Tissue-specific protein in-vivo proximity labeling method and application thereof
By using the Cre-loxP system to insert the TurboID fusion gene fragment into the mouse genome and combining it with the expression of tissue-specific Cre recombinase, tissue-specific protein proximity tagging in mammals is achieved. This solves the problem of difficulty in achieving tissue-specific protein proximity tagging in mammals in existing technologies and provides an efficient research tool platform.
Patent Information
- Application Number
- CN202510885769.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-09-23
Smart Images

Figure CN120683143A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the biomedical technology field of constructing genetically engineered animal models, and specifically to a method for achieving tissue-specific protein proximity labeling in vivo, a mouse model constructed by the method, and applications of the method, which are particularly suitable for studying protein interaction networks in specific tissue cell populations. Background Art
[0002] As the core functional carriers of life activities, proteins rely on complex molecular interaction networks to realize their biological functions, including dynamic regulatory mechanisms such as protein-protein interactions (PPIs), protein-nucleic acid interactions, and protein-small molecule ligand binding. Protein interaction networks play a pivotal role in key life processes such as cell cycle regulation, post-transcriptional modification of gene expression, maintenance of protein homeostasis, and regulation of metabolic pathways. The analysis of these dynamic interaction mechanisms has become a key frontier in modern molecular biology research.
[0003] The current mainstream protein interaction detection technology system mainly includes classic methods such as co-immunoprecipitation (Co-IP), GST pull-down, and yeast two-hybrid system. Taking Co-IP technology as an example, as the gold standard for verifying in vivo protein interactions, its application faces significant technical bottlenecks: First, the method is limited by the steric hindrance effect of the antigen epitope, making it difficult to effectively capture transient or weak-affinity interaction events; second, the detection sensitivity of low-abundance target proteins is insufficient; third, the success of the experiment is highly dependent on the availability of specific monoclonal antibodies, and the species restriction and epitope masking of antibody preparation often lead to false-negative results. These technical limitations have severely restricted our in-depth understanding of the dynamic regulatory mechanisms of cellular signaling transduction networks, especially the quantitative characterization of weak interaction events in subcellular organelle microenvironments, which still poses significant technical challenges.
[0004] In 2012, Roux first reported a biotin-based protein proximity labeling (PL) method and named this biotin ligase BioID. Through genetic engineering, a target bait protein is fused to BioID. When expressed in cells, the bait protein catalyzes the covalent labeling of neighboring proteins with biotin (typically within a 10-40 nm radius) in living cells. The required substrate, biotin, is a water-soluble B vitamin that is ubiquitous in living organisms and binds tightly to avidin. Biotinylated proteins are then enriched using streptavidin magnetic beads, and mass spectrometry analysis allows for the identification of neighboring molecules of the target protein. This technique not only eliminates the need for antibodies but also facilitates the capture of transient or weak protein interactions in vivo, enabling the study of complex biological processes within cells. Subsequently, Ting et al. optimized BioID to develop a new, more efficient proximity labeling enzyme, TurboID, which significantly improves labeling efficiency, enabling complete labeling within minutes to hours. This method also offers enhanced sensitivity, making it more suitable for studying live animals or low-expressing proteins.
[0005] At present, research on protein proximity labeling is mainly focused on the cellular level. Usually, protein proximity labeling in cell lines is achieved by knocking the bait protein-TurboID fusion gene into a specific cell line. However, if you want to study the protein interaction relationship of a certain bait protein during development or under specific pathological conditions, you need to perform protein proximity labeling in vivo. In 2023, the first in vivo protein proximity labeling system for plants was established. By constructing transgenic Arabidopsis that stably expresses the BIN2-TurboID fusion protein, the first BIN2 interaction molecular regulatory network in plants was mapped. Although TurboID has obvious advantages, especially in labeling efficiency and time control, there are currently no reports on bait protein-specific protein proximity labeling in mammals. This field urgently needs a stable genetic model for tissue-specific labeling in mammals. Summary of the Invention
[0006] To address the shortcomings of the existing technology, the present invention provides a mouse model that conditionally expresses TurboID fusion protein, which utilizes the Cre-loxP system to achieve proximity labeling of target proteins in specific tissues to study the interaction network of specific proteins (such as VGLL4) in vivo.
[0007] To achieve the above object, the present invention adopts the following technical solutions:
[0008] The tissue-specific protein in vivo proximity labeling method comprises the following steps:
[0009] S1. Construct a TurboID fusion gene fragment with loxP sequences and knock it into the Vgll4 locus of the mouse genome. Breed and identify F0 generation positive mice.
