Preparation of perylene bisimide derivative and application of perylene bisimide derivative as mitochondrial transcription inhibitor
By preparing non-planar perylene imide derivatives, the problem of existing mitochondrial targeting probes lacking specific targeting of mitochondrial DNA was solved, specific inhibition of mitochondrial DNA and anti-tumor effects were achieved, the water solubility of the compound was enhanced, and new mitochondrial targeting probes and anti-tumor treatment tools were provided.
Patent Information
- Application Number
- CN202510823804.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2025-09-30
AI Technical Summary
Existing mitochondrial targeting probes lack small molecule compounds that specifically target mitochondrial DNA, and existing mitochondrial transcription inhibitors mostly rely on fat-soluble cations or synthetic molecules, which are limited in variety and cannot effectively inhibit mitochondrial DNA transcription.
Non-planar perylene imide derivatives are prepared and embedded in DNA through specific structures to inhibit mitochondrial gene transcription, exert anti-tumor effects, and use their fluorescence properties for mitochondrial imaging.
It achieves specific inhibition of mitochondrial DNA, significantly inhibits gene transcription in tumor cells, enhances the water solubility of the compound, provides a new mitochondrial targeting probe, and provides a new tool for anti-tumor treatment.
Smart Images

Figure CN120718019A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of pharmaceutical technology and chemical probe development. More specifically, it relates to the preparation and application of a perylene imide derivative as a mitochondrial transcription inhibitor. This perylene imide derivative is a non-planar perylene imide derivative that can be used as a DNA-binding mitochondrial transcription inhibitor. The compound names PDI-NC and PDI-NN used herein have the following meanings: Background Art
[0002] Mitochondria, as essential organelles in eukaryotic cells, play a crucial role in energy production, apoptosis regulation, and metabolism. With in-depth research into the metabolic characteristics of tumor cells, increasing evidence indicates that mitochondrial dysfunction in tumor cells is closely associated with their malignant transformation. Tumor cell growth differs from normal cells in its dependence on oxidative phosphorylation. In 2020, Nature reported the first small molecule compounds, IMT1 and IMT1B, that specifically inhibit mitochondrial transcription for cancer therapy. These compounds exert their anti-tumor activity by specifically targeting human mitochondrial RNA polymerase, inhibiting mitochondrial transcription in tumor cells (Nature, 2020, 588(7839):712-716). Therefore, the development of targeted mitochondrial transcription inhibitors has become an emerging direction in cancer treatment and provides powerful chemical tools for studying the role of mitochondrial DNA in physiology and disease.
[0003] In addition to directly targeting RNA polymerase, many DNA-binding compounds, such as actinomycin D, are also RNA polymerase inhibitors. However, most of these DNA-binding compounds act on nuclear DNA and are not enriched in mitochondria. Therefore, no small molecule compounds specifically targeting mitochondrial DNA have been reported. Furthermore, existing mitochondrial-targeting probes mostly rely on lipid-soluble cations or synthetic molecules. However, these probes primarily consist of dyes containing anthocyanin structures (such as JC-1) or rhodamine structures (such as Rhodamine 123 and the MitoTracker series), and the variety is limited. Furthermore, low-toxic mitochondrial dyes such as JC-1 and MitoTracker do not inhibit mitochondrial DNA transcription.
