Gene for regulating and controlling protein content of lentinus edodes and application of gene

Abstract

The invention belongs to the technical field of fungal gene engineering, and discloses an application of a LePC4 gene in regulating and controlling the protein content of lentinus edodes. A LePC4 gene overexpression and interference vector is constructed, the function of the gene is researched through an agrobacterium tumefaciens-mediated genetic transformation method, and the result shows that the LePC4 gene negatively regulates and controls the protein content of lentinus edodes hyphae and interferes the gene expression, and the protein content of the lentinus edodes hyphae can be remarkably increased.

Description

Technical Field

[0001] The invention belongs to the technical field of fungal genetic engineering, and particularly relates to a LePC4 gene for regulating the protein content of shiitake mushrooms and an application thereof. Background Art

[0002] Lentinula edodes is the world's most produced edible fungus and is widely cultivated in China, Japan, South Korea, and other Southeast Asian countries (Dong Haoran et al. Research Progress on the Structure and Function of Lentinan Polysaccharides. Biotechnology Advances. 2024.14:911-919). Lentinula edodes is a pillar of my country's edible fungus industry, possessing significant edible, medicinal, and economic value (Gu Li et al. Current Status of Edible Fungus Breeding in my country. Vegetables. 2025:1-18). Its fleshy texture is rich in protein, carbohydrates, amino acids, and vitamins, while being low in fat and cholesterol-free. It is a renowned edible and medicinal fungus, earning it the reputation of being the "King of Wild Delicacies" (Liu Xiao et al. Nutritional Value, Current Status, and Prospects of Comprehensive Utilization of Lentinula edodes. Food Industry. 2017,38:207-210; Yang Jie et al. Research Progress on the Nutritional Value of Lentinula edodes and the Quality and Safety of Deep-Processed Foods. Agricultural Products Processing. 2024,98-103). Besides fresh and dried mushrooms, shiitake mushrooms can also be processed and sold in various forms, including canned foods, condiments, and pre-prepared dishes (Chen Zhang'e. Application Value and Prospects of Shiitake Mushrooms. Modern Food. 2023, 29: 26-28). The residue left after harvesting shiitake mushrooms is rich in nutrients such as cellulose, hemicellulose, organic acids, and protein, and can be reused in edible fungus production, fermented as organic fertilizer, and processed into livestock feed (Yang Yao et al. Analysis of the Current Status and Prospects of Edible Fungus Residue Utilization. Agricultural Science and Technology and Information. 2024: 139-142, 148). In addition, shiitake mushrooms are rich in a variety of bioactive substances, which can be developed and utilized in the food industry, cosmetics, medicine and other fields, thereby increasing the added value of their products (Guo et al. Research progress on extraction technology and biological activity of polysaccharides from Edible Fungi: a review. Food Reviews International. 2023, 39: 4909-4940; Navarro-Simarro et al. Food and human health applications of edible mushroom by-products. New Biotechnology. 2024, 81: 43-56).

[0003] Important agronomic traits of shiitake mushrooms, such as yield, number of mushrooms (number of fruiting bodies), single mushroom weight, and mycelial growth rate, directly affect the commercial quality and economic benefits of edible fungi and are the core content of genetic breeding research (Zhang Yan et al. Research Progress on Molecular Breeding of Edible Fungi. Mycological Research. 2019.17(04):229-239). Among them, most important agronomic traits are quantitative traits (Xiao Yang et al. Association analysis and its application in fungal genetics research. Mycological Journal. 2016.35:782-790). The genetic improvement of these quantitative traits is of great significance to improving industrial benefits. Quantitative traits are regulated by multiple genes, have a complex genetic basis, and are easily affected by environmental factors. There is no clear correspondence between phenotype and genotype, making it difficult to carry out genetic improvement (Santoyo et al.Quantitative linkage mapping of lignin degrading enzymatic activities in Pleurotus ostreatus. Enzyme and Microbial Technology. 2008.43(2):137-143.). Since the 1980s, with advances in molecular biology and quantitative genetics, researchers have begun using molecular markers, genetic linkage maps, and species populations to identify regulatory genes for important traits and develop efficient molecular breeding tools through methods such as quantitative trait loci (QTL) linkage analysis and association analysis. The application of these technologies has provided new research ideas and technical means for revealing the genetic basis of quantitative traits and promoting the genetic improvement of shiitake mushrooms.

