Lentinula edodes ABC transporter gene LeABC2 and its application in regulating heat tolerance of lentinula edodes

Abstract

This invention belongs to the field of fungal genetic engineering technology and discloses the ABC transporter gene of shiitake mushroom. LeABC2 And its application in regulating the heat tolerance of shiitake mushrooms. Genome-wide association analysis was performed based on the heat tolerance phenotypic data of 133 shiitake mushroom strains to identify candidate genes regulating heat tolerance. LeABC2 , build LeABC2 The gene function was studied using an RNA interference vector via Agrobacterium-mediated genetic transformation. The results showed... LeABC2 The gene negatively regulates the heat resistance of shiitake mushroom mycelium, and interfering with the expression of this gene can improve the heat resistance of mycelium, providing a new solution to the problem of high temperature affecting yield and quality in the shiitake mushroom industry.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of fungal genetic engineering, and particularly relates to a Lentinula edodes ABC transporter gene LeABC2 and application thereof in regulating heat tolerance of Lentinula edodes. BACKGROUND

[0002] Lentinula edodes is one of the main cultivated edible fungi in China, and has high edible value, nutritional value and economic value. Temperature is one of the important conditions for biological growth and development. When the temperature rises above the threshold level for a period of time, it will cause irreversible damage to the growth and development of organisms, which is called high temperature stress. When the temperature rises sharply by 10-15℃ higher than the outside, it can cause various biological activities including edible fungi to oxidize biological membranes, produce a variety of unsaturated aldehyde ketone products with harmful effects, cause protein denaturation, destroy cell membrane stability, and cause a series of physiological disorders.

[0003] Edible fungi can be divided into low temperature type, medium temperature type and high temperature type according to their mycelial stage adaptability (Bian Y. P. Edible Fungus Cultivation (3rd Edition). Beijing: Higher Education Press. 2017, 138-140). The optimal temperature for growth of different types of edible fungi is significantly different. In addition, some temperature-resistant edible fungi need a certain temperature difference during growth and development to stimulate the development of fruiting bodies. Suitable temperature plays an important role in the growth and development process of edible fungi. Agaricus bisporus is sensitive to high temperature during cultivation. When the temperature exceeds 32℃, the growth of mycelium is limited, resulting in poor quality of fruiting bodies, long and thin stems, and easy opening of the umbrella (Chen R. et al. Identification of two thermotolerance-related genes in Agaricus bisporus. Food Technology and Biotechnology, 2003, 41(4): 339-344.). Pleurotus ostreatus can accelerate the development of fruiting bodies at high temperature, but the mycelium is prone to breakage, the cap is thin, the weight is reduced, and the yield is decreased (Jue Chao. Effects of High Temperature Stress on Physiological and Biochemical Characteristics of Pleurotus ostreatus [Master's Thesis]. Henan Agricultural University. 2011; Yan Ziyu. Core carbon metabolic response of Pleurotus ostreatus under high temperature stress [PhD Thesis]. Chinese Academy of Agricultural Sciences. 2020.). After the temperature exceeds 19.4℃ during the fruiting period of Agaricus bitorquis, the number of fruiting bodies per unit area decreases rapidly, and there are significant differences in the cap diameter and cap thickness of fruiting bodies (Bao Ru. Key Techniques for High-yield Cultivation of Agaricus bitorquis [Master's Thesis]. Northwest A&F University. 2015.).

[0004] Lentinula edodes belongs to low-temperature and temperature-inversion fruiting fungi, and its growth and development process requires high temperature. The optimum temperature for spore germination is 22-26℃, the optimum temperature for mycelial growth is 24-27℃, the optimum temperature for primordium differentiation is 10-12℃, and the optimum temperature for fruiting body development is 8-20℃ (Zhang Baofen. Breeding of high-temperature tolerant strains of Lentinula edodes. [Master's thesis]. Nanjing Agricultural University, 2014). At 24-27℃, the growth rate of Lentinula edodes mycelium is the fastest, but due to high enzyme activity in mycelium and vigorous metabolism, the material is consumed quickly, and the mycelium is prone to aging. In actual production, 20-24℃ is usually used to cultivate healthy mycelium (Jiang Yu et al. Analysis of temperature requirements and control measures for Lentinula edodes growth. Henan Agriculture, 2018(26): 14-16).