[0010] S2. The F0 generation positive mice in step S1 were mated with wild-type mice to obtain the F1 generation, and Vgll4-TurboID positive mice were obtained by genotyping;
[0011] S3. The positive F1 generation mice are mated with mice that express Cre recombinase in tissue-specific ways to obtain bigenic mice that express the VGLL4-TurboID fusion protein in specific tissues;
[0012] S4. Performing biotin intervention on the double-genotype mice in step S3 to achieve protein proximity labeling in their tissues;
[0013] In step S1, the TurboID fusion gene fragment with loxP sequence is specifically the loxP-5*STOP-loxP-TurboID-2A-GFP-WPRE-ployA exogenous gene fragment;
[0014] The nucleic acid sequence of TurboID-2A-GFP is shown in SEQ ID HO.1;
[0015] The nucleic acid sequence of loxP-5*STOP-loxP is shown in SEQ ID HO.2;
[0016] The nucleic acid sequence of WPRE-ployA is shown in SEQ ID HO.3.
[0017] Preferably, the loxP-5*STOP-loxP-TurboID-2A-GFP-WPRE-ployA exogenous gene fragment is site-specifically inserted after the 5th exon of the Vgll4 gene.
[0018] Preferably, the mouse that tissue-specifically expresses Cre recombinase is derived from Nkx2.1-Cre mouse.
[0019] Preferably, the F1 generation mice are verified by GFP expression, Western Blot and immunofluorescence co-localization detection.
[0020] The present invention also provides a protein proximity-labeled mouse constructed using the labeling method.
[0021] Preferably, the mouse can stably express VGLL4-TurboID fusion protein in alveolar epithelial tissue after Cre-induced expression and perform protein proximity labeling, and the labeled protein can be immunofluorescently stained and co-localized with GFP, TurboID and avidin antibodies.
[0022] Preferably, the biotin intervention method is to add biotin through drinking water, and the intervention duration is 1 to 2 weeks; the growth period of the bigenic mice undergoing biotin intervention is 8 weeks old.
[0023] Preferably, the labeled protein is enriched by avidin magnetic beads and analyzed by Western blot and mass spectrometry.
[0024] In addition, the tissue-specific protein in vivo proximity labeling method provided by the present invention can be applied to in vivo screening of VGLL4 interacting proteins and analysis of lung development or disease-related signaling pathways or targets.
[0025] Beneficial effects of the present invention:
[0026] (I) For the first time, a mouse model capable of tissue-specific expression of TurboID fusion proteins was constructed, enabling efficient protein proximity tagging in mammals. This approach facilitates the study of interacting proteins of desired genes. By inserting TurboID after the target gene to construct a specific bait protein, this model has the following significant advantages:
[0027] This method uses CRISPR / Cas9 technology for site-specific insertion into the genome, ensuring the precise positioning of the fusion gene sequence at the endogenous locus, thereby ensuring the stable expression of the fusion protein in the target tissue;
[0028] Secondly, combined with the tissue-specific expression capability of the Cre / loxP system, the target protein, such as VGLL4, is activated only in the desired cell population, thus avoiding systemic background interference;
[0029] In addition, the fused GFP tag can be used for real-time visual screening and identification of positive individuals, simplifying the model construction process;
[0030] (2) The present invention also offers the advantages of oral administration of biotin, which is simple to operate and has minimal physiological interference with animals. Under conditions where TurboID enzyme activity is activated, efficient labeling of adjacent proteins can be achieved in just a few hours to two days, enabling in situ studies of protein interaction networks over short timescales. This model is suitable for mapping protein interactions across a variety of tissues and time windows, and has broad research application potential.
[0031] (3) This animal model provides a powerful in vivo tool platform for protein interactomics, developmental biology, disease mechanism research, and potential drug screening. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1Schematic diagram of the construction strategy of Vgll4-TutboID tool mice (A) and the construction and working principle of alveolar epithelial-specific proximity marker mice (B);
[0033] Figure 2 Schematic diagram of the experimental process of proximity labeling of mouse lung epithelial proteins;
[0034] Figure 3 Schematic diagram of the protein proximity labeling experiment principle;
[0035] Figure 4 The figure shows the immunofluorescence staining results of frozen sections of lung tissue of Nkx2.1-Cre; Vgll4-TurboID mice after 2 weeks of biotin drinking water intervention using GFP, TurboID antibody (red) and avidin (gray);
[0036] Figure 5 Western blot analysis of GFP, TurboID, VGLL4, and GAPDH protein levels (A) and avidin labeling levels (B) in lung tissues of Nkx2.1-Cre;Vgll4-TurboID mice and Vgll4-TurboID control mice after 0, 1, and 2 weeks of biotin drinking water intervention.
