Application of PPARG gene or / and expression product thereof in preparation of medicine for inhibiting hepatocellular carcinoma, method and medicine

Abstract

The invention relates to the technical fields of molecular biology, developmental biology, cytobiology and medicine, in particular to application of a PPARG gene or / and an expression product thereof in preparation of a medicine for inhibiting hepatocellular carcinoma, a method and the medicine. According to the present invention, the non-nerve cell differentiation-promoting factor PPARG gene or / and the non-nerve cell differentiation-promoting factor PPARG protein is / are adopted to inhibit tumorigenicity and malignant characteristics of liver cancer cells; the invention provides a protein PPARG capable of promoting muscle fiber differentiation, which can promote cancer cells to differentiate into muscle cells, so that the cancer cells lose nerve stemness and further lose tumorigenicity, thereby inhibiting the development process of cancers and treating the cancers. The invention is a novel cancer treatment method developed based on the discovery of the inventor on the essential characteristics of cancer cells, namely the brand-new regularity of the nerve stemness.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology, developmental biology, cell biology and medical technology, and in particular to the use, method and medicine of the PPARG gene or / and its expression products in preparing drugs for inhibiting hepatocellular carcinoma. Background Art

[0002] Malignant tumors (cancer) are extremely complex diseases. Currently, in addition to traditional surgery, radiotherapy, and chemotherapy, targeted therapies are the mainstay of cancer treatment, achieving many positive results. In recent years, immune cell therapy and immune checkpoint inhibitors have been revolutionary breakthroughs in cancer treatment. Immunotherapy, specifically CAR-T cells, has demonstrated promising results in specific hematologic malignancies. However, due to the difficulty CAR-T cells gain access to solid tumors and the inhibitory effects of the solid tumor microenvironment on CAR-T cells, this therapy has yet to be effective in treating solid tumors. Immune checkpoint inhibitors, primarily PD-1 / PD-L1 and CTLA4 inhibitors, have demonstrated promising results in treating several solid tumors. Both targeted therapies and immunotherapies target only a subset of the cancer cells in complex and heterogeneous tumors due to their highly specific targets. Furthermore, complex signaling feedback loops and negative feedback loops within cells can lead to cancer cell resistance, ultimately rendering treatment ineffective. Recent studies have shown that cancer cells can also develop resistance to immunotherapy. Furthermore, studies have shown that, in some cases, immunotherapy can even lead to hyperprogression of cancer. Therefore, although many advances have been made in cancer treatment, in most cases, there is still no effective treatment. The reason is that scientific research still lacks understanding of the nature of cancer occurrence and development.

[0003] In recent years, the research team led by the inventors has found that different types of cancer (tumorigenic) cells have the characteristics of neural stem / progenitor cells, that is, neural stemness. This is because: 1) different types of cancer cells (such as liver cancer, lung cancer, breast cancer, liver cancer, prostate cancer, glioblastoma, melanoma, osteosarcoma, etc.) have the potential to differentiate into neurons and therefore have the characteristics of neural stem / progenitor cells; 2) in the occurrence and development of tumors, the main genes that promote the malignant characteristics of cancer cells (such as unlimited proliferation ability, invasion, migration, escape from apoptosis and immune surveillance, chemical resistance, etc.) are all neural stem cell-specific genes, which means that cancer cells and neural stem / progenitor cells share a large number of regulatory signal networks. These shared neural stem cell-specific genes give cancer cells the characteristics of neural stem cells. The inventors' research further found that neural stemness is a factor that determines and integrates the tumorigenicity and multipotential differentiation potential of cells. In other words, cancer cells are cells with neural stemness and multipotential differentiation potential characteristics.Therefore, the purpose of treating cancer can be achieved by promoting the differentiation of cancer cells, causing them to lose their neural stemness and thus lose their tumorigenicity or malignant characteristics (see the inventor's paper: 1) Similarity in gene-regulatory networks suggests that cancer cells share characteristics of embryonic neural cells. J Biol Chem. 2017, 292(31): 12842-12859; 2) Tumorigenesis as a process of gradual loss of original cell identity and gain of properties of neural precursor / progenitor cells. Cell Biosci. 2017, 7: 61; 3) Neural stemness contributes to cell tumorigenicity. Cell Biosci. 2021 Jan 19; 11(1): 21; 4) Neural stemness unifies cell tumorigenicity and pluripotent differentiation potential. J Biol Chem. 2022 Jul; 298(7): 102106; 5) Neural is Fundamental: Neural Stemness as the Ground State of Cell Tumorigenicity and Differentiation Potential. Stem Cell Rev Rep. 2022 Jan; 18(1): 37-55); 6) Suppression of Cell Tumorigenicity by Non-neural Pro-differentiation Factors via Inhibition of Neural Property in Tumorigenic Cells. Front Cell Dev Biol. 2021 Sep 14; 9: 714383.). According to the principles of developmental biology, differentiation factors of different tissue types must inhibit each other. On the one hand, this promotes the differentiation of cells of a specific tissue type and maintains its characteristics, and on the other hand, it can form boundaries between different tissues.Non-neuronal cell differentiation-promoting factors can promote the differentiation of non-neuronal cells while inhibiting the properties of neural stem cells. Given that neural stemness is an essential characteristic of cancer cells (including liver cancer cells), appropriate non-neuronal cell differentiation-promoting factors can be used to inhibit cancer cells.

[0004] PPARG is a key factor in promoting adipocyte differentiation (see Tontonoz P, Hu E, Spiegelman BM. Regulation of adipocyte gene expression and differentiation by peroxisome proliferator activated receptor gamma. Curr Opin Genet Dev. 1995 Oct; 5(5): 571-6). Based on the neural stem cell characteristics and multipotent differentiation potential of cancer cells, the present invention aims to utilize non-neural cell differentiation-promoting factors to inhibit the neural stemness of cancer cells, develop a treatment for liver cancer, and explore the application of this treatment to the treatment of other cancers. Summary of the Invention

[0005] The present invention aims to overcome the problems existing in the prior art by providing a method, application, and use of the PPARG gene and / or its expression products in the preparation of a drug for inhibiting hepatocellular carcinoma. Based on the neural stem cell characteristics and multipotent differentiation potential of cancer cells, the present invention aims to utilize PPARG, a non-neural cell differentiation-promoting factor, to inhibit the neural stemness of cancer cells, develop a treatment for liver cancer, and explore the application of this treatment for other cancers.