[0005] High temperature environment has a significant impact on the growth and development of Lentinula edodes. Lentinula edodes mycelium has poor tolerance to high temperature, and high temperature above 34℃ often leads to inhibition of mycelial growth and development, and even leads to mycelial damage and death (Li Wenwu et al. Temperature requirements and control measures for Lentinula edodes growth. Edible Fungi, 2013, 35(02): 51-52.). During the fruiting body growth stage, temperature control directly affects the yield and quality of Lentinula edodes. High temperature can lead to a decrease in enzyme activity in the fruiting body, a decrease in nutrient transport capacity, and an increase in respiratory intensity, which exacerbates self-consumption (Jiang Yu et al. Analysis of temperature requirements and control measures for Lentinula edodes growth. Henan Agriculture, 2018(26): 14-16).

[0006] Through long-term evolution, fungi have developed self-protection mechanisms to resist high temperature. Reactive Oxygen Species (ROS) can act as a signaling substance in the resistance to heat stress (Zhang Xue. Heat stress induces Ca 2+and ROS regulation of Ganoderma lucidum HSP expression, mycelial growth and secondary metabolism [Master's thesis]. Nanjing Agricultural University, 2016.), high temperature stress can regulate the accumulation of ROS in mycelium, the increase of intracellular ROS will start the ROS removal system, activate the antioxidant defense system to relieve the oxidative damage caused by high temperature stress (Liu R. et al. Heat stress-induced reactive oxygen species participate in the regulation of HSP expression, hyphal branching and ganoderic acid biosynthesis in Ganoderma lucidum. Microbiological Research, 2018, 209:43-54; Chang Tingting et al. Research progress of high temperature stress response of edible and medicinal fungi. Journal of Edible Fungi, 2021, 28(1): 124-134.). Trehalose will continuously accumulate in edible fungi cells under high temperature, in Pleurotus ostreatus, trehalose can alleviate the accumulation of lactic acid, down-regulate the expression of pyruvate kinase (PK) and phosphofructokinase (PFK) genes, and improve the glycolysis process of Pleurotus ostreatus under heat stress (Xu Ruiping. Analysis of auxin signal transduction pathway and initial exploration of CRISPR-Cas9 gene editing system in Pleurotus ostreatus under heat stress [PhD thesis]. Central China Agricultural University, 2023.). Under the shock response, heat shock proteins (HSPs) can be rapidly and massively synthesized, acting as molecular chaperones. Heat shock proteins can be divided into six categories: small molecule sHSP family, HSP40 family, HSP60 family, HSP70 family, HSP90 family, and large molecule HSP family. These heat shock proteins can bind to intracellular denatured proteins, prevent intracellular proteins from irreversible denaturation, degrade misfolded proteins, help repair misfolded proteins, avoid protein denaturation, relieve heat shock stress, and improve cell stress resistance (Singh A. et al. Plant Hsp100 / ClpB-like proteins: poorly-analyzed cousins of yeast ClpB machine. Plant Molecular Biology, 2010, 74(4-5): 395-404.; Fu Qingxian et al. Research progress of the role of heat shock protein 60 in nervous system diseases. International Journal of Neurology and Neurosurgery, 2019, 46(3): 341-345.).Fungi can also control the rate of ROS production, affect its metabolic process, and thus improve heat tolerance by regulating mitochondrial activity and antioxidant processes using soluble sugars, and calcium signaling pathways regulated by calmodulin (CDPK) (Keunen E. et a1. Plant sugars are crucial players in the oxidative challenge during abiotic stress: extending the traditional concept. Plant Cell Environment, 2013, 36: 1242-1255; Asano T. et a1. A rice calcium-dependent proteinkinase OsCPKl2 oppositely modulates salt-stress tolerance and blast disease resistance. Plant Journal, 2012, 69: 26-36).

[0007] In recent years, the Lentinula edodes stick rot disease caused by high temperature stress and subsequent Trichoderma infection has broken out many times in the main production areas of Hubei and Guizhou, China, causing damage to the yield and quality of L. edodes and huge economic losses to L. edodes production enterprises and cooperatives (Zhao C. et a1. Occurrence and control of Lentinula edodes stick rot disease. Hubei Plant Protection, 2020(05): 45-47; Wang Y. Identification of the pathogenic fungi of Lentinula edodes stick rot disease in Guizhou and preliminary exploration of its occurrence regularity [Master's thesis]. Guizhou University, 2022.). Therefore, studying the molecular mechanism of heat tolerance in L. edodes, mining heat-tolerant genes, and cultivating heat-tolerant L. edodes varieties are of great significance for solving the L. edodes stick rot disease caused by high temperature.