[0004] The protein content of shiitake mushrooms is a complex quantitative trait, usually referring to the crude protein content of shiitake mycelium or fruiting body. Shiitake mushrooms are high in protein, with the protein content of their dry products reaching 30.81g / 100g (Yang Jie et al. Research progress on the nutritional value of shiitake mushrooms and the quality and safety of deep-processed foods. Agricultural Products Processing. 2024. (20): 98-103). The functional proteins contained in them, such as lectins and ergothioneine, have multiple physiological activities (Sofia et al. The health-promoting potential of edible mushroom proteins. Current Pharmaceutical Design. 2022. 29: 804-823). Currently, protein extraction mainly uses alkaline extraction and acid precipitation methods and their improved processes. Different methods significantly affect the protein yield and functional properties (Dong Juan. Research on the fractional extraction of shiitake mushroom stem components and their application in vegetarian sausages [Master's thesis]. Tianjin: Tianjin University of Science and Technology Library. 2023; Hu Danhui. Extraction, properties and development of new nutritious bread from shiitake mushroom stem proteins [Master's thesis]. Shenyang: Liaoning University Library. 2019). Studies have shown that the carbon-nitrogen ratio of the culture medium and exogenous additives (such as mulberry branch chips and L-amino acids) can regulate the protein content and related enzyme activities of shiitake mushrooms (Lei Ye et al. Comparison of nutritional components of shiitake mushrooms cultivated with mulberry branch chip substrates at different ratios. Chinese Journal of Food and Nutrition. 2023.1-8; Chang Tingting et al. Research progress on the response of edible and medicinal fungi to high temperature stress. Journal of Edible Fungi. 2021.28:124-134). Although my country is rich in edible fungus protein resources, their in-depth development and utilization are still in their early stages. In the future, the integration of multidisciplinary technologies is expected to expand their application in fields such as food and medicine (Liu et al. The prospect of mushroom as an alterative protein: From acquisition routes to nutritional quality, biological activity, application and beyond. Food Chemistry. 2025.469:142600; Xu Min et al. Research progress on edible fungus protein. Edible and Medicinal Fungi. 2025.33:17-27).

[0005] There are many reports on the genetic basis of protein content in major crops. In species such as soybean (Wang et al. Primary metabolite contents are correlated with seed protein and oil traits in near-isogenic lines of soybean. The Crop Journal. 2019. 7: 651-659), wheat (Thorwarth et al. Dissecting the genetics underlying the relationship between protein content and grain yield in a large hybrid wheat population. Theoretical and Applied Genetics. 2019. 132: 489-500), rapeseed (Chao et al. Genetic dissection of seed oil and protein content and identification of networks associated with oil content in Brassica napus. Scientific Reports. 2017. 7: 46295) and maize (Deng Min. Genome-wide association analysis and linkage analysis of amino acid residues in maize grains and comparative analysis of the metabolomes of maize and rice [PhD dissertation]. Wuhan: Huazhong Agricultural University Library. 2017), natural populations, recombinant inbred lines, and near-isogenic inbred lines were used to conduct linkage analysis and genome-wide association analysis. Using GWAS (Gene Genomics and Genomics Surveys) to map quantitative trait loci (QTLs) has uncovered loci and candidate genes associated with protein content, providing important insights into the genetic basis of protein content at the molecular level. However, research on the genetic basis of protein content in edible fungi has yet to be reported.

[0006] Overall, the genetic basis of important quantitative traits in Lentinus edodes has mainly focused on the discovery of QTL candidate genes, while gene function verification has rarely been reported. Currently, there are no reports on genes related to protein content in Lentinus edodes.

[0007] The present invention locates the LePC4 gene as a gene related to regulating the protein content of Lentinus edodes through genome-wide association analysis. Functional studies show that the LePC4 gene negatively regulates the protein content of Lentinus edodes mycelium. Interfering with the expression of this gene can increase the protein content of Lentinus edodes mycelium. Summary of the Invention

[0008] The present invention provides a gene cloned from Lentinus edodes (Lewpm1006156), which regulates protein content. This gene, named LePC4, is located on chromosome 4 of the Lentinus edodes monokaryon Wpm-1 reference genome. Functional domain prediction results suggest it may be involved in apoptosis. The LePC4 gene is 1292 base pairs long, as shown in SEQ ID NO. 1. The open reading frame is 684 base pairs long, as shown in SEQ ID NO. 2. The encoded amino acid sequence is shown in SEQ ID NO. 3.