[0004] Perylene diimide (PDI) is a compound composed of a perylene core and two imide groups. Cationic perylene diimide derivatives can accumulate in mitochondria, triggering a burst of endogenous reactive oxygen species and inducing apoptosis (Angew. Chem. Int. Ed. 2021, 60, 16215–16223). However, no new mitochondrial transcription inhibitors that bind to mitochondrial DNA and are based on perylene diimide have been reported. Summary of the Invention
[0005] In view of the above defects or improvement needs of the prior art, the object of the present invention is to provide a preparation of a perylene imide derivative and its application as a mitochondrial transcription inhibitor, wherein the perylene imide derivative is a non-planar perylene imide derivative and can be used as a mitochondrial transcription inhibitor in anti-tumor treatment. The present invention prepares a non-planar perylene imide derivative having a structure shown in the general formula (I) (II), and proves through a single molecule stretching experiment that the compound of the structure (I) (II) has the activity of intercalating and binding with DNA, and proves through fluorescent cell imaging that PDIC-BL can be specifically enriched in mitochondria and inhibit the transcription of mitochondrial genes. The present invention proves for the first time that such compounds specifically inhibit mitochondrial gene transcription in tumor cells and exert anti-tumor effects. At the same time, due to the fluorescent properties of the perylene imide derivatives, the compounds prepared by the present invention can also be used for fluorescent imaging of mitochondria, providing a mitochondrial probe with a novel structure compared to existing mitochondrial probes. The non-planar perylene imide derivatives obtained by the present invention can target mitochondria with high specificity and sensitivity, provide a new structural choice for fluorescent dyes targeting mitochondria, and provide a reliable tool for the application of cell mitochondrial imaging and anti-tumor treatment.
[0006] To achieve the above objectives, according to a first aspect of the present invention, a non-planar perylene imide derivative or a pharmaceutically acceptable salt or solvent compound thereof is provided, characterized in that the structural formula of the non-planar perylene imide derivative satisfies the general formula (I) or (II),
[0007] In the general formula (I), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom; In the general formula (II), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom.
[0008] As a further preferred embodiment of the present invention, the non-planar perylene imide derivative is PDIC-BL, whose structural formula satisfies the general formula (I), and the four R1 groups in the general formula (I) are all chlorine atoms; Alternatively, the non-planar perylene imide derivative is PDIC-PD, whose structural formula satisfies the general formula (II), and the four R1 groups in the general formula (II) are all chlorine atoms; Preferably, the pharmaceutically acceptable salt is PDIC-BL hydrochloride or PDIC-PD hydrochloride.
[0009] According to a second aspect of the present invention, the present invention provides a method for preparing the above-mentioned non-planar perylene imide derivatives or pharmaceutically acceptable salts or solvent compounds thereof, characterized in that the preparation method of the non-planar perylene imide derivatives comprises using halogenated 3,4,9,10-perylenetetracarboxylic dianhydride as a first raw material, reacting the first raw material with a second raw material in an organic solvent containing an acid; and separating and purifying after the reaction to obtain the non-planar perylene imide derivatives. Wherein, the second raw material is 1-(2-aminoethyl)pyrrolidine or 1-(2-aminoethyl)piperidine; when the second raw material is 1-(2-aminoethyl)pyrrolidine, the obtained non-planar perylene imide derivative satisfies the general formula (I); when the second raw material is 1-(2-aminoethyl)piperidine, the obtained non-planar perylene imide derivative satisfies the general formula (II); Preferably, the first raw material is selected from 1,6,7,12-tetrachloro-3,4,9,10-perylenetetracarboxylic dianhydride, 1,6,7,12-tetrafluoro-3,4,9,10-perylenetetracarboxylic dianhydride, and 1,7-dibromo-3,4,9,10-perylenetetracarboxylic dianhydride.
[0010] As a further preferred embodiment of the present invention, the acid-containing organic solvent is preferably N-methylpyrrolidone containing acid, and the acid is any one of glacial acetic acid, formic acid, propionic acid, and butyric acid; preferably, the acid is glacial acetic acid; The reaction temperature of the reaction is 100-120 ° C.
[0011] According to a third aspect of the present invention, the present invention provides a fluorescent compound that targets mitochondria, binds to mitochondrial DNA, and inhibits mitochondrial DNA transcription, characterized in that it comprises a non-planar perylene imide derivative as shown in general formula (I) or (II):
[0012] In the general formula (I), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom; In the general formula (II), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom.
[0013] According to a fourth aspect of the present invention, the present invention provides a use of a non-planar perylene imide derivative or a pharmaceutically acceptable salt thereof in the preparation of a drug for inhibiting mitochondrial DNA transcription and thereby exerting an anti-tumor effect, characterized in that: ; .
[0014] In the general formula (I), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom; In the general formula (II), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom; In the general formula (III), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom.