[0008] ABC (ATP-binding cassette) transporters, also known as ATP-binding cassette proteins, are a superfamily of membrane-integral proteins that are ubiquitous in prokaryotic and eukaryotic cells (Verrier PJ. et al. Plant ABC proteins-a unified nomenclature and updated inventory. Trends in Plant Science, 2008, 13(4): 151-159). The ABC transporter family is the largest family of transmembrane proteins that bind ATP and use the energy to drive the active transport of different molecules against a concentration gradient across all cellular membranes (Dean M. et al. Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annual Review of Genomics and Human Genetics, 2005, 6: 123-142; Higgins CF. ABC transporters: from microorganisms to man. Annual Review of Cell Biology, 1992, 8: 67-113; Dean M. et al. The human ATP-binding cassette (ABC) transporter superfamily. Journal of Lipid Research, 2001, 42(7): 1007-1017). ABC transporters have two nucleotide-binding domains (NBDs) and two transmembrane binding domains (TMDs) (Verrier P. et al. Plant ABC proteins--a unified nomenclature and updated inventory. Trends in Plant Science, 2008, 13(4): 151-159).Among the many types of ABC transporters, the structure and sequence of NBD are highly conserved (Davidson AL. et al. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiology and Molecular Biology Reviews, 2008, 72(2):317-364). However, the sequence similarity of TMD of ABC transporters is low. The NBD domain is responsible for binding ATP, and its conformation changes after ATP hydrolysis, thereby activating the transport process, while the TMD domain forms a channel for the substrate to pass through the lipid bilayer. The coordination of the two ultimately achieves the transport of substances (Davidson AL. et al. ABC transporters: how small machines do a big job. Trends in Microbiology, 2007, 15(10):448-455). Currently, in plant cells, ABC transporters play a key role in plant hormone transport, plant anther development, detoxification of exogenous toxins, lipid metabolism, plant disease resistance, etc. (Wu Z. et al. The influence of ABC transporters on plant anther development. Molecular Plant Breeding. 2024, https: / / link.cnki.net / urlid / 46.1068.S.20240312.1759.022). In arthropods, ABC transporters play an important role in detoxification and can actively reduce the overall contact of cells and organisms with endogenous toxins and xenobiotics, including pesticides (Amezian D. et al. The role of ATP-binding cassette transporters in arthropod pesticide toxicity and resistance. Current Opinion in Insect Science, 2024, 63:101200). In plant pathogenic fungi, ABC transporters can participate in the pathogenicity of fungi and affect the interaction between pathogens and hosts (Chen D. et al. Research progress of ABC transporter structure and function in plant pathogenic fungi. Progress in Biochemistry and Biophysics, 2021, 48(03):309-316.). Currently, there have been more studies on the function of ABC transporters in plants, animals, and pathogens, but relatively few studies on their function in edible fungi, and the role of ABC transporters in heat resistance is not clear.

[0009] The present application locates the Lentinula edodes ABC transporter gene (LeABC2) as a mycelium heat resistance related gene through whole genome association analysis, and uses the RNA interference technology to study the function of the LeABC2 gene in the heat resistance of Lentinula edodes, thereby providing a new solution for breaking through the problem of high temperature affecting the yield and quality in the Lentinula edodes industry. SUMMARY

[0010] The present application provides a heat resistance regulated gene LeABC2 cloned from Lentinula edodes, the full length of the gene is 5715bp, the sequence is shown as SEQ ID NO. 1, the length of the open reading frame is 4437bp, the sequence is shown as SEQ ID NO. 2, and the amino acid sequence is shown as SEQ ID NO. 3.

[0011] The second object of the present application provides an application of the ABC transporter gene LeABC2 in regulating the heat resistance of Lentinula edodes. The RNA interference expression vector of the gene is constructed, and is transformed into Lentinula edodes by the agrobacterium-mediated genetic transformation method, and the interference of the gene expression can improve the heat resistance of the mycelium.