[0009] A second object of the present invention is to provide the use of the gene LePC4 in regulating the protein content of Lentinus edodes. Overexpression and RNA interference expression vectors for this gene were constructed, and the function of the gene was studied through Agrobacterium-mediated genetic transformation using the high-protein strain YS19 and the low-protein strains WX-1 and ZP17 as recipients. The results showed that compared with the control empty-load strain, RNA interference in the WX-1 Lentinus edodes strain significantly increased its mycelial protein content by 13.06%-17.11% (p < 0.05); RNA interference in the ZP17 Lentinus edodes strain significantly increased its mycelial protein content by 14.09%-27.27% (p < 0.05). The overexpressed YS19 Lentinus edodes strain significantly decreased its mycelial protein content by 6.91%-18.67% (p < 0.05). Therefore, interfering with LePC4 gene expression can significantly increase the protein content of Lentinus edodes mycelium, while overexpression reduces the protein content of Lentinus edodes mycelium.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] 1. Gene cloning

[0012] Using the genome of the Lentinus edodes monokaryon Wpm-1 as a reference, we designed primers: LePC4-DNA-F: 5'-CGGAACTGTGCACCATAAAAAC-3' and LePC4-DNA-R: 5'-GCTCGAAGCATTGAAGGCG-3'. CDS primers: LePC4-cDNA-F: 5'-ATGCTGTTTCTTCCACTCCTACACT-3' and LePC4-cDNA-R: 5'-TCACGCCTTGGTTATGCTTGC-3'. The full-length LePC4 gene sequence (SEQ ID NO. 1) and CDS sequence (SEQ ID NO. 2) were amplified using DNA and cDNA from the Lentinus edodes strain Wuxiang No. 1 (WX-1), respectively.

[0013] 2. Construction of gene overexpression (OE) and interference (RNAi) vectors

[0014] OE vector construction: Based on the nucleotide sequences at both ends of the restriction site, the recombination primers LePC4-OE-F: attgactgcttgaatggtaccATGCTGTTTCTTCCACTCCTACACT and LePC4-OE-R: gggaaattcgagctcgaattcTCACGCCTTGGTTATGCTTGC were designed to amplify the overexpression fragment (SEQ ID NO. 4), and the recombination primers LePC4-RNAi-F: ctcgcagctcttcacgaattcTCAATTGGTGAAGGGGCATATC and LePC4-RNAi-R: attgactgcttgaatggtaccATGTATGTTCCAACTATGCCAGTCG were designed to amplify the interference fragment (SEQ ID NO. 5). The linearized fragment pCAMBIA1300-g, the Legpd promoter fragment and the LePC4 gene overexpression fragment were homologously recombined by a one-step cloning method. The pCAMBIA1300-g, the Leactin promoter fragment, the Legpd promoter fragment and the LePC4 gene interference fragment were homologously recombined by a one-step cloning method and transformed into Escherichia coli competent cells Trans-T1. The positive clones were sequenced and tested with primers LePC4-OE-F and LePC4-OE-R and LePC4-RNAi-F and LePC4-RNAi-R, and then sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. After sequencing and comparison, the vector plasmids of the positive clones were extracted, namely the recombinant overexpression vector LePC4-OE and the interference vector LePC4-RNAi ( Figure 3 BC).

[0015] 3. Genetic transformation and phenotypic analysis of Lentinus edodes

[0016] Agrobacterium-mediated genetic transformation was used to transform the overexpression receptor strain YS19 and the interference receptor strains WX-1 and ZP17. After three screenings, stable OE and RNAi positive transformants were obtained ( Figure 4 The control empty vector, OE, and RNAi transformants were inoculated into MYG liquid medium and cultured at 25°C and 120 rpm for 16 days. Mycelia were collected and rinsed with ddH2O to remove the culture medium. The mycelia were freeze-dried and the protein content was determined according to the method in GB5009.5-2016 "National Food Safety Standard - Determination of Protein in Food".

[0017] Experiments have confirmed that compared with the control empty strain, the mycelial protein content of the YS19 strain with LePC4 gene overexpression was significantly reduced by 6.91%-18.67% (p<0.05), while the mycelial protein content of the WX-1 and ZP17 strains after LePC4 gene interference was significantly increased by 13.06%-17.11% and 14.09%-27.27%, respectively (p<0.05).