[0015] As a further preferred embodiment of the present invention, the pharmaceutically acceptable salt of the non-planar perylene imide derivative is specifically a salt formed by the reaction of the non-planar perylene imide derivative with other compounds, wherein the other compound is an organic acid, an inorganic acid, an organic base or an inorganic base; Preferably, the organic acid corresponding to the organic acid salt is one or more selected from acetic acid, methanesulfonic acid, citric acid, fumaric acid, maleic acid, glycolic acid, lactic acid, salicylic acid, succinic acid, p-toluenesulfonic acid, tartaric acid, methanesulfonic acid, malonic acid, and lipoic acid; the inorganic acid corresponding to the inorganic acid salt is one or more selected from hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid; the organic base corresponding to the organic base salt is meglumine and / or glucosamine; and the inorganic base corresponding to the inorganic base salt is an alkaline compound of an alkali metal or an alkaline earth metal.
[0016] As a further preferred embodiment of the present invention, the application is to induce tumor cell apoptosis by inhibiting mitochondrial DNA transcription.
[0017] As a further preferred embodiment of the present invention, the drug is an anti-tumor drug for treating breast cancer; Preferably, the application is to induce tumor cell apoptosis by inhibiting the expression of mitochondrial DNA encoding genes mtCO1 and mtND1 in breast cancer cells.
[0018] According to the fifth aspect of the present invention, the present invention provides a pharmaceutical composition that can be used for mitochondrial-targeted anti-tumor treatment, characterized in that it comprises the above-mentioned non-planar perylene imide derivatives or pharmaceutically acceptable salts or solvent compounds thereof.
[0019] Through the above technical solutions conceived by the present invention, compared with the prior art, the present invention has prepared a new non-planar perylene imide compound represented by the general formula (I) (II), and at the same time, it was discovered for the first time that the non-planar perylene imide compound represented by the general formula (I) (II) (III) can not only specifically aggregate in mitochondria, but also directly interact with DNA to inhibit the transcription of mitochondrial genes and exert an anti-tumor effect. This mechanism is different from the previously reported mitochondrial transcription inhibitors that act on mitochondrial RNA polymerase, and provides a new idea and method for the development of anti-tumor drugs of the mitochondrial transcription inhibitor class. The fluorescence properties of the compounds of the present invention can be used to provide a new live cell imaging tool for real-time monitoring of mitochondrial function and its dynamic changes.
[0020] The present invention discovered for the first time a small molecule compound that targets mitochondria and binds to mitochondrial DNA, thereby inhibiting mitochondrial DNA transcription. This mechanism of direct inhibition of mitochondrial transcription is different from the previously reported mechanism of directly triggering the outbreak of endogenous reactive oxygen species and inducing cell apoptosis. Instead, it works by directly affecting the transcription of mitochondrial-encoded genes, affecting the assembly of oxidative phosphorylation complexes, destroying mitochondrial homeostasis, and thus killing tumor cells. It is a new type of mitochondrial transcription inhibitor that binds to mitochondrial DNA, which is completely different from the existing technology.
[0021] Specifically, the present invention can achieve the following beneficial effects: (1) The present invention reports for the first time a non-planar perylene imide derivative and a pharmaceutically acceptable salt thereof. The non-planar perylene imide derivative has the general structure of (I) (II). The perylene imide plane contains at least one halogen atom. The halogen causes the original conjugated perylene plane to change, forming a non-planar perylene imide derivative (taking the halogen atom as Cl as an example, the chlorine atom causes the conjugated planar conformation to be distorted, forming a non-planar structure). Taking the following examples as an example, PDIC-BL hydrochloride and PDIC-NC showed significant anti-tumor activity in MCF-7 cell experiments and can be further used in clinical promotion.
[0022] (2) The non-planar perylene imide derivatives of the general formula (I) (II) (III) obtained in the present invention have a strong fluorescent signal, can target mitochondria with high specificity, and can play a significant role in inhibiting mitochondrial DNA transcription. The mitochondrial-targeted fluorescent probe obtained based on the non-planar perylene imide derivatives of the present invention can be used for cell imaging. For example, the prepared mitochondrial-targeted fluorescent probe can be added to the cell culture medium for incubation, and then the mitochondrial fluorescent signal can be captured by fluorescence microscopy to monitor the dynamic changes of mitochondria. The probe not only has a strong fluorescent signal, excellent mitochondrial targeting ability and specificity, but also can effectively inhibit the transcription of mitochondrial DNA. Through real-time imaging, the probe can monitor the morphology and functional changes of mitochondria in living cells and the dynamic process of mitochondrial DNA transcription inhibition, and can be used for cell biology research on the function of mitochondrial DNA transcription, as well as tumor treatment research.