[0006] One of the purposes of the present invention is to utilize the characteristic that cancer cells, including liver cancer cells, have neural stem cell properties to inhibit the neural stemness of cancer cells, thereby inhibiting the tumorigenicity and malignant characteristics of cancer cells, and developing a new strategy for treating liver cancer.

[0007] The second purpose of the present invention is to provide a new medical use of the non-neuronal cell differentiation promoting factor PPARG.

[0008] The third object of the present invention is to provide a drug suitable for treating various malignant tumors.

[0009] The purpose of the present invention and the solution to the technical problem are achieved by adopting the following technical solutions.

[0010] The first aspect of the present invention provides a use of a PPARG gene or / and its expression product in the preparation of a drug for inhibiting hepatocellular carcinoma.

[0011] In some preferred embodiments of the present invention, the PPARG gene and / or its expression product suppresses the neural stemness characteristics of liver cancer cells, causing them to lose their migration, invasion, tumorigenicity or malignant characteristics, thereby achieving the purpose of inhibiting cancer cell migration, invasion, tumorigenicity or promoting cancer cell differentiation into muscle cells.

[0012] The second aspect of the present invention provides a use of an agent that promotes PPARG in the preparation of a drug for inhibiting hepatocellular carcinoma.

[0013] In some preferred embodiments of the present invention, the agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein.

[0014] In some preferred embodiments of the present invention, the agent that promotes PPARG includes a vector that overexpresses PPARG or contains the PPARG gene, such as a viral vector including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, a non-viral vector including but not limited to a cationic polymer vector, a nanoparticle vector, a liposome or a liposome complex, a ligand-mediated targeting vector, a natural polymer material such as collagen, hyaluronic acid, chitosan or alginate.

[0015] The third aspect of the present invention provides a drug for inhibiting hepatocellular carcinoma, the active ingredient of which comprises one of the following:

[0016] (i) PPARG protein;

[0017] (ii) the coding sequence of the PPARG protein;

[0018] (iii) an expression vector for overexpressing PPARG, containing the coding sequence of the PPARG protein.

[0019] In some preferred embodiments of the present invention, the expression vector includes a viral vector and a non-viral vector; the viral vector includes but is not limited to adenovirus, lentivirus, retrovirus, and adeno-associated virus; the non-viral vector includes but is not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials including but not limited to collagen, hyaluronic acid, chitosan or alginate.

[0020] In some preferred embodiments of the present invention, a pharmaceutically acceptable carrier and / or excipient is further included.

[0021] In some preferred embodiments of the present invention, the dosage form of the drug includes oral preparations such as tablets, powders, granules, capsules, pills, sustained-release pellets, solid dispersions, inclusion compounds, liquid preparations such as suspensions, emulsions, melts, syrups, mixtures, solutions, injectable preparations such as injections, aqueous or oily suspensions, emulsions, liposomes, microcapsules, microspheres, nanoparticles, sustained-release or controlled-release preparations, preferably injectables.

[0022] In some preferred embodiments of the present invention, the inhibition of hepatocellular carcinoma includes promoting the differentiation of cancerous tissue cells into muscle cells, and inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells.

[0023] The fourth aspect of the present invention provides a general method for inhibiting tumors, which includes the following process: promoting PPARG in a subject in need thereof, wherein the promotion of PPARG includes promoting the transcription of the PPARG gene, promoting the expression of the PPARG gene, promoting the function of the PPARG protein, and / or inhibiting the degradation of the PPARG protein.

[0024] In some preferred embodiments of the present invention, the promotion of PPARG is performed by administering to the subject one or more of: non-neuronal cell differentiation promoting factor PPARG protein, PPARG protein coding sequence, or expression vectors that overexpress PPARG or contain PPARG protein coding sequence.

[0025] In some preferred embodiments of the present invention, the expression vector includes a viral vector and a non-viral vector; the viral vector includes but is not limited to adenovirus, lentivirus, retrovirus, and adeno-associated virus; the non-viral vector includes but is not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials including but not limited to collagen, hyaluronic acid, chitosan or alginate.

[0026] In some preferred embodiments of the present invention, the promotion of PPARG is performed systemically or locally in the subject, such as in tumor cells.

[0027] In some preferred embodiments of the present invention, the tumor is preferably a human malignant solid tumor, such as liver cancer, colon cancer, melanoma, preferably hepatocellular carcinoma.

[0028] The fifth aspect of the present invention provides a method for promoting the differentiation of cancerous tissue cells into muscle cells, the method comprising: promoting PPARG in cancerous tissue, wherein the promotion of PPARG includes promoting the transcription of the PPARG gene, promoting the expression of the PPARG gene, promoting the function of the PPARG protein, and / or inhibiting the degradation of the PPARG protein.

[0029] The sixth aspect of the present invention provides a method for inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells, the method comprising: promoting PPARG in cancerous tissue, wherein the promotion of PPARG includes promoting the transcription of the PPARG gene, promoting the expression of the PPARG gene, promoting the function of the PPARG protein, and / or inhibiting the degradation of the PPARG protein.

[0030] In some preferred embodiments of the present invention, the promotion of PPARG is performed by administering to the subject one or more of: non-neuronal cell differentiation promoting factor PPARG protein, PPARG protein coding sequence, or expression vectors that overexpress PPARG or contain PPARG protein coding sequence.

[0031] In some preferred embodiments of the present invention, the expression vector includes a viral vector and a non-viral vector; the viral vector includes but is not limited to adenovirus, lentivirus, retrovirus, and adeno-associated virus; the non-viral vector includes but is not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials including but not limited to collagen, hyaluronic acid, chitosan or alginate.

[0032] In some preferred embodiments of the present invention, the promotion of PPARG is performed systemically or locally in the subject, such as in tumor cells.

[0033] In some preferred embodiments of the present invention, the tumor is preferably a human malignant solid tumor, such as liver cancer, colon cancer, melanoma, preferably hepatocellular carcinoma.

[0034] A seventh aspect of the present invention provides a use of a PPARG-promoting agent in the preparation of a drug for promoting the differentiation of cancerous tissue cells into muscle cells.