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0019] This study is the first to publicly disclose the role of the LePC4 gene in regulating protein content in Lentinus edodes. A genome-wide association analysis based on cap protein content phenotypic data from 133 Lentinus edodes strains identified LePC4 as a key candidate gene for regulating protein content in Lentinus edodes. Experimental results from the present study demonstrated that overexpressing this gene reduced protein content in Lentinus edodes mycelium, while interfering with its expression increased it, demonstrating that LePC4 negatively regulates protein content in Lentinus edodes mycelium. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Results of a genome-wide association analysis for protein content. Significant association sites detected by the association analysis are above the purple horizontal line, and genes within ±2 kb of these sites are candidate genes associated with the trait. LePC4 (Lewpm1006156) is located within ±2 kb of the black boxed association sites.

[0021] Figure 2 LePC4 gene structure (A), LePC4 protein transmembrane domain (B) and signal peptide prediction results (C).

[0022] Figure 3 Maps of the vector plasmid pCAMBIA1300-g (A), the recombinant overexpression vector LePC4-OE (B), and the recombinant interference vector LePC4-RNAi (C).

[0023] Figure 4 qRT-PCR analysis of LePC4 gene expression in LePC4-OE / RNAi transformants. A: RNAi strain WX-1, WX-1-CK serves as an empty vector control, and R-1, R-2, R-4, and R-14 serve as four RNAi transformants. B: RNAi strain ZP17, ZP17-CK serves as an empty vector control, and R-1, R-6, R-10, and R-11 serve as four RNAi transformants. C: Overexpression strain YS19, YS19-CK serves as an empty vector control, and O-16, O-31, O-32, and O-34 serve as four overexpression transformants. * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001.

[0024] Figure 5 Mycelial protein content of transformants. A: Mycelial protein content of RNAi strain WX-1. CK-WX-1 is the empty vector control, and R-1, R-2, R-4, and R-14 are the four RNAi transformants. B: Mycelial protein content of RNAi strain ZP17. CK-ZP17 is the empty vector control, and R-1, R-6, R-10, and R-11 are the four RNAi transformants. C: Mycelial protein content of overexpression strain YS19. CK-YS19 is the empty vector control, and O-16, O-31, O-32, and O-34 are the four overexpression transformants. * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001. DETAILED DESCRIPTION

[0025] Unless otherwise specified, the methods used in the following examples are conventional biological experimental methods. The primers used were synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd., and the sequencing was completed by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. The pEASY-Basic Seamless Cloning and Assembly Kit was purchased from TransGen, restriction enzymes were purchased from New England Biolabs, hygromycin B was purchased from Roche, Switzerland, and kanamycin (Kan +), rifampicin (Rif), cefotaxime (Cef), and acetosyringone (AS) were purchased from Qingjiang Biotechnology Co., Ltd., the San Prep column DNA recovery kit was purchased from Shanghai Huiling Biotechnology Co., Ltd., and RNAiso Plus was purchased from Bao Bioengineering (Dalian) Co., Ltd. The genome data of the Lentinus edodes monokaryon Wpm-1 used in the experiment was sequenced by the inventors' research group. Lentinus edodes strains WX-1, ZP17, YS19, and Wpm-1, the competent Escherichia coli Trans-T1, the competent Agrobacterium EHA105, and the vector plasmid pCAMBIA1300-g (the original 35S promoter of the pCAMBIA1300 vector was replaced with the Lentinus edodes Legpd promoter to drive expression of the hygromycin phosphotransferase gene hph) were all maintained in the inventors' laboratory.

[0026] Example 1 Cloning of LePC4 gene

[0027] The protein content of the fruiting body cap of 133 Lentinus edodes strains was systematically determined. Further genome-wide association analysis revealed that the LePC4 gene is an important candidate gene regulating the protein content of Lentinus edodes ( Figure 1 ).