[0023] (3) The non-planar perylene imide derivatives of the present invention can target mitochondria and induce apoptosis of tumor cells by inhibiting mitochondrial DNA transcription, thereby playing an anti-tumor role. Taking PDIC-BL as an example, as verified in the examples below, the present invention demonstrated through single-molecule force spectroscopy stretching experiments that PDIC-BL hydrochloride, PDIC-PD hydrochloride, and PDIC-NC can bind to double-stranded DNA, embed into double-stranded DNA, and lead to an increase in the end-to-end length of DNA. The present invention further confirmed through rtPCR experiments the significant inhibitory effect of PDIC-BL hydrochloride on the mitochondrial genes mtCO1 and mtND1, revealing its mechanism of enrichment in mitochondria, binding to mitochondrial double-stranded DNA, and inhibiting mitochondrial transcription, thereby achieving anti-tumor activity, showing good therapeutic potential and selectivity.
[0024] (4) The non-planar perylene imide derivatives obtained in the present invention have significantly better solubility than conventional planar perylene imide compounds. Conventional planar perylene imide compounds, such as those with structural formulas such as PDI-NN and PDI-NC, do not contain halogen atoms in the perylene imide planar ring.
[0025] The non-planar perylene imide derivatives obtained by the present invention can significantly enhance the water solubility and anti-tumor activity of the compound. Taking PDIC-BL, PDIC-NC and PDIC-PD as examples, as illustrated in the examples below, PDIC-BL hydrochloride, PDIC-NC and PDIC-PD hydrochloride have a significant effect on the growth of MCF-7 cells in a 48-hour MTT experiment. The anti-tumor activity of PDIC-BL and PDIC-NC was higher than that of planar PDI-NC, and PDIC-BL had the best anti-tumor activity. The expression of PDIC-BL in MCF-7 cells was 3.0 ± 1.3 μM. Furthermore, PDIC-BL significantly inhibited the transcription of the mitochondrial genes mtCO1 and mtND1 in MCF-7 cells in a 6-hour rtPCR experiment, with their expression levels reduced to approximately 20% of the control group (P < 0.01), further demonstrating the role of its mitochondrial targeting mechanism.
[0026] (5) Moreover, the preparation process of the non-planar perylene imide derivative of the present invention is simple. The reaction temperature can be preferably controlled at 100-120 °C, and the yield can be as high as 60% or more. The drug has high purity, high yield, stable quality, is suitable for large-scale production, and is easy to realize industrial application. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 The non-planar perylene imide derivative PDIC-BL hydrochloride prepared in Example 1 1 H-NMR spectrum.
[0028] Figure 2 The non-planar perylene imide derivative PDIC-BL hydrochloride prepared in Example 1 13 C-NMR spectrum.
[0029] Figure 3 The non-planar perylene imide derivative PDIC-NC prepared in Example 2 1 H-NMR spectrum.
[0030] Figure 4 The non-planar perylene imide derivative PDIC-NC prepared in Example 2 13 C-NMR spectrum.
[0031] Figure 5 The non-planar perylene imide derivative PDIC-PD hydrochloride prepared in Example 3 1 H-NMR spectrum.
[0032] Figure 6 The non-planar perylene imide derivative PDIC-PD hydrochloride prepared in Example 3 13 C-NMR spectrum.
[0033] Figure 7 The fluorescence spectrum of the non-planar perylene imide derivative PDIC-BL hydrochloride prepared in the present invention.
[0034] Figure 8 The fluorescence spectrum of the non-planar perylene imide derivative PDIC-NC prepared in the present invention.