[0012] In order to achieve the above object, the present application adopts the following technical solutions:

[0013] I. Cloning of the gene

[0014] The gene primers LeABC-DNA-F: 5'-TGGCTGTGGACAGTCTCTACAGTAT-3' and LeABC-DNA-R: 5'-GTCTAATACTACTTTAGAAC-3' are designed with the Lentinula edodes mononuclear Wpm-4 genome data as a reference sequence, and the cDNA primers LeABC-cDNA-F: 5'-TGGCTGTGGACAGTCTCTACA-3' and LeABC-cDNA-R: 5'-GTCTAATACTACTTTAGAACG-3' are designed. The DNA of the Lentinula edodes cultivation strain Wpm-4 is used as a template to amplify the LeABC2 full-length gene sequence (SEQ ID NO. 1), and the cDNA of the Wpm-4 strain is used as a template to amplify the cDNA sequence of LeABC2 (SEQ ID NO. 2).

[0015] II. Construction of gene interference (RNAi) vector

[0016] RNAi vector construction: according to the nucleotide sequence at both ends of the restriction site, design the recombinant primer ABC-RNAi-F: 5'-attgactgcttgaatggtaccCACACGAGGGCTCAGTCGC-3' and ABC-RNAi-R: 5'-ctcgcagctcttcacgaattcGCAGTTTGCTGCAGACCCA-3', amplify the LeABC2 conserved region fragment (SEQ ID NO. 4). Linearize the fragment pCAMBIA1300-g, Legpd promoter fragment, Leactin promoter fragment, LeABC2 gene conserved region fragment according to one-step cloning method for homologous recombination, transform into E. coli competent cells Trans-T1, and use primers ABC-RNAi-F and ABC-RNAi-R for positive clone sequencing detection. Extract the vector plasmid of the positive clone, which is the recombinant interference vector LeABC2-RNAi Figure 3 B).

[0017] III. Genetic transformation of Lentinula edodes and phenotype analysis

[0018] The heat-resistant strain S606 of Lentinula edodes is transformed by using the Agrobacterium-mediated genetic transformation method, and after three times of screening, stable RNAi positive transformants are obtained. Figure 4 The wild type, control empty load and RNAi transformants are subjected to heat shock at 36℃, 37℃, 38℃, 39℃, 40℃ and 41℃ for 24h, and then are cultured at 25℃, and the mycelium recovery growth is observed.

[0019] Experiments prove that compared with the control empty load strain, the RNAi strain can recover growth faster under the same high temperature stress, and the growth rate is increased by 2-3 times. The critical temperature of high temperature stress of the RNAi strain is increased by 1℃ compared with the wild type strain S606.

[0020] Compared with the prior art, the present application has the following advantages and beneficial effects:

[0021] The present application is the first to disclose the role of LeABC2 gene in regulating the heat resistance of Lentinula edodes at home and abroad. Based on the heat resistance phenotype data of 133 Lentinula edodes strains, whole genome association analysis is carried out to obtain the candidate gene LeABC2 for regulating heat resistance. Further, the LeABC2 gene RNA interference vector is constructed, and the function of the gene is studied by using the Agrobacterium-mediated genetic transformation method. The results show that the RNAi strain has stronger heat resistance than the wild type heat-resistant strain, and the recovery ability under high temperature stress is significantly enhanced. The LeABC2 gene negatively regulates the heat resistance of Lentinula edodes mycelium, and provides new gene resources for breaking through the problem of high temperature affecting yield and quality in Lentinula edodes industry. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The red horizontal line above is the significant correlation site detected by the correlation analysis, and the genes within the ±2 kb range are the trait correlation candidate genes. LeABC2 is located within the ±2 kb range of the correlation site indicated by the black arrow.

[0023] Figure 2 The figure is the LeABC2 protein sequence and structure analysis.

[0024] Figure 3 The figure is the vector plasmid pCAMBIA1300-g(A) and the recombinant vector LeABC2-RNAi(B) map.

[0025] Figure 4 The figure is the qRT-PCR detection of the expression amount of LeABC2 gene in LeABC2-RNAi transformants. S606 is the wild type strain, CK is the empty control inserted, and R-1, R-2, R-3 are three RNAi transformants.

[0026] Figure 5 The figure is the growth of wild type and transformant strains after different temperature heat stress. S606 is the wild type strain, CK is the empty control inserted, and R-1, R-2, R-3 are three RNAi transformants.