[0028] Based on the genome data of the Lentinus edodes monokaryon Wpm-1, primers LePC4-DNA-F: 5'-CGGAACTGTGCACCATAAAAAC-3' and LePC4-DNA-R: 5'-GCTCGAAGCATTGAAGGCG-3' were designed. The DNA sequence of the LePC 4 gene was amplified and sequenced using the DNA of the Lentinus edodes cultivated strain WX-1 as a template. Primers LePC4-cDNA-F: 5'-ATGCTGTTTCTTCCACTCCTACACT-3' and LePC4-cDNA-R: 5'-TCACGCCTTGGTTATGCTTGC-3' were designed. The CDS sequence of the LePC 4 gene was amplified and sequenced using the cDNA of the WX-1 strain as a template. PCR amplification system: 25 μL of 2× Phanta Max Buffer, 2 μL of each primer (10 μmol / L), 1 μL of dNTP Mix (10 mmol / L), 1 μL of Phanta Max Super-Fidelity DNA Polymerase (1 U / μL), 200 ng of template, and ddH2O to 50 μL. Reaction parameters: initial denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C (1 min 30 s for DNA sequences and 45 s for CDS sequences) for 34 cycles; complete extension at 72°C for 10 min.

[0029] Sequence analysis results showed that the full length of LePC4 gene was 1292 bp, including 5 exons and 4 introns ( Figure 2 A), the open reading frame is 684 bp in length. The LePC4 gene sequence is shown in SEQ ID NO.1, the open reading frame sequence is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.3. Analysis of the physicochemical properties of the gene-encoded protein showed that it contains 227 amino acids with a molecular formula of C 1161 H 1804 N 304 O 317 S5, molecular weight is 25.3KDa, theoretical isoelectric point is 8.79, instability coefficient is 43.36, average hydrophilicity coefficient is -0.077, fat coefficient is 91.78, LePC4 protein is a relatively unstable hydrophilic protein. LePC4 protein has no transmembrane region and is distributed outside the membrane (outside) ( Figure 2 B). The signal peptide prediction results showed that the probability of LePC4 protein being a secretory protein was 0.9008 ( Figure 2 C).

[0030] Example 2: LePC4 overexpression (OE) and interference (RNAi) vector construction

[0031] Overexpression vector construction: EcoRI and KpnⅠ were used to construct plasmid pCAMBIA1300-g ( Figure 3A) Double enzyme digestion was performed, and the product was detected and recovered by 1% agarose gel electrophoresis. Based on the nucleotide sequences at both ends of the restriction enzyme cleavage sites, recombinant primers LePC4-OE-F: attgactgcttgaatggtaccATGCTGTTTCTTCCACTCCTACACT and LePC4-OE-R: gggaaattcgagctcgaattcTCACGCCTTGGTTATGCTTGC were designed to amplify the overexpressed LePC4 gene fragment. Primers Legpd-F: 5'-tgccactggcTGAAAAGACATGGATTGAGCCA-3' and Legpd-R: 5'-tctagaggatccccgggTACCGTACATCCCTTGCTCTGC-3' were designed to amplify the Lentinus edodes Legpd promoter fragment. PCR amplification products were purified and recovered. The linearized pCAMBIA1300-g fragment, the Legpd promoter fragment, and the LePC4 gene fragment were homologously recombined using a one-step cloning method (160 ng of the linearized pCAMBIA1300-g fragment, 20 ng of the Legpd promoter, 30 ng of the LePC4 gene fragment, 5 μL of 2× Basic Assembly Mix, supplemented with ddH2O to 10 μL). After incubation at 50°C for 15 min, the fragment was transformed into competent E. coli Trans-T1 cells. Positive clones were sequenced using primers LePC4-OE-F: attgactgcttgaatggtaccATGCTGTTTCTTCCACTCCTACACT and LePC4-OE-R: gggaaattcgagctcgaattcTCACGCCTTGGTTATGCTTGC). The clones were then sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. Sequencing results showed that the positive cloned gene fragments had 100% similarity to the reference sequence. The vector plasmid of the positive clone was extracted, which was the recombinant overexpression vector LePC4-OE ( Figure 3 B).