[0037] Figure 6 The figure shows the results of avidin magnetic bead enrichment of total lung tissue protein in Nkx2.1-Cre;Vgll4-TurboID mice and Vgll4-TurboID control mice after 0, 1, and 2 weeks of biotin drinking water intervention;
[0038] Figure 7 Schematic diagram of the principle of BioID and TurboID biotin ligase protein proximity labeling;
[0039] Figure 8 Flowchart of VGLL4-TurboID protein proximity labeling. DETAILED DESCRIPTION
[0040] In order to make those skilled in the art better understand the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The experimental methods in the following embodiments, unless otherwise specified, are conventional methods. The test materials used in the following embodiments, unless otherwise specified, were purchased from conventional biochemical reagent companies.
[0041] It should be noted that, unless there is a conflict, the embodiments and features in the embodiments of this application may be combined with each other. The present application will be described in detail below with reference to the accompanying drawings and in conjunction with the embodiments. It should be understood that the embodiments described in this specification are merely for the purpose of explaining the present invention and are not intended to limit the present invention.
[0042] Example 1: Construction of Vgll4-TurboID tool mice
[0043] CRISPR / Cas9 technology was used to insert the loxP-5*STOP-loxP-TurboID-2A-GFP-WPRE-ployA exogenous gene fragment after the 5th exon of the mouse Vgll4 gene (the operation principle is shown in the attached Figure 7 and attached Figure 1 A), wherein the detailed sequence of TurboID-2A-GFP (see SEQ ID HO.1 in the sequence listing) is:
[0044]
[0045] The nucleic acid sequence of loxP-5*STOP-loxP is shown in SEQ ID HO.2;
[0046]
[0047] The nucleic acid sequence of the WPRE-polyA is shown in SEQ ID NO.3:
[0048] TCGAGGGGGCCACGGTACCCGTATCAAGCTTATCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGATACCGTCGATCCTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGGA。
[0049] First, a gRNA targeting the Vgll4 site was designed. After the gRNA was synthesized, it was co-microinjected into C57BL / 6 mouse fertilized eggs together with Cas9 mRNA and a donor plasmid containing an expression cassette. After the fertilized eggs were implanted into pseudopregnant female mice, F0 generation mice were obtained.
[0050] Subsequently, the tail tips of F0 mice were cut, and genomic DNA was extracted using a rapid genotype detection kit. PCR amplification was performed using specific primers to identify whether the expression cassette was successfully inserted. Some samples were further verified by Sanger sequencing to verify the insertion site and sequence integrity.
[0051] At the same time, Western blot was used to detect the expression of GFP and TurboID proteins; GFP signals were detected by fluorescence microscopy to assist in screening positive individuals and verify that the TurboID fusion protein can be expressed under the drive of the endogenous promoter (e.g. Figure 1 B).
[0052] Example 2: Construction and validation of a protein proximity marker model specific to alveolar epithelial cells
[0053] The F1 generation Vgll4-TurboID heterozygous mice obtained above were crossed with Nkx2.1-Cre mice that specifically express Cre recombinase in the alveolar epithelium to obtain bigenic offspring (Nkx2.1-Cre; Vgll4-TurboID). Figure 1 B in the Figure 2 、 3 、4.
[0054] In Cre-expressing cells, the loxP-STOP-loxP sequence is excised, thereby activating the expression of the VGLL4-TurboID-2A-GFP fusion protein. Eight-week-old double-positive mice were selected for experimental groups. Biotin at a concentration of 200 μM was added to their drinking water for one and two consecutive weeks. A negative control group without biotin was also established.
[0055] After the biotin treatment, lung tissue was collected and processed. Half of the tissue was used for frozen sectioning and immunofluorescence staining. Anti-GFP, anti-TurboID antibodies, and fluorescently labeled avidin were used to detect protein colocalization. See the attached Figure 4 , verifying the expression of VGLL4-TurboID fusion protein and its protein proximity labeling in alveolar epithelial cells.