[0027] Figure 6 The figure is the mycelial growth rate of wild type and transformant strains after heat stress. S606 is the wild type strain, CK is the empty control inserted, and R-1, R-2, R-3 are three RNAi transformants. DETAILED DESCRIPTION

[0028] The methods used in the following examples are all conventional biological experimental methods unless otherwise specified, and the primers used are synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd., and the sequencing is completed by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. pEASY-Basic Seamless Cloning and Assembly Kit is purchased from TransGen company, restriction endonuclease is purchased from New England Biolabs company, hygromycin B is purchased from Roche company in Switzerland, kanamycin (Kan +Rifampin, cefotaxime (Cef), and acetylsuccinone (AS) were purchased from Qingjiang Biotechnology Co., Ltd., the San Prep column DNA recovery kit was purchased from Shanghai Huiling Biotechnology Co., Ltd., and RNAiso Plus was purchased from Takara Bio Engineering (Dalian) Co., Ltd. The genome data of the lentinan monokaryotic Wpm-4 strain used in the experiment were sequencing results from the inventor's research group. Lentinus edodes strain S606 and Wpm-4, Escherichia coli competent cells Trans-T1, Agrobacterium tumefaciens competent cells EHA105, and the vector plasmid pCAMBIA1300-g (the original 35S promoter of the pCAMBIA1300 vector was replaced by the Lentinus edodes Legpd promoter to initiate the expression of the hygromycin phosphotransferase gene hph) were all preserved in the inventor's laboratory. Example 1: Cloning of the LeABC2 gene

[0029] The ability of 133 *Lentinula edodes* strains to recover growth under high-temperature stress was systematically determined, and their heat tolerance phenotypes were examined. Further genome-wide association analysis revealed that LeABC2 (the ABC gene of *Lentinula edodes*) is an important candidate gene regulating heat tolerance in *Lentinula edodes*. Figure 1 ).

[0030] Based on the genome data of the lentinan monokaryotic strain Wpm-4 as a reference sequence, and using the DNA of the cultivated lentinan strain Wpm-4 as a template, primers LeABC-DNA-F:5'-TGGCTGTGGACAGTCTCTACAGTAT-3' and LeABC-DNA-R:5'-GTCTAATACTACTTTAGAAC-3' were designed to amplify and sequence the DNA sequence of the ABC transporter gene (SEQ ID NO.1). The PCR amplification system consisted of: 25 μL of 2×PhantaMax Buffer, 2 μL each of primers (10 μmol / L), 1 μL of dNTP Mix (10 mmol / L), 1 μL of PhantaMax Super-Fidelity DNA Polymerase (1 U / μL), 200 ng of template, and ddH2O added to a final volume of 50 μL. Reaction parameters were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 6 min, cycle number 34; and 72℃ complete extension for 10 min.

[0031] The cDNA of Wpm-4 strain was used as a template to design primers: LeABC-cDNA-F: 5'-TGGCTGTGGACAGTCTCTACA-3' and LeABC-cDNA-R: 5'-GTCTAATACTACTTTAGAACG-3', and the cDNA sequence of the ABC transporter protein gene was obtained by amplification and sequencing (SEQ ID NO. 2). The reaction parameters were as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 5 min, 34 cycles; and 72 °C complete extension for 10 min.

[0032] The basic physicochemical properties of LeABC2 protein were analyzed, and the results showed that LeABC2 gene encoded 1478 amino acids, the amino acid sequence was shown as SEQ ID NO. 3, the molecular formula of the protein was C 7376 H 11458 N 1970 O 2137 S 56 , the relative molecular mass was 163721.39, the theoretical isoelectric point was 8.09, the instability coefficient was 41.09, the aliphatic index was 86.21, and the total average hydrophobicity index was -0.027, so LeABC2 was an unstable hydrophilic protein.

[0033] LeABC2 protein functions in the form of a dimer, which consists of 4 domains, i.e., 2 highly conserved ATP binding domains (ABC) and 2 transmembrane domains (TMD) Figure 2 A). LeABC2 protein can have 12 transmembrane structures, which are located at 510-532 bp, 545-567 bp, 594-616 bp, 623-645 bp, 655-674 bp, 759-781 bp, 1172-1194 bp, 1207-1229 bp, 1259-1281 bp, 1288-1310 bp, 1315-1334 bp, and 1439-1461 bp Figure 2 B). The signal peptide analysis of the protein sequence showed that LeABC2 protein does not have a signal peptide and is a non-secretory protein Figure 2 C).