[0032] RNAi vector construction: Plasmid pCAMBIA1300-g was double-digested with EcoRI and KpnI, and the fragments were recovered by 1% agarose gel electrophoresis. Recombinant primers LePC4-RNAi-F (ctcgcagctcttcacgaattcTCAATTGGTGAAGGGGCATATC) and LePC4-RNAi-R (attgactgcttgaatggtaccATGTATGTTCCAACTATGCCAGTCG) were designed based on the nucleotide sequences flanking the restriction sites to amplify a 411-bp LePC4 gene interference fragment. Recombinant primers LeActin-F (5'-ccacctcaaacttcggaattcGCAGTATTTATACCTACGGAGCG-3'G) and LeActin-R (5'-tcttccgagCGTGAAGAGCTGCGAGTGTTG-3') were designed to amplify the Lentinus edodes Leactin promoter fragment. The PCR amplification product was purified and recovered. The linearized fragment pCAMBIA1300-g, the Legpd promoter fragment, the Leactin promoter fragment, and the LePC4 gene interference fragment were homologously recombined using a one-step cloning method (100 ng of the linearized fragment pCAMBIA1300-g, 50 ng of the Leactin promoter, 40 ng of the Legpd promoter, 20 ng of the LePC4 antisense fragment, 5 μL of 2× Basic Assembly Mix, supplemented with ddH2O to 10 μL). After reaction at 50°C for 15 min, the cells were transformed into competent Escherichia coli Trans-T1 cells. Positive clones were sequenced using primers LePC4-RNAi-F: ctcgcagctcttcacgaattcTCAATTGGTGAAGGGGCATATC and LePC4-RNAi-R: attgactgcttgaatggtaccATGTATGTTCCAACTATGCCAGTCG) and sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. Sequencing results showed that the positive cloned gene fragment had 100% similarity with the reference sequence. The vector plasmid of the positive clone was extracted, which was the recombinant interference vector LePC4-RNAi ( Figure 3 C).

[0033] Example 3: Screening of transformants by Agrobacterium-mediated genetic transformation

[0034] The recombinant vectors LePC4-OE, LePC4-RNAi, and pCAMBIA1300-g(CK) constructed above were transformed into Agrobacterium competent cells EHA105 using the freeze-thaw method. The steps are as follows:

[0035] 1) Take the EHA105 competent cells out of the -80°C freezer and place them on ice when they are thawed and in an ice-water mixture.

[0036] 2) Add approximately 1 μg of the constructed vector plasmid to 100 μL of competent cells and mix gently;

[0037] 3) Place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min;

[0038] 4) Add 800 μL of LB liquid medium without antibiotics and culture at 28°C, 200 rpm for 2 h;

[0039] 5) Centrifuge at 6000 rpm for 1 minute, take about 100 μL of supernatant, gently blow to resuspend the bacteria and apply to a plate containing 50 μg / mL kanamycin (Kanamycin). + ) and 20 μg / mL rifampicin (Rif) on LB plates at 28°C for 60 h;

[0040] 6) OE-positive clones were detected using primers LePC4-cDNA-F: ATGCTGTTTCTTCCACTCCTACACT and hyg-R: CGGTGAGTTCAGGCTTTTTCAT; RNAi-positive clones were detected using primers LePC4-yan-F: GTTATCTGCATCCCCAAGCT and LePC4-yan-R: TGCTTGAATGgtaccATGTATGTTC; CK-positive clones were detected using primers HYG: TCTATTTCTTTGCCCTCGGACG and gpd R11: CTTGCCTCTAATCCCTTGCTC;

[0041] 7) The single clone that is positive by PCR is shaken to OD 600 =1.8-2.0 (detected by UV spectrophotometer), and preserved with an equal volume of 50% glycerol in a -80°C ultra-low temperature freezer for subsequent research.

[0042] The Lentinus edodes strains YS19, WX-1 and ZP17 were used as recipients for Agrobacterium-mediated genetic transformation. The method was as follows: Agrobacterium EHA105 containing the linear vector plasmid pCAMBIA1300-g (CK) and the recombinant vectors LePC4-OE and LePC4-RNAi were respectively plated on LB resistance plates (50 μg / mL Kan + , 20μg / mL Rif) were streaked and cultured for 2 days, and a single colony was picked and placed in 1mL liquid LB (50μg / mL Kan +, 20μg / mL Rif) for 48h at 28℃ and 200r / min. Then the cultured Agrobacterium solution was added to 100mL basic medium MM (50μg / mL Kan + ) in 28 ° C, 200 r / min after 24h, 4 ° C, 5000 r / min centrifugation for 10min, discard the supernatant, collect the bacterial liquid. Use appropriate amount of induction medium IM to resuspend the bacteria so that the initial OD 600 The OD value was about 0.4, and acetosyringone (AS) was added to a final concentration of 200 μmol / L. The culture was shaken at 28°C and 200 r / min for 3-5 h to make the OD 600 The mycelia of Lentinus edodes strains YS19, WX-1 and ZP17 were activated on MYG medium for 7 days and then cut into small cubes with a scalpel and the OD value was calculated. 600 Submerge the plate in a 0.8% Agrobacterium suspension for 20 minutes, shaking every 5 minutes. After discarding excess suspension, the mycelial clumps were inoculated into co-cultivation medium (200 μmol / L AS) and incubated at 25°C for 2 days. After 2 days of co-cultivation, the mycelial clumps were transferred to MYG medium plates containing hygromycin (WX-1: 4 μg / mL, YS19 and ZP17: 5 μg / mL) and ceftriaxone sodium (300 μg / mL). The plates were incubated at 25°C for approximately 15 days for the first screening. Mycelia that germinated after the first screening were punched with a sterile pipette tip and transferred to MYG medium containing hygromycin (WX-1: 4 μg / mL, YS19 and ZP17: 5 μg / mL). The plates were incubated at 25°C for 7-10 days for the second screening. Strains that remained viable after three screenings were considered presumptive positive transformants and continued in the next experiment.