[0035] An eighth aspect of the present invention provides a use of an agent that promotes PPARG in the preparation of a drug for inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells.

[0036] In some preferred embodiments of the present invention, the agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein.

[0037] In some preferred embodiments of the present invention, the agent that promotes PPARG includes a vector that overexpresses PPARG or contains the PPARG gene, such as a viral vector including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, a non-viral vector including but not limited to a cationic polymer vector, a nanoparticle vector, a liposome or a liposome complex, a ligand-mediated targeting vector, a natural polymer material such as collagen, hyaluronic acid, chitosan or alginate.

[0038] A ninth aspect of the present invention provides a drug for promoting the differentiation of cancerous tissue cells into muscle cells, wherein the drug comprises an agent that promotes PPARG.

[0039] A tenth aspect of the present invention provides a drug for inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells, wherein the drug comprises an agent that promotes PPARG.

[0040] In some preferred embodiments of the present invention, the agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein.

[0041] In some preferred embodiments of the present invention, the agent that promotes PPARG includes a vector that overexpresses PPARG or contains the PPARG gene, such as a viral vector including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, a non-viral vector including but not limited to a cationic polymer vector, a nanoparticle vector, a liposome or a liposome complex, a ligand-mediated targeting vector, a natural polymer material such as collagen, hyaluronic acid, chitosan or alginate.

[0042] Through the above technical solution, the present invention has at least the following advantages: The present invention utilizes the non-neuronal cell differentiation-promoting factor PPARG gene and / or protein to inhibit the tumorigenicity and malignant characteristics of liver cancer cells. The present invention provides a protein called PPARG that promotes myofiber differentiation, which can promote the differentiation of cancer cells into myocytes, causing them to lose their neural stemness and thus their tumorigenicity, thereby inhibiting the progression of cancer and treating cancer. The present invention is a novel cancer treatment method developed based on the inventors' novel discovery of the regularity of an essential characteristic of cancer cells (i.e., neural stemness).

[0043] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a detailed description of the preferred embodiments of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1Western blotting was used to detect the expression of PPARG in SKHEP1 cells and the inhibitory effect of PPARG on neural stemness factors and tumor-promoting factors. The results showed that the expression of PPARG in SKHEP1 liver cancer cells led to a decrease in the expression of neural stemness factors and tumor-promoting factors, and an increase in the expression of myokines.

[0045] Figure 2 Crystal violet staining was used to detect changes in cell migration ability after SKHEP1 liver cancer cells were infected with a lentivirus expressing PPARG. The results showed that the expression of PPARG in SKHEP1 liver cancer cells decreased the migration ability of cancer cells.

[0046] Figure 3 Crystal violet staining was used to detect changes in the invasive ability of liver cancer cells SKHEP1 after infection with a lentivirus expressing PPARG. The results showed that the expression of PPARG in liver cancer cells SKHEP1 decreased the invasive ability of the cancer cells.

[0047] Figure 4 The changes in volume and weight of transplanted tumors formed after SKHEP1 hepatocellular carcinoma cells were infected with a lentivirus expressing PPARG. This shows that expressing PPARG in SKHEP1 hepatocellular carcinoma cells reduces the tumorigenicity of the cancer cells.

[0048] Figure 5 This data shows changes in the mouse liver after injection of adeno-associated virus expressing PPARG into a mouse liver cancer model; it shows that in a mouse liver cancer model, injection of adeno-associated virus expressing PPARG can inhibit the occurrence / development of liver cancer. DETAILED DESCRIPTION

[0049] In order to make the technical means, creative features, objectives and effects achieved by the present invention easier to understand, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0050] [definition]

[0051] PPARG: PPARG stands for peroxisome proliferative activated receptor gamma. The PPARG gene is located on chromosome 3, 3p25. Four different mRNA forms encode two proteins, one composed of 477 amino acid residues and the other of 505. PPARG is a regulator of adipocyte differentiation. Furthermore, PPARG is implicated in the pathology of various diseases, including obesity, diabetes, atherosclerosis, and cancer. PPARG's Genbank ID is NM_015869.

[0052] Carriers or excipients: Pharmaceutically acceptable carriers or excipients as used herein refer to additives commonly used in the pharmaceutical field other than active ingredients, such as diluents (starches, sugars, celluloses, and inorganic salts), excipients, fillers such as starch and sucrose, binders such as water, ethanol, cellulose derivatives, gelatin, and polyvinylpyrrolidone, disintegrants such as dry starch and sodium carboxymethyl starch, solubilizers such as polysorbates and polyoxyethylene fatty acid esters, absorption enhancers, surfactants such as Tween and Spam, adsorption carriers, and lubricants such as magnesium stearate and micronized silica gel. Other excipients such as flavoring agents and sweeteners may also be added to the composition.

[0053] Administration: The drugs of the present invention can be administered to patients in need of such treatment in the form of pharmaceutical compositions via oral administration, nasal inhalation, rectal administration, parenteral administration, or transdermal administration. For oral administration, they can be formulated into conventional solid preparations such as tablets, powders, granules, capsules, pills, sustained-release pellets, solid dispersions, inclusion compounds, and liquid preparations such as suspensions, emulsions, melts, syrups, mixtures, and solutions. For parenteral administration, they can be formulated into injectable solutions, aqueous or oily suspensions, emulsions, liposomes, microcapsules, microspheres, nanoparticles, and various sustained-release and controlled-release formulations. Injections are preferred, with injections that target release at specific sites being particularly preferred.

[0054] Solid tumor: As used herein, the term "solid tumor" refers to an abnormal mass of tissue that includes cancer cells. In various embodiments, for example, as set forth herein, a solid tumor is or includes an abnormal mass of tissue that does not contain cysts or fluid areas. In some embodiments, for example, as set forth herein, a solid tumor can be benign; in some embodiments, a solid tumor can be malignant. Examples of solid tumors include carcinomas, lymphomas, and sarcomas. In some embodiments, for example, as set forth herein, a solid tumor can be or include a tumor of the adrenal gland, bile duct, bladder, bone, brain, breast, cervix, colon, endometrium, esophagus, eye, gallbladder, gastrointestinal tract, kidney, larynx, liver, lung, nasal cavity, nasopharynx, oral cavity, ovary, penis, pituitary gland, prostate, retina, salivary gland, skin, small intestine, stomach, testicle, thymus, thyroid, uterus, vagina, and / or vulva.