[0034] Example 2 Construction of gene interference (RNAi) vector

[0035] The plasmid pCAMBIA1300-g was double digested with Eco Rl and Kpnl, and the recovery was detected by 1% agarose gel electrophoresis. According to the nucleotide sequence at both ends of the digestion site, the recombinant primers ABC-RNAi-F: 5'-attgactgcttgaatggtaccCACACGAGGGCTCAGTCGC-3' and ABC-RNAi-R: 5'-ctcgcagctcttcacgaattcGCAGTTTGCTGCAGACCCA-3' were designed to amplify a 464 bp long LeABC2 conserved region fragment (SEQ ID NO. 4), and the reaction parameters were as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 34 cycles; 72°C thorough extension for 10 min. The PCR amplification product was purified and recovered. The recombinant primers LeActin-F: 5'-ccacctcaaacttcggaattcGCAGTATTTATACCTACGGAGCG-3' and LeActin-R: 5'-tcttccgagCGTGAAGAGCTGCGAGTGTTG-3' were used to amplify the L. edodes Leactin promoter fragment. The PCR amplification product was purified and recovered. The linearized fragment pCAMBIA1300-g, Legpd promoter fragment, Leactin promoter fragment, and ABC transporter gene conserved region fragment were subjected to homologous recombination by one-step cloning (2 x Basic Assembly Mix 5 μL, supplemented with ddH2O to 10 μL, 100 ng of the linearized fragment pCAMBIA1300-g, 50 ng of the Leactin promoter, 40 ng of the Legpd promoter, and 20 ng of the LeABC conserved fragment). The reaction was performed at 50°C for 15 min in a PCR instrument, and the reaction system was then transferred to the E. coli competent cells Trans-Tl, and the positive clones were subjected to sequencing detection with the primers ABC-RNAi-1-F and ABC-RNAi-1-R, and were sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the positive clone gene fragment had 100% similarity with the reference sequence. The vector plasmid of the positive clone was extracted, which was the recombinant interference vector ABC-RNAi.

[0036] Example 3: Introduction of the gene interference (RNAi) vector into Agrobacterium

[0037] The above constructed recombinant vector ABC-RNAi and pCAMBIA1300-g (CK) were introduced into the Agrobacterium competent cells EHA105 by freeze-thaw method. The steps were as follows:

[0038] 1) The Agrobacterium competent cells stored at -80°C were inserted into ice when they were melted and in the ice water mixed state;

[0039] 2) Add 5 μL plasmid DNA to 100 μL competent cells, mix the bottom of the tube, and then stand on ice for 5 min, in liquid nitrogen for 5 min, 37°C water bath for 5 min, and ice bath for 5 min;

[0040] 3) Add 900 μL LB medium without antibiotics, and shake culture at 28°C for 3.5 h;

[0041] 4) Centrifuge at 5000 r / min for 3 min, take about 100 μL supernatant, resuspend the bacterial pellet by blowing, and spread on LB medium containing 50 μg / mL Kan + and 20 μg / mL Rif;

[0042] 5) Invert and culture in a 28°C incubator for 2-3 days, about 60 h;

[0043] 6) Perform RNAi positive clone detection with primers ABC-RNAi-1-F and ABC-RNAi-1-R;

[0044] 7) Shake the positive monoclonal strain to OD 600 = 1.8-2.0, add an equal volume of 50% glycerol, and store in a -80°C refrigerator for subsequent use.

[0045] Example 4 Genetic transformation and phenotype analysis of Lentinula edodes

[0046] Using the heat-resistant strain S606 of Lentinula edodes as the recipient strain, Agrobacterium-mediated genetic transformation was performed as follows: the stored Agrobacterium liquid containing recombinant vector ABC-RNAi and plasmid pCAMBIA1300-g was added to 1 mL liquid LB medium (containing 50 μg / mL Kan + , 20 μg / mL Rif), and activated at 28°C and 200 r / min for 1 d. The activated Agrobacterium liquid was added to 100 mL basic medium MM (containing 50 μg / mL Kan + ), and cultured at 28°C and 200 r / min for 24 h. After centrifugation at 4°C and 5000 r / min for 10 min, the supernatant was discarded. Acetyl-syringone (AS) was added to the induction medium IM to a final concentration of 200 μmol / L, and the bacterial body was resuspended with an appropriate amount of induction medium, so that the initial OD 600 of the bacterial liquid was about 0.4. The bacterial liquid was placed in a 28°C, 200 r / min shaker for 2.5 h, so that the OD 600 was about 0.8.