[0043] Minimal Media (MM): K-buffer 10 mL, MN buffer 20 mL, 20% glucose (w / v) 10 mL, 0.01% FeSO4 (w / v) 10 mL, 20% (NH4)2SO4 (w / v) 2.5 mL, 1% CaCl2·2H2O (w / v) 1 mL, ddH2O 1 L, adjust the pH to 6.7-7.0 with H3PO4 or NaOH.

[0044] Induction Media (IM): K-buffer 10 mL, MN buffer 20 mL, 20% glucose (w / v) 5 mL, 0.01% FeSO4 (w / v) 10 mL, 20% (NH4)2SO4 (w / v) 2.5 mL, 1% CaCl2·2H2O (w / v) 1 mL, 50% glycerol (w / v) 10 mL, 7.808 g MES (40 mmol / L, MW 195.2), ddH2O 1 L, adjust the pH to 5.6 with H3PO4 or NaOH.

[0045] Co-induction media (Co-IM): K-buffer 10 mL, MN buffer 20 mL, 20% glucose (w / v) 2.5 mL, 0.01% FeSO4 (w / v) 10 mL, 20% (NH4)2SO4 (w / v) 2.5 mL, 1% CaCl2·2H2O (w / v) 1 mL, 50% glycerol (w / v) 10 mL, 7.808 g MES (40 mmol / L, MW 195.2), agar 20 g, ddH2O 1 L, adjust the pH to 5.6 with H3PO4 or NaOH.

[0046] Example 4 Identification of positive transformants by PCR and real-time fluorescence quantitative PCR

[0047] Strains that remained viable after three rounds of screening were considered presumptive positive transformants. Mycelia were collected after 10 days of culture on cellophane-covered MYG medium at 25°C. Total DNA was extracted using the CTAB method and verified by PCR amplification. OE-positive transformants were verified using primers LePC4-cDNA-F: ATGCTGTTTCTTCCACTCCTACACT and hyg-R: CGGTGAGTTCAGGCTTTTTCAT; RNAi-positive transformants were verified using primers LePC-yan-F: GTTATCTGCATCCCCAAGCT and LePC4-yan-R: TGCTTGAATGgtaccATGTATGTTC; and CK-positive transformants were verified using primers HYG: TCTATTTCTTTGCCCTCGGACG and gpd R11: CTTGCCTCTAATCCCTTGCTC. The recombinant overexpression vector LePC4-OE, the interference vector LePC4-RNAi, and the CK vector were used as positive controls, respectively. ddH2O was used as a blank control. Reaction parameters: 95°C pre-denaturation for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 2 minutes 30 seconds for LePC4-OE, 1 minute 20 seconds for LePC4-RNAi, and 1 minute 50 seconds for CK transformants, for 30 cycles, and extension at 72°C for 10 minutes. Transformants that amplified target fragments of 2340 bp, 1288 bp, and 1749 bp were identified as positive overexpression, interference, and CK transformants, respectively.

[0048] Positive transformants were screened and cultured on MYG medium covered with cellophane at 25°C for 10 days. Mycelia were then harvested and total RNA was extracted using the RNAiso Plus kit (TaKaRa). Reverse transcription was performed using the HiScript II One Step RT-PCR Kit (Vazyme). Real-time quantitative PCR (qRT-PCR) was performed using the AceQ™ qPCR SYBR Green Master Mix (Takara) kit in the CFXConnect Real-Time PCR System (BIO-RAD). The reverse-transcribed cDNA was diluted 10-fold and used as a template.