[0035] Figure 9 The fluorescence spectrum of the non-planar perylene imide derivative PDIC-PD hydrochloride prepared in the present invention.
[0036] Figure 10 The non-planar perylene imide derivative PDIC-BL hydrochloride prepared by the present invention co-localizes with the mitochondria of breast cancer MCF-7 cells.
[0037] Figure 11 The present invention is to test the MTT activity of the non-planar perylene imide derivatives (ie, PDIC-BL hydrochloride, PDIC-NC, PDIC-PD hydrochloride) on breast cancer MCF-7 cells.
[0038] Figure 12 The effects of the non-planar perylene imide derivatives PDIC-BL hydrochloride, PDIC-PD hydrochloride, and PDIC-NC prepared by the present invention on mitochondrial transcription in breast cancer MCF-7 cells; wherein, Figure 12 (a) and (b) are for PDIC-BL hydrochloride. Figure 12 (c) and (d) are for PDIC-NC. Figure 12 (e) and (f) are for PDIC-PD hydrochloride; in addition, the "NC" column in the figure represents the control group, and the "2μM" column indicates that 2μM of the corresponding non-planar perylene imide derivative was used.
[0039] Figure 13 This is a comparison chart of the solubility experiments of PDI-NN, PDI-NC, PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride in Example 8.
[0040] Figure 14 1 and 2 show the single-molecule force spectroscopy results of the binding of the non-planar perylene imide derivatives (i.e., PDIC-BL hydrochloride, PDIC-PD hydrochloride, and PDIC-NC) and the traditional planar perylene imide derivative PDI-NC to double-stranded DNA in Example 9.
[0041] Figure 15 This is a comparison chart of the MTT activities of PDIC-BL hydrochloride prepared in the present invention and the traditional planar perylene imide derivative PDI-NC in Comparative Example 1 on breast cancer MCF-7 cells. DETAILED DESCRIPTION
[0042] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely for the purpose of explaining the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.
[0043] The preparation method of the non-planar perylene imide derivatives of the present invention, taking the general formula (I), (II), and (III) where all four R1 groups are Cl and PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride as examples, can be as follows:
[0044] Specifically: In an organic solvent (N-methylpyrrolidone), tetrachloroperylene anhydride (1,6,7,12-tetrachloro-3,4,9,10-tetracarboxylic dianhydride) is respectively reacted with 1-(2-aminoethyl)pyrrolidine, N,N-dimethylethylenediamine, and 1-(2-aminoethyl)piperidine, and the mixture is stirred and heated. After the reaction is completed, an appropriate amount of organic solvent is added and stirred for 24 hours, and the intermediates are filtered to obtain the intermediates. Subsequently, an appropriate amount of hydrochloric acid is added dropwise to the intermediates for acidification, and an organic solvent is added for recrystallization, and the final products PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride are respectively obtained by filtration.
[0045] In the following examples, the reagents used were all purchased from commercial sources, as shown in Table 1. .
[0046] The following are specific embodiments: Example 1 This example is the preparation of a non-planar perylene imide derivative PDIC-BL hydrochloride. The structural formula of the non-planar perylene imide derivative PDIC-BL hydrochloride is:
[0047] The perylene imide derivative PDIC-BL hydrochloride was prepared as follows: 1,6,7,12-Tetrachloro-3,4,9,10-tetracarboxylic dianhydride (265.0 mg, 0.5 mmol) and 1-(2-aminoethyl)pyrrolidine (0.5 mL, 3.9 mmol) were added sequentially to a reaction flask filled with N-methylpyrrolidone (NMP, 9 mL) and glacial acetic acid (8 mL) under argon. After stirring at 120°C for 24 hours, hydrochloric acid (2 M, 20 mL) was added to the reaction solution to obtain PDIC-BL hydrochloride as a dark black solid (318.1 mg, 80% yield).
[0048] The H NMR spectrum analysis of the product is as follows: 1 H NMR (600 MHz, CF3COOD) δ 9.18 (s, 4H), 8.49 (s, 2H), 5.19 (t, J = 5.5 Hz, 4H), 4.53 (dd, J = 11.3, 5.9Hz, 4H), 4.22(q, J = 5.6 Hz, 4H), 3.71 (dt, J = 12.1, 6.3 Hz, 4H), 2.73-2.63 (m, 8H). like Figure 1 shown.