[0047] The mycelium of Lentinula edodes strain S606 was activated in MYG medium in advance, and after about 7 d, it was intensively punched and scraped with a sterilized gun head, and resuspended with the above OD 600Agrobacterium liquid with OD600 of about 0.8 was used to infect the mycelia for 25 min with slight shaking every 5 min to ensure uniform infection. The liquid was carefully drained, and the mycelial blocks were inoculated on co-cultivation medium Co-IM (containing 200 μmol / L AS) and cultured at 25°C for 2 d. After 2 d of co-cultivation, the mycelial blocks were picked from the medium, soaked in sterile water containing 400 μg / ml cefotaxime (Cef) for 20 min, and shaken every 5 min to remove the Agrobacterium on the surface of the mycelia. The water was carefully drained, and the mycelial blocks were inoculated on MYG medium containing 6 μg / mL hygromycin and 400 μg / mL Cef and cultured at 25°C for 15 d for the first screening.

[0048] The mycelia that germinated after the first screening were picked with a sterilized gun head, inoculated on MYG medium containing 6 μg / mL hygromycin, 6-7 mycelial blocks per plate, and cultured at 25°C for 7 d for the second screening. The mycelia that germinated after the second screening were picked with a sterilized gun head, inoculated on MYG medium containing 6 μg / mL hygromycin, 1 mycelial block per plate, and cultured at 25°C for 7 d for the third screening. The strains that could still grow after the third screening were used as putative positive transformants, and their DNA and RNA were extracted for the next step.

[0049] Minimal Media (MM): K-buffer 10 mL, M-N buffer 20 mL, 20% glucose (w / v) 10 mL, 0.01% FeSO4(w / v) 10 mL, 20% (NH4)2SO4(w / v) 2.5 mL, 1% CaCl 2· 2H2O (w / v) 1 mL, ddH2O 1 L, and the pH was adjusted to 6.7-7.0 with H3PO4 or NaOH.

[0050] Induction Media (IM): K-buffer 10 mL, M-N buffer 20 mL, 20% glucose (w / v) 5 mL, 0.01% FeSO4(w / v) 10 mL, 20% (NH4)2SO4(w / v) 2.5 mL, 1% CaCl 2· 2H2O (w / v) 1 mL, 50% glycerol (w / v) 10 mL, 7.808 g MES (40 mmol / L, MW 195.2), ddH2O 1 L, and the pH was adjusted to 5.6 with H3PO4 or NaOH.

[0051] Co-induction Media (Co-IM): K-buffer 10 mL, M-N buffer 20 mL, 20% glucose (w / v) 2.5 mL, 0.01% FeSO4(w / v) 10 mL, 20% (NH4)2SO4(w / v) 2.5 mL, 1% CaCl 2· 2H2O (w / v) 1 mL, 50% glycerol (w / v) 10 mL, 7.808 g MES (40 mmol / L, MW 195.2), agar 20 g, ddH2O 1 L, adjust pH to 5.6 with H3PO4 or NaOH.

[0052] Example 5 PCR and real-time fluorescent quantitative PCR identification of positive transformants

[0053] The strains that can still grow after three times of screening were used as putative positive transformants, and the mycelium was collected after 7 days of culture at 25°C on MYG medium with glass paper, and the total DNA was extracted by CTAB method. PCR amplification was used to verify the transformants, and the hygromycin primers GPD-F: TTCGTTTCAGGCCTTGCCTC and HYG-R: CGGTGTCGTCCATCACAGTT were used for PCR verification. The recombinant interference vector ABC-RNAi was used as a positive control, and S606 wild type, empty DNA, and water were used as negative controls. Reaction parameters: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 1 min 30 s, cycle number 27; 72°C complete extension for 10 min. The transformants that can amplify the 1242 bp target fragment were preliminarily identified as positive transformants.