[0049] The quantitative primers were LePC4-QF: 5'-GGCATTTCGTCCTCCAAGAC-3', LePC4-QR: 5'-TCACGCCTTGGTTATGCTTG-3'. The internal reference gene was Leactin, and the internal reference primers were LeActin-F: 5'-GTTGTCTCCTGCCTCTATGAAG-3', LeActin-R: 5'-AAGTACTGAGGGAAGCAAGAATAG-3'. The controls were YS19, WX-1, and ZP17 strains transformed with empty vectors. The relative expression of genes was calculated using 2 -ΔΔCT (Luo et al. Selection and validation of references for qRT-PCR in Lentinula edodes under different experiment conditions. 2019, Genes, 10(9), 647.).

[0050] Reaction system: AceQTM qPCR SYBR Green Master Mix 5 μL, primers 0.5 μL each, cDNA 3 μL, ddH2O 1 μL.

[0051] Reaction program: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 30 s; cycle number 35; 60°C; melting curve temperature set at 60-95°C, data read every 0.5°C.

[0052] According to the quantitative results, the interference strain WX-1 transformants were finally selected: 1 CK transformant (WX-1-CK), 4 RNAi transformants (R-1, R-2, R-4, R-14)) Figure 4 A) and the interference strain ZP17 transformants: 1 CK transformant (ZP17-CK), 4 RNAi transformants (R-1, R-6, R-10, R-11) ( Figure 4 B), overexpression strain YS19 transformants: 1 CK transformant (YS19-CK), 4 OE transformants (O-16, O-31, O-32, O-34) ( Figure 4 C) Conduct subsequent phenotypic experiments.

[0053] Example 5 Determination of protein content in hyphae of LePC4-OE / RNAi transformants

[0054] The overexpression and interference transformants were inoculated into MYG liquid culture medium and cultured at 25°C and 120r / min for 16 days. The mycelia were collected and rinsed with sterile water to remove excess culture medium. The mycelia were freeze-dried and sent to Qingdao Stand Standard Testing Co., Ltd. According to the method of GB5009.5-2016 "Determination of Protein in Food, National Food Safety Standard", the protein content of the mycelia was tested. The results showed that compared with the control CK-WX-1, the protein content of the four interference transformants of the WX-1 strain increased significantly by 13.06%-17.11% (p < 0.05) ( Figure 5 A). Compared with the control CK-ZP17, the protein content of the R-1 and R-10 transformants of the ZP17 strain increased significantly by 14.09% and 27.27%, respectively (p<0.05) ( Figure 5 B). Compared with the control CK-YS19, the protein content of the four overexpression transformants of the YS19 strain was significantly reduced by 6.91%-18.67% (p<0.05) ( Figure 5 C). The above results indicate that the LePC4 gene is involved in regulating the protein content of Lentinus edodes mycelium and exhibits a negative regulatory effect.

Claims

1. Shiitake mushrooms LePC4 A gene characterized by The CDS sequence of the gene is shown in SEQ ID NO.

2.

2. The shiitake mushroom according to claim 1 LePC4 The protein encoded by the gene is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

3.

3. Containing the mushroom according to claim 1 LePC4 Genetic biomaterial, characterized in that The biological materials include expression cassettes, expression vectors, and recombinant bacteria.

4. The shiitake mushroom according to claim 1 LePC4 The gene, or the shiitake mushroom according to claim 2 LePC4 The protein encoded by the gene, or the protein described in claim 3 LePC4 Application of genetic biomaterials in regulating protein content in Lentinus edodes mycelium.

5. The use according to claim 4, characterized in that described LePC4 The gene negatively regulates the protein content of Lentinus edodes mycelium.

6. A method for increasing the protein content of shiitake mushroom mycelium, characterized in that: Interference in claim 1 LePC4 Gene expression.

7. The method according to claim 6, characterized in that Build LePC4 The invention discloses an RNA interference vector for a gene, wherein the RNA interference vector contains the fragment shown in SEQ ID NO.5, and the RNA interference vector is transferred into shiitake mushrooms through an Agrobacterium-mediated genetic transformation method.

Images