[0055] The above-mentioned solid tumors are all within the scope of the present invention.

[0056] Variant: As used herein, the term "variant" refers to an entity that exhibits significant structural identity to a reference entity but differs structurally from the reference entity in the presence, absence, or level of one or more chemical moieties as compared to the reference entity. In some embodiments, for example, as provided herein, a variant also differs functionally from its reference entity. Generally speaking, whether a particular entity is appropriately considered a "variant" of a reference entity depends on the degree of structural identity it exhibits to the reference entity. A variant can be a molecule that is comparable but not identical to the reference. For example, a variant nucleic acid can differ from a reference nucleic acid at one or more differences in nucleotide sequence. In some embodiments, for example, as provided herein, a variant nucleic acid exhibits an overall sequence identity of at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% to a reference nucleic acid. In many embodiments, for example, as provided herein, a nucleic acid of interest is considered a "variant" of a reference nucleic acid if it has a sequence identical to the reference sequence but with minor sequence changes at specific positions. In some embodiments, for example, as set forth herein, the variant has 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 substituted residues compared to a reference. In some embodiments, for example, as set forth herein, the variant has no more than 5, 4, 3, 2, or 1 residue additions, substitutions, or deletions compared to a reference. In various embodiments, for example, as set forth herein, the number of additions, substitutions, or deletions is less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and typically less than about 5, about 4, about 3, or about 2 residues.

[0057] The promotion of PPARG according to the present invention may target wild-type PPARG or a PPARG variant as defined above.

[0058] The present invention is based on the neural stem cell characteristics and multipotent differentiation potential of cancer cells, and aims to use the non-neural cell differentiation-promoting factor PPARG to inhibit the neural stemness of cancer cells, thereby achieving the purpose of inhibiting the invasion, migration and tumorigenicity of cancer cells.

[0059] Therefore, the present invention can inhibit the expression of neural stemness factors and tumor-promoting factors in cancer cells by overexpressing PPARG in cancer tissues, thereby reducing cell wall invasion, migration and tumorigenicity. Therefore, the present invention provides the following exemplary embodiments.

[0060] [Application of PPARG gene or / and its expression product in the preparation of drugs for inhibiting hepatocellular carcinoma]

[0061] In some embodiments of the present invention, there is provided a use of a PPARG gene or / and its expression product in the preparation of a drug for inhibiting hepatocellular carcinoma.

[0062] In some embodiments of the present invention, the PPARG gene and / or its expression product suppresses the neural stemness characteristics of liver cancer cells, causing them to lose their migration, invasion, tumorigenicity or malignant characteristics, thereby achieving the purpose of inhibiting cancer cell migration, invasion, tumorigenicity or promoting cancer cell differentiation into muscle cells.

[0063] In some embodiments of the present invention, the non-neuronal cell differentiation promoting factor PPARG is human non-neuronal cell differentiation promoting factor, PPARG Genbank ID: NM_015869.

[0064] [Application of PPARG-stimulating agents in the preparation of drugs for inhibiting hepatocellular carcinoma]

[0065] In some embodiments of the present invention, there is provided a use of an agent that promotes PPARG in the preparation of a drug for inhibiting hepatocellular carcinoma.

[0066] In some embodiments of the present invention, the agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein.

[0067] In some embodiments of the present invention, the agent that promotes PPARG includes a vector that overexpresses PPARG or contains the PPARG gene, such as a viral vector including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, a non-viral vector including but not limited to a cationic polymer vector, a nanoparticle vector, a liposome or a liposome complex, a ligand-mediated targeting vector, a natural polymer material such as collagen, hyaluronic acid, chitosan or alginate.

[0068] [Drugs that inhibit hepatocellular carcinoma]

[0069] In some embodiments of the present invention, a drug for inhibiting hepatocellular carcinoma is provided, wherein the active ingredient comprises one of the following:

[0070] (i) PPARG protein;

[0071] (ii) the coding sequence of PPARG protein;

[0072] (iii) an expression vector for overexpressing PPARG, containing the coding sequence of the PPARG protein.

[0073] In some embodiments of the present invention, the expression vector includes a viral vector and a non-viral vector; the viral vector includes but is not limited to adenovirus, lentivirus, retrovirus, and adeno-associated virus; the non-viral vector includes but is not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials including but not limited to collagen, hyaluronic acid, chitosan or alginate.

[0074] In some embodiments of the present invention, the expression vector is an adeno-associated viral vector AAV-CBh-PPARG-eGFP, and the injection dose of the adeno-associated viral vector is 1 to 10×10 11 vg is preferably 2 to 3×10 11 vg.

[0075] In some embodiments of the present invention, a pharmaceutically acceptable carrier and / or excipient is further included.

[0076] In some embodiments of the present invention, the dosage form of the drug includes oral preparations such as tablets, powders, granules, capsules, pills, sustained-release pellets, solid dispersions, inclusion compounds, liquid preparations such as suspensions, emulsions, melts, syrups, mixtures, solutions, injectable preparations such as injection solutions, aqueous or oily suspensions, emulsions, liposomes, microcapsules, microspheres, nanoparticles, sustained-release or controlled-release preparations, preferably injectables.

[0077] In some embodiments of the present invention, the inhibition of hepatocellular carcinoma includes promoting the differentiation of cancerous tissue cells into muscle cells, and inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells.

[0078] [Universal Method for Tumor Inhibition]

[0079] In some embodiments of the present invention, a general method for inhibiting tumors is provided, which comprises the following process: promoting PPARG in a subject in need thereof, wherein the promotion of PPARG includes promoting the transcription of the PPARG gene, promoting the expression of the PPARG gene, promoting the function of the PPARG protein, and / or inhibiting the degradation of the PPARG protein.

[0080] In some embodiments of the present invention, the promotion of PPARG is performed by administering to the subject one or more of: non-neuronal cell differentiation promoting factor PPARG protein, PPARG protein coding sequence, or expression vectors overexpressing PPARG or containing PPARG protein coding sequence.

[0081] In some embodiments of the present invention, the expression vector includes a viral vector and a non-viral vector; the viral vector includes but is not limited to adenovirus, lentivirus, retrovirus, and adeno-associated virus; the non-viral vector includes but is not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials including but not limited to collagen, hyaluronic acid, chitosan or alginate.

[0082] In some embodiments of the present invention, the expression vector is an adeno-associated viral vector AAV-CBh-PPARG-eGFP, and the injection dose of the adeno-associated viral vector is 1 to 10×10 11 vg is preferably 2 to 3×10 11 vg.

[0083] In some embodiments of the invention, the stimulation of PPARG occurs systemically or locally in the subject, such as in tumor cells.

[0084] In some embodiments of the present invention, the tumor is preferably a human malignant solid tumor, such as liver cancer, colon cancer, melanoma, and more preferably hepatocellular carcinoma.

[0085] [Methods for promoting the differentiation of cancerous tissue cells into muscle cells], [Methods for inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells]

[0086] In some embodiments of the present invention, a method for promoting the differentiation of cancerous tissue cells into muscle cells is provided, the method comprising: promoting PPARG in cancerous tissue, wherein the promotion of PPARG includes promoting the transcription of the PPARG gene, promoting the expression of the PPARG gene, promoting the function of the PPARG protein, and / or inhibiting the degradation of the PPARG protein.

[0087] In some embodiments of the present invention, a method for inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells is provided, the method comprising: promoting PPARG in cancerous tissue, wherein the promotion of PPARG includes promoting the transcription of the PPARG gene, promoting the expression of the PPARG gene, promoting the function of the PPARG protein, and / or inhibiting the degradation of the PPARG protein.

[0088] In some embodiments of the present invention, the promotion of PPARG is performed by administering to the subject one or more of: non-neuronal cell differentiation promoting factor PPARG protein, PPARG protein coding sequence, or expression vectors overexpressing PPARG or containing PPARG protein coding sequence.

[0089] In some embodiments of the present invention, the expression vector includes a viral vector and a non-viral vector; the viral vector includes but is not limited to adenovirus, lentivirus, retrovirus, and adeno-associated virus; the non-viral vector includes but is not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials including but not limited to collagen, hyaluronic acid, chitosan or alginate.

[0090] In some embodiments of the present invention, the expression vector is an adeno-associated viral vector AAV-CBh-PPARG-eGFP, and the injection dose of the adeno-associated viral vector is 1 to 10×10 11 vg is preferably 2 to 3×10 11 vg.

[0091] In some embodiments of the invention, the stimulation of PPARG occurs systemically or locally in the subject, such as in tumor cells.

[0092] In some embodiments of the present invention, the tumor is preferably a human malignant solid tumor, such as liver cancer, colon cancer, melanoma, preferably hepatocellular carcinoma.

[0093] [Use of a PPARG-stimulating agent in the preparation of a drug for promoting the differentiation of cancerous tissue cells into muscle cells], [Use of a PPARG-stimulating agent in the preparation of a drug for inhibiting the migration, invasion, or tumorigenicity of cancerous tissue cells]

[0094] In some embodiments of the present invention, there is provided a use of an agent that promotes PPARG in the preparation of a drug for promoting the differentiation of cancerous tissue cells into muscle cells.

[0095] In some embodiments of the present invention, there is provided a use of an agent that promotes PPARG in the preparation of a medicament for inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells.

[0096] In some embodiments of the present invention, the agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein.

[0097] In some embodiments of the present invention, the agent that promotes PPARG includes a vector that overexpresses PPARG or contains the PPARG gene, such as a viral vector including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, a non-viral vector including but not limited to a cationic polymer vector, a nanoparticle vector, a liposome or a liposome complex, a ligand-mediated targeting vector, a natural polymer material such as collagen, hyaluronic acid, chitosan or alginate.

[0098] In some embodiments of the present invention, the expression vector is an adeno-associated viral vector AAV-CBh-PPARG-eGFP, and the injection dose of the adeno-associated viral vector is 1 to 10×10 11 vg is preferably 2 to 3×10 11 vg.

[0099] [Drugs that promote the differentiation of cancerous tissue cells into muscle cells], [Drugs that inhibit the migration, invasion, or tumorigenicity of cancerous tissue cells]

[0100] In some embodiments of the present invention, a drug is provided for promoting the differentiation of cancerous tissue cells into muscle cells, the drug comprising an agent that promotes PPARG.

[0101] In some embodiments of the present invention, a drug for inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells is provided, characterized in that the drug includes an agent that promotes PPARG.

[0102] In some embodiments of the present invention, the agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein.

[0103] In some embodiments of the present invention, the agent that promotes PPARG includes a vector that overexpresses PPARG or contains the PPARG gene, such as a viral vector including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, a non-viral vector including but not limited to a cationic polymer vector, a nanoparticle vector, a liposome or a liposome complex, a ligand-mediated targeting vector, a natural polymer material such as collagen, hyaluronic acid, chitosan or alginate.

[0104] In some embodiments of the present invention, the expression vector is an adeno-associated viral vector AAV-CBh-PPARG-eGFP, and the injection dose of the adeno-associated viral vector is 1 to 10×10 11 vg is preferably 2 to 3×10 11 vg.

[0105] Example

[0106] The reagents and raw materials used in the present invention are all commercially available or can be prepared according to literature methods. Experimental methods in the following examples where specific conditions are not specified are generally carried out according to conventional conditions such as those described in Molecular Cloning: A Laboratory Manual (4th Edition) (J. Sambrook and MR Green, translated by He Fuchu et al., Science Press, 2017), or according to conventional conditions or the conditions recommended by the product manufacturer.

[0107] The quantitative tests in the following examples were all repeated three times, and the average value was taken as the result.

[0108] Example 1: Detection of the inhibitory effect of PPARG on neural stemness factors and tumor promoting factors

[0109] A PPARG lentiviral expression vector was constructed and packaged with PPARG-expressing lentivirus. SKHEP1 hepatocellular carcinoma cells (purchased from the Chinese Academy of Sciences Cell Bank) were infected with Dulbecco's modified eagle medium (DMEM, #11965-092, Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS, Gibco, #10099141), 50 U / mL penicillin, and 50 μg / mL streptomycin. Cultures were maintained at 37°C in a 5% CO2 incubator. Western blotting was used to examine PPARG expression in SKHEP1 cells and the inhibitory effects of PPARG on neural stemness factors and tumor-promoting factors were also examined.

[0110] The coding sequence of PPARG (NCBI Reference Sequence: NM_015869.5) was ligated into the lentiviral expression vectors pLVX-IRES-puro and pLVX-IRES-Zsgreen1 to construct the expression plasmids pLVX-PPARG-IRES-puro and pLVX-PPARG-IRES-Zsgreen1.

[0111] The specific method is as follows:

[0112] (i) The PPARG gene sequence fragment was amplified by PCR from cDNA of human embryonic kidney 293T cells (purchased from the Cell Bank of the Chinese Academy of Sciences) using the designed primers.

[0113] The PCR amplification system is shown in Table 1.

[0114] Table 1 PCR reaction system (total 50 μL)

[0115] <![CDATA[ddH2O]]> 19 μL 293T cDNA 2μL PPARG-Forward primer (10 μM) 0.8μL PPARG-Reverse primer (10 μM) 0.8μL 2x Taq Mix 25 μL

[0116] The PCR amplification reaction conditions were: 95°C for 3 min, 95°C for 15 s, 60°C for 15 s, 72°C for 1 min 45 s, and 72°C for 5 min.

[0117] (ii) The PCR product was subjected to agarose electrophoresis to recover the PPARG target band of 1518 bp on agarose gel. The amplified PPARG fragment was obtained using a DNA Gel Extraction Kit (Cat. No.: 30519KE1, purchased from Corning Life Sciences, Inc.).

[0118] (iii) Using the double enzyme digestion method of Xba1 and Not1, the two blank vectors pLVX-IRES-puro and pLVX-IRES-Zsgreen1 and the PPARG amplified fragment were digested at 37°C, respectively. After the two digested vectors and fragments were treated with a PCR clean up kit (Cat. No.: 11113KB1, purchased from Corning Life Sciences, Inc.), the two double enzyme digested vectors and amplified fragments were incubated at 16°C for more than 20 hours to connect the vectors and fragments.

[0119] (iv) Transform the two ligated products into E. coli. Spread the bacterial suspension onto a solid LB plate and incubate at 37°C for 12-17 hours. Once colonies have grown, add 1 mL of LB liquid medium containing antibiotics to a 1.5 mL centrifuge tube. Label the colonies and pick single colonies to place in liquid medium, placing one colony per tube. Incubate at 37°C, shaking at 200 rpm for 5 hours.

[0120] (v) PCR identification of bacterial solution. After the PCR reaction, the PCR reaction product was subjected to 1% agarose gel electrophoresis and observed and photographed under a gel imager. Positive colonies were selected based on the size of the target band and sent for sequencing. The sequencing results were compared with the target band sequence to determine whether the construction was successful.

[0121] The PCR reaction system is shown in Table 2.

[0122] Table 2 PCR reaction system (total 20 μL)

[0123] <![CDATA[ddH2O]]> 7.4μL bacterial liquid 1 μL PPARG-Forward primer (10 μM) 0.8μL PPARG-Reverse primer (10 μM) 0.8μL 2x Taq Mix 10 μL

[0124] The PCR amplification reaction conditions were: 95°C for 3 min, 95°C for 15 s, 60°C for 15 s, 72°C for 1 min 45 s, and 72°C for 5 min.

[0125] The primer sequences involved in the above process are:

[0126] PPARG-Forward primer:ccggtctagaatggttgacacagagatg;

[0127] PPARG-Reverse primer:ccgggcggccgcgtacaagtccttgtagatctc.

[0128] HEK293T cells were cultured to 70-90% confluence in a 6cm dish. The expression plasmid pLVX-PPARG-IRES-puro and the packaging plasmids 8.91 and SVG were mixed in a ratio of 3.33:2.5:1 in 500 μL of serum-free Opti-MEM medium (Opti-MEM, #31985-070, Thermo Fisher Scientific). The transfection reagent PEI was then added at a volume / mass ratio 3 times the total amount of plasmid. After mixing, the cells were allowed to stand for 15 minutes before being added to the HEK293T cell culture dish and placed in a 37°C, 5% CO2 incubator. After 6 hours, the culture medium was replaced with fresh DMEM supplemented with 10% FBS. Incubation continued at 37°C, 5% CO2. 48 hours after transfection, all the culture medium from the dish was collected and mature viral particles were suspended in the medium. The culture medium was then filtered through a 0.45 μm filter and used.

[0129] The auxiliary transfection reagent polybrene was added to the filtered virus-containing medium at a final concentration of 10 μg / mL. The mixture was then added to a culture dish of SKHEP1 cells grown to 70-80% confluence for infection. The cells were incubated at 37°C in a 5% CO2 incubator for 12 hours, after which the medium was changed. Following lentiviral infection, the cells were cultured at 37°C in a 5% CO2 incubator for 2 days. The cells were then selected with the selection antibiotic puromycin at a concentration of 2 μg / mL for 2 days to kill uninfected cells. After 8 days of culture, whole-cell protein was harvested using cell lysis buffer. After quantification with a protein standard, 20 μg of each protein was electrophoresed on a 10% SDS-PADE gel at a constant voltage of 100 V to separate the proteins. Following electrophoresis, the electrotransfer membrane (PVDF membrane) and the SDS-PADE gel were stacked and placed in a transfer tank filled with transfer buffer. Electrophoresis was performed at a constant voltage of 100 V for 120 minutes, and the protein bands from the gel were transferred to the PVDF membrane. Then, the PVDF membrane was blocked with 20 mL of 5% skim milk at room temperature for 2 hours, and different primary antibodies were used (for specific information, see the following paragraph), and beta-ACT antibody was used to detect the expression of beta-ACT as an internal reference, and incubated overnight at 4°C. Then, TBST was washed 3 times, each time for 10 minutes. Then, rabbit / mouse secondary antibody (1:10000) was incubated at room temperature for 2 hours, and TBST was washed 3 times, each time for 10 minutes. Protein immunoblotting was displayed by immunoblotting substrate purchased from Tianneng Company (purchased from Tanon, item number #180-501), and fluorescence was detected by Odyssey infrared laser imaging system and protein signal was scanned in grayscale. The results are shown in Figure 1 .

[0130] The types of primary antibodies (as well as their sources and dilution concentrations) were: beta-ACT (purchased from Cell Signaling, catalog number #4970. 1:10,000), PPARG (purchased from Cell Signaling, catalog number #2435. 1:1000), EZH2 (purchased from Cell Signaling, catalog number #5246. 1:4,000), LSD1 (purchased from Cell Signaling Technology, catalog number #2139. 1:2000), DNMT1 (purchased from Abcam, catalog number #ab13537. 1:2000), C-MYC (purchased from Abcam, catalog number #ab32072. 1:2000), SOX2 (purchased from Cell Signaling Technology, catalog number #5246. 1:4,000), and IL-67 (purchased from Cell Signaling Technology, catalog number #2139. 1:2000). Technology, catalog number #3579. 1:1000), SF3B1 (purchased from Abcam, catalog number #ab172634. 1:1000), RPS3 (purchased from Abclonal, catalog number #A2533. 1:1000).

[0131] See the results Figure 1 The results showed that PPARG was successfully overexpressed in SKHEP1 cells. At the same time, the amount of proteins that promote tumorigenesis / development in the cells decreased significantly. According to the inventors’ research, these proteins that promote tumorigenesis / development are also neural stem proteins ( Figure 1 ).

[0132] Example 2: After the liver cancer cells SKHEP1 were infected with a lentivirus expressing PPARG, the changes in cell migration ability were detected using Transwell assay

[0133] The lower half of the insert of a Transwell-24 well plate (insert pore size 8 μm, purchased from Corning, catalog #3422) was immersed in 500 μL of culture medium containing 10% fetal bovine serum (FBS). Using the method described in [Example 1], 1×10 5 SKHEP1 cells (cultured for 6 days) infected with PPARG-expressing lentivirus and selected by puromycin were mixed with 200 μL serum-free DMEM medium and then added to the upper half of the chamber. 5 SKHEP1 cells infected with blank vector lentivirus and selected by puromycin were mixed with 200 μL serum-free culture medium, and then the cells were added to the upper half of another chamber. The Transwell-24 well plate was then placed in an incubator at 37°C and containing 5% CO2 for 24 hours. After fixing the cells with 37% formaldehyde solution for 10 minutes, the cells were stained with 0.5% (w / v) crystal violet staining solution for 10 minutes. The cells on the upper layer of the chamber were wiped away with a cotton swab and then washed three times with PBS solution. The migration of the cells was then observed and recorded under a microscope. The results are shown in Figure 2 .

[0134] The results showed that the expression of PPARG in SKHEP1 cells strongly inhibited the migration ability of SKHEP1 cells ( Figure 2 ).

[0135] Example 3: After the liver cancer cells SKHEP1 were infected with a lentivirus expressing PPARG, the changes in cell invasion ability were detected using Transwell assay

[0136] The melted Matrigel (Matrigel, purchased from Corning, catalog number #354234) was diluted with PBS solution at a ratio of 1:8 (v / v) and mixed. 80 μL of diluted Matrigel was spread in the chamber of the Transwell-24 well plate (the chamber pore size (pore size of inserts) was 8 μm, purchased from Corning, catalog number #3422). The Transwell-24 well plate was then placed in a humidified incubator at 37°C for 60 minutes. At the same time, SKHEP1 cells that had been infected with a lentivirus expressing PPARG, screened with puromycin, and cultured for 6 days were separated from the culture dish with trypsin solution. As a control, cells infected with a blank vector virus were treated in parallel. Then, trypsin was inactivated with a culture medium containing 10% fetal bovine serum, and the cells were subsequently washed three times by centrifugation with a serum-free culture medium. 5×10 5 The cells were suspended and evenly spread on the hardened basement gel. The lower half of the Transwell-24 well plate chamber was submerged in 500 μL of culture medium containing 10% fetal bovine serum. Afterwards, the Transwell-24 well plate was placed in an incubator and cultured at 37°C and 5% CO2 for 8 hours. After fixing the cells with 37% formaldehyde solution for 10 minutes, the cells were stained with 0.5% (w / v) crystal violet staining solution for 10 minutes. Use a cotton swab to wipe away the cells on the upper layer of the chamber, and then wash three times with PBS solution. The migration of the cells was then observed and recorded under a microscope. The results are shown in Figure 3 .

[0137] The results showed that the expression of PPARG in SKHEP1 cells strongly inhibited the invasion ability of SKHEP1 cells ( Figure 3 ).

[0138] Example 4: Changes in the subcutaneous tumor-forming ability of SKHEP1 hepatocellular carcinoma cells in immunodeficient nude mice after infection with a lentivirus containing the PPARG protein coding region sequence

[0139] When SKHEP1 cells grew to 70-80% confluence in a culture dish, they were infected with a PPARG-expressing lentivirus using the method described in [Example 1] and screened with puromycin. After screening, the cells were cultured for 3 days and then injected subcutaneously into immunodeficient nude mice (purchased from Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd.). SKHEP1 cells infected with a blank vector-packaged lentivirus were injected in the same manner as a control. The number of cells injected per mouse was 3×10 6Five mice were injected with control and PPARG overexpressing cells respectively. The volume of transplanted tumor was measured regularly and the volume was calculated according to the formula (0.5×length×width 2 ) The volume of the transplanted tumor was calculated, and the growth curve of the transplanted tumor was prepared based on the growth volume of the transplanted tumor. The significance of the difference in tumor growth was statistically analyzed using the two-sided ANOVA-Bonferroni / Dunn test (*P<0.05, **P<0.01, ***P<0.001). 56 days after the injection of cells, the mice were euthanized, the transplanted tumors were taken, the transplanted tumor volume was measured, and the significance of the difference in tumor weight was statistically analyzed using the two-tailed Student's t-test (*P<0.05, **P<0.01, ***P<0.001). The differences in transplanted tumors formed subcutaneously in nude mice between the control and PPARG-overexpressing cells were compared. The results are shown in Figure 4 .

[0140] The results showed that the growth and weight of the transplanted tumors formed by cells overexpressing PPARG were significantly smaller than those formed by control cells. This indicates that PPARG can inhibit the tumorigenicity of cancer cells ( Figure 4 ).

[0141] Example 5: PPARG exhibits the ability to inhibit the occurrence and development of liver cancer in a mouse model of liver cancer

[0142] Male C57BL / 6J mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were randomly divided into two groups. A mouse liver cancer model was established using the DEN (Diethylnitrosamine) / CCl4 chemical induction method. At 14 days of age, each mouse received a single intraperitoneal injection of DEN at a dose of 25 mg / kg body weight. CCl4 was dissolved in olive oil at a volume ratio of 1:4. Starting from 4 weeks of age, each mouse received an intraperitoneal injection of CCl4 twice a week at a dose of 5 μL / g body weight for 16 consecutive weeks to establish a mouse liver cancer model.

[0143] To verify whether PPARG has the effect of inhibiting liver cancer, Heyuan Bio constructed an adeno-associated virus (AAV) vector (AAV-PPARG-eGFP) expressing PPARG and packaged it with AAV2 / 8 serotype virus suitable for liver infection for injection into mice. A blank vector-packaged virus (AAV-eGFP) was used as a negative control. When the mice were 16 weeks old, the first AAV virus injection was performed by tail vein injection. The virus dose injected into each mouse was 2×10 11vg. One group of mice was injected with AAV-EGFP virus through the tail vein. Another group of mice was injected with AAV-PPARG-eGFP. When the mice were 20 weeks old, the second AAV virus injection was performed in the same manner as the first. During the experiment, the body weight of each mouse was recorded weekly. When the mice were 30 weeks old, they were euthanized. The liver was removed, the liver tumor formation was observed, the liver weight was weighed, and the liver to body weight ratio was calculated. The results are shown in Figure 5 .

[0144] The results showed that injection of AAV virus expressing PPARG could significantly inhibit the occurrence and development of liver cancer ( Figure 5 ).

[0145] In addition, according to literature reports, the PPARG gene is lowly expressed in breast cancer due to hypermethylation (see Wu et al. Integrated Analysis of the Expression Characteristics, Prognostic Value, and Immune Characteristics of PPARG in Breast Cancer. Front Genet. 2021 Sep 9; 12: 737656). The inactivation of PPARG has the effect of promoting cancer occurrence (see Caruso et al. Loss of PPARγactivity characterizes early protumorigenic stromal reprogramming and dictates the therapeutic window of opportunity. Proc Natl Acad Sci US A. 2023 Oct 17; 120 (42): e2303774120). The liver cancer cell line SKHEP1 used in this study had almost no expression of PPARG. In the experiment, protein blotting, RT-PC and immunofluorescence experiments all observed that the expression of PPARG in the liver cancer cell line SKHEP1 was significantly increased after overexpression of exogenous genes.

[0146] In subsequent studies, the research team discovered that, in addition to the liver cancer cell line SKHEP1, the PPARG gene and / or its expression products exhibited significant inhibitory effects on other tumor cell types, including but not limited to the human colon cancer cell line HCT116, the mouse melanoma cell line B16F10, and the mouse colon cancer cell line CT26. In these cell lines, the PPARG gene and / or its expression products inhibited the neural stemness, proliferation, invasion, migration, and tumorigenicity of tumor cells.

[0147] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as a preferred embodiment as above, it is not intended to limit the present invention. Any technician familiar with this profession can make slight changes or modifications to equivalent embodiments of the methods and technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. Use of PPARG gene or / and its expression product in the preparation of a drug for inhibiting hepatocellular carcinoma, characterized in that: The PPARG gene and / or its expression product suppresses the neural stemness characteristics of liver cancer cells, causing them to lose their migration, invasion, tumorigenicity or malignant characteristics, thereby achieving the purpose of suppressing cancer cell migration, invasion, tumorigenicity or promoting cancer cell differentiation into muscle cells.

2. Application of agents that promote PPARG in the preparation of drugs that inhibit hepatocellular carcinoma.

3. The use according to claim 2, characterized in that The agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein; The agents that promote PPARG include vectors that overexpress PPARG and contain the PPARG gene, such as viral vectors including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, non-viral vectors including but not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials such as collagen, hyaluronic acid, chitosan or alginate.

4. Drugs for inhibiting hepatocellular carcinoma, the active ingredients of which include one of the following: (i) PPARG protein; (ii) the coding sequence of the PPARG protein; (iii) an expression vector that overexpresses PPARG and contains a coding sequence of the PPARG protein; The expression vectors include viral vectors and non-viral vectors; the viral vectors include but are not limited to adenovirus, lentivirus, retrovirus, and adeno-associated virus; the non-viral vectors include but are not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials including but not limited to collagen, hyaluronic acid, chitosan or alginate.

5. The drug according to claim 4, characterized in that Pharmaceutically acceptable carriers and / or excipients are also included.

6. The drug according to claim 4, characterized in that The dosage form of the drug includes oral preparations such as tablets, powders, granules, capsules, pills, sustained-release pellets, solid dispersions, inclusion compounds, liquid preparations such as suspensions, emulsions, melts, syrups, mixtures, solutions, injectable preparations such as injections, aqueous or oily suspensions, emulsions, liposomes, microcapsules, microspheres, nanoparticles, sustained-release or controlled-release preparations, preferably injectables.

7. Use of a PPARG-stimulating agent in the preparation of a drug for promoting the differentiation of cancerous tissue cells into muscle cells, or inhibiting the migration, invasion or tumorigenicity of cancerous tissue cells.

8. The use according to claim 7, characterized in that The agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein; The agents that promote PPARG include vectors that overexpress PPARG and contain the PPARG gene, such as viral vectors including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, non-viral vectors including but not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials such as collagen, hyaluronic acid, chitosan or alginate.

9. A drug that promotes the differentiation of cancerous tissue cells into muscle cells, or inhibits the migration, invasion or tumorigenicity of cancerous tissue cells, characterized in that: The medicaments include agents that promote PPARG.

10. The drug according to claim 9, characterized in that The agent promoting PPARG promotes the transcription of the PPARG gene, promotes the expression of the PPARG gene, promotes the function of the PPARG protein, and / or inhibits the degradation of the PPARG protein; The agents that promote PPARG include vectors that overexpress PPARG and contain the PPARG gene, such as viral vectors including but not limited to adenovirus, lentivirus, retrovirus, adeno-associated virus, non-viral vectors including but not limited to cationic polymer vectors, nanoparticle vectors, liposomes or liposome complexes, ligand-mediated targeting vectors, and natural polymer materials such as collagen, hyaluronic acid, chitosan or alginate.

Images