[0056] The other half of the lung tissue was used for protein extraction and Western blot analysis to detect the expression of GFP, TurboID and VGLL4 fusion proteins (the results correspond to Figure 5Figure A in Figure 2), and the changes in biotin labeling levels in total protein samples with the increase of intervention time were detected by Streptavidin-HRP. Figure 5 Figure B; and further enrichment and detection of labeled proteins using avidin magnetic beads, see Figure 5 B.
[0057] Example 3: Enrichment and Interaction Network Analysis of Protein Neighboring Marker Proteins After biotin treatment, lung tissue of Nkx2.1-Cre; Vgll4-TurboID mice was lysed and biotinylated proteins were affinity enriched using Streptavidin magnetic beads. The enriched protein samples were separated by SDS-PAGE and verified by Western blot. Figure 6 .
[0058] Subsequently, the protein samples were sent to the mass spectrometry center for LC-MS / MS analysis, and a list of neighboring interacting proteins of VGLL4 in lung epithelial tissue was obtained based on the peptide spectrum database comparison.
[0059] The above analysis results can be used to construct the cell signaling pathway and protein interaction network involved in VGLL4, and preliminarily reveal the functional role of VGLL4 in alveolar epithelial cells.
[0060] As can be seen from Examples 1-3 above, the present invention provides a mouse model capable of constructing tissue-specific expression of TurboID fusion proteins, achieving efficient protein proximity labeling in mammals; this method is suitable for mapping protein interactions across a variety of tissues and time windows, and has broad research and application potential.
[0061] The foregoing description is merely a preferred embodiment of the present application and is not intended to limit the present application. Persons skilled in the art will readily appreciate that various modifications and variations are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.
Claims
1. A tissue-specific protein proximity labeling method in vivo, characterized in that: The following steps are involved: S1. Construct a TurboID fusion gene fragment with loxP sequences and knock it into the Vgll4 locus of the mouse genome. Breed and identify F0 generation positive mice. S2. The F0 generation positive mice in step S1 were mated with wild-type mice to obtain the F1 generation, and Vgll4-TurboID positive mice were obtained by genotyping; S3. The positive F1 generation mice are mated with mice that express Cre recombinase in tissue-specific ways to obtain bigenic mice that express the VGLL4-TurboID fusion protein in specific tissues; S4. Performing biotin intervention on the double-genotype mice in step S3 to achieve protein proximity labeling in their tissues; In step S1, the TurboID fusion gene fragment with loxP sequence is specifically the loxP-5*STOP-loxP-TurboID-2A-GFP-WPRE-ployA exogenous gene fragment; The nucleic acid sequence of TurboID-2A-GFP is shown in SEQ ID HO.1; The nucleic acid sequence of loxP-5*STOP-loxP is shown in SEQ ID HO.2; The nucleic acid sequence of WPRE-ployA is shown in SEQ ID HO.
3.
2. The tissue-specific protein proximity labeling method according to claim 1, characterized in that: The TurboID fusion gene fragment with loxp sequence described in step S1 is inserted into the 5th exon of Vgll4 gene.
3. The tissue-specific protein proximity labeling method according to claim 1, characterized in that: The mice expressing tissue-specific Cre recombinase are derived from Nkx2.1-Cre mice.
4. The tissue-specific protein proximity labeling method according to claim 1, characterized in that: The F1 generation mice were verified by GFP expression, Western Blot and immunofluorescence co-localization detection.
5. A protein proximity labeling mouse, characterized in that: It is constructed by the method according to any one of claims 1 to 4.
6. A protein proximity labeling mouse according to claim 5, characterized in that: After Cre-induced expression, the mouse can stably express VGLL4-TurboID fusion protein in alveolar epithelial tissue and perform protein proximity labeling. The labeled protein can be immunofluorescently stained and co-localized using GFP, TurboID and avidin antibodies.
7. A protein proximity labeling mouse according to claim 6, characterized in that: The biotin intervention method is to add biotin through drinking water, and the intervention duration is 1 to 2 weeks; the growth period of the double-genotype mice undergoing biotin intervention is 8 weeks old.
8. The protein proximity labeling mouse according to claim 7, characterized in that: The labeled proteins were enriched by avidin magnetic beads and analyzed by Western blot and mass spectrometry.
9. Tissue-specific protein proximity labeling methods are used to screen VGLL4-interacting proteins in vivo and analyze signaling pathways or targets related to lung development or disease.