[0054] The positive transformants screened were cultured at 25°C for 7 days on MYG medium with glass paper, and the mycelium was collected. Total RNA was extracted using the RNAiso Plus kit (TaKaRa), and reverse transcription was performed using the HiScript IIOne Step RT-PCR Kit (Vazyme). Real-time quantitative PCR (qRT-PCR) was performed using the AceQTM qPCR SYBR Green Master Mix (Takara) kit in the CFX Connect Real-Time PCR System (BIO-RAD). The cDNA after reverse transcription was diluted 10 times as a template.

[0055] The quantitative primers are qPCR-F: 5'-TGGTATTGGACCGTTGGATTT-3' and qPCR-R: 5'-CGGCGAAAGAGACATAGTAGAAG-3'. The reference gene is Leactin, the reference primers are LY-Leactin-F: 5'-GCATCCTGTCCTTCTTACCGAG-3' and LY-Leactin-R: 5'-AAGAGCGAAACCCTCGTAGATG-3', and the control is the S606 strain transformant into which the empty vector is transferred. The relative expression amount of the gene is calculated by 2 -ΔΔCT (Luo et al. Selection and validation of references for qRT-PCR in Lentinula edodes under different experiment conditions. 2019, Genes, 10(9), 647.)

[0056] The qRT-PCR reaction system is: AceQTM qPCR SYBR Green Master Mix 5 μL, primers (10 μM) 0.5 μL each, cDNA 3 μL, and ddH2O 1 μL. The reaction parameters are: 95 °C pre-denaturation for 5 min, 95 °C denaturation for 10 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, and the cycle number is 40; the temperature setting of the melting curve is 65 °C to 95 °C, and the data is read once every 0.5 °C.

[0057] According to the quantitative results, the S606 wild-type strain, one control transformant (CK) into which the empty vector is transferred, and three RNAi transformants (R-1, R-2, and R-3) are finally selected for subsequent phenotype experiments. Figure 4 ).

[0058] Example 6: Determination of heat resistance of ABC-RNAi transformants

[0059] The S606 wild-type, empty control, and positive transformants cultured at 25 °C for 5 d are subjected to heat shock at 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, and 41 °C for 24 h, and then cultured at 25 °C to observe the mycelial growth recovery. Figure 5 At 36-38 °C, the S606 wild-type, empty control, and RNAi transformants can recover growth within 5 d after heat shock. Within the same time, the mycelial recovery growth rate of the transformants RNAi-2 and RNAi-3 is significantly higher than that of the wild-type strain. Figure 6). Under the condition of heat shock at 39℃, the growth of the empty control strain stopped, and the wild type S606 and the transformant RNAi-2 could recover growth within 5 days after heat shock. After heat shock at 40℃, the wild type and the empty control could not recover growth, but the transformants RNAi-1, RNAi-2 and RNAi-3 could recover growth within 10 days after heat shock. After heat shock at 41℃, the wild type, the empty control and the transformants could not recover growth Figure 5

[0060] Experiments have proved that, compared with the control empty strain, under the same high temperature stress, the RNAi strain can recover growth faster, and the growth rate is increased by 2-3 times. For the critical temperature of high temperature stress, the RNAi strain is 1℃ higher than the wild type strain S606. After interfering the expression of Le-ABC2 gene, the heat resistance of Lentinula edodes mycelium is enhanced, and the strain recovers growth earlier after heat shock.​

Claims

1. Shiitake mushrooms WithABC2 Genes, or shiitake mushrooms WithABC2 Gene-encoded proteins, or WithABC2 The application of gene interference vectors in regulating the heat resistance of shiitake mushrooms is characterized by, Interference WithABC2 Gene expression enhances the heat resistance of shiitake mushrooms. WithABC2 The cDNA sequence of the gene is shown in SEQ ID NO.

2.

2. A method for improving the heat resistance of shiitake mushrooms, characterized in that, RNA interference was used to inhibit [the virus] in shiitake mushrooms. WithABC2 Gene expression, the WithABC2 The cDNA sequence of the gene is shown in SEQ ID NO.

2.

3. The method according to claim 2, characterized in that, Build WithABC2 A gene RNA interference vector containing the fragment shown in SEQ ID NO.4 was transferred into shiitake mushrooms using an Agrobacterium-mediated genetic transformation method.

Images