[0049] Its carbon nuclear magnetic resonance spectrum analysis is as follows: 13 C NMR (151 MHz, CF3COOD) δ 161.07, 132.64,130.19, 127.17, 126.32, 119.15, 117.68, 52.06, 50.92, 33.27,18.67. Figure 2 shown.
[0050] Example 2 This example is the preparation of a non-planar perylene imide derivative PDIC-NC. The structural formula of the non-planar perylene imide derivative PDIC-NC is:
[0051] The perylene imide derivative PDIC-NC was prepared as follows: 1,6,7,12-tetrachloro-3,4,9,10-tetracarboxylic dianhydride (265.0 mg, 0.5 mmol), N,N-dimethylethylenediamine (0.9 mL, 10 mmol), and glacial acetic acid (5 mL) were added sequentially to a reaction flask containing N-methylpyrrolidone (NMP, 5 mL) and reacted under argon. After stirring at 100°C for 24 hours, the reaction solution was recrystallized by adding hydrochloric acid (2 M, 100 mL) and anhydrous ethanol (100 mL). N,N'-bis(2-(dimethylammonium)ethyl)perylene-1,6,7,12-tetrachloro-3,4,9,10-tetracarboxylic diimide hydrochloride (PDIC-NC) was isolated as a red solid (222.9 mg, 60% yield).
[0052] The H NMR spectrum analysis of the product is as follows: 1H NMR (600 MHz, CF3COOD) δ 9.21 (s, 4H), 8.37 (s, 2H), 5.24 (br s, 4H), 4.22 (br s, 4H), 3.66 (s, 12H). like Figure 3 shown.
[0053] Its carbon nuclear magnetic resonance spectrum analysis is as follows: 13 C NMR (151 MHz, CF3COOD) δ 161.22, 132.72,130.27, 127.23, 126.40, 119.21, 117.70, 54.01, 40.06 (d, J =5.0 Hz), 32.30.HRMS-ESI, m / z calcd for C 32 H 25 Cl4N4O4 + : 671.0595; found: 671.0551. Figure 4 shown.
[0054] Example 3 This example is the preparation of a non-planar perylene imide derivative PDIC-PD hydrochloride. The structural formula of the non-planar perylene imide derivative PDIC-PD hydrochloride is:
[0055] The perylene imide derivative PDIC-PD hydrochloride was prepared as follows: a mixture of 1,6,7,12-tetrachloro-3,4,9,10-tetracarboxylic dianhydride (265 mg, 0.5 mmol), 1-(2-aminoethyl)piperidine (0.5 mL, 3.5 mmol), 6 mL of glacial acetic acid, and 9 mL of N-methylpyrrolidone (NMP) was reacted under argon. After stirring at 120°C for 24 hours, hydrochloric acid (2 M, 10 mL) was added to the reaction solution and separated to afford N,N'-bis(2-(1-piperidinyl)ethyl)perylene-1,6,7,12-tetrachloro-3,4,9,10-tetracarboxylic diimide hydrochloride (PDIC-PD) (329.3 mg, 80% yield) as a deep red solid.
[0056] The H NMR spectrum analysis of the product is as follows: 1H NMR (600 MHz, CF3COOD) δ 9.20 (s, 4H),7.75 (s, 2H), 5.21 (t, J = 5.6 Hz, 4H), 4.44-4.38 (m, 4H), 4.12(q, J = 5.5Hz, 4H), 3.50 (q, J = 11.4 Hz, 5H), 2.55-2.48 (m, 5H), 2.44-2.35 (m, 8H), 2.09 -1.96 (m, 2H). like Figure 5 shown.
[0057] Its carbon nuclear magnetic resonance spectrum analysis is as follows: 13 C NMR (151 MHz, CF3COOD) δ 161.26, 132.70,130.29, 127.26, 126.39, 119.28, 117.86, 52.47 (d, J = 15.7Hz), 51.66-51.03(m), 31.89, 19.12 (d, J = 3.6 