dilution (1:5000) for the corresponding species. Finally, immunoblot signals were visualized using an ECL chemiluminescence kit. Band intensities were quantified using Image J software, and data were normalized to the corresponding β-actin band (control).

[0050] The present application used Western-blot to detect the involved signal pathway proteins JAK2 and STAT6 and their phosphorylation levels. The results are as follows Figure 15 and Figure 16 As shown, p-STAT6 is expressed at low levels in the hMPV group. However, in OVA mice infected with hMPV, p-STAT6 protein expression levels were significantly decreased compared to the OVA group, indicating that hMPV infection leads to downregulation of p-STAT6 protein levels in OVA mice. This trend is consistent with the expression of MUC5AC and IL-4 in the lungs, suggesting that p-STAT6 may be an important target for regulating mucin MUC5AC secretion. JAK2 has not yet been shown to play a role in hMPV-infected OVA mice and is therefore not included in the figure.

[0051] In order to further verify the expression of p-STAT6 protein in the airway of hMPV-infected OVA mice, lung tissue airway images under different fields of view were selected to analyze the mean fluorescence intensity of p-STAT6 protein. Figure 17 and Figure 18 As shown in the figure, the statistical difference of the mean fluorescence intensity of each group was significant compared with the control group, P < 0.01. The fluorescence intensity of p-STAT6 protein in the OVA group was the strongest, while that in OVA mice infected with hMPV was significantly weakened, indicating that the expression level of p-STAT6 protein in lung tissue was consistent with the protein level detected by Western-blot.

[0052] In summary, the use of the human metapneumovirus of the present application in the preparation of drugs for the treatment of asthma can reduce airway hyperresponsiveness in asthma patients, reduce the expression of MUC5AC, IL-4 and p-STAT6 proteins in asthma patients, and reduce the total cell count, eosinophil count and neutrophil count in BALF, and can effectively treat asthma and alleviate asthma symptoms.

[0053] The foregoing description is merely a specific embodiment of the present application and is not intended to limit the present application. Persons skilled in the art will readily appreciate that various modifications and variations are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. Use of human metapneumovirus in the preparation of drugs for treating asthma.

2. Use of human metapneumovirus in the preparation of drugs for treating asthma for alleviating airway hyperresponsiveness.

3. The use according to claim 1 or 2, characterized in that The drug is used to reduce the expression of MUC5AC.

4. The use according to claim 3, characterized in that The drug is used to reduce the expression level of p-STAT6 protein.

5. The use according to claim 1 or 2, characterized in that: The drug is used to reduce the expression of IL-4.

6. The use according to claim 1 or 2, characterized in that: The drug is used to reduce the total cell count, eosinophil and neutrophil counts in BALF.

7. The use according to claim 1 or 2, characterized in that The medicine is in the form of oral preparation, injection or spray.

8. A drug for treating asthma, characterized in that: It contains human metapneumovirus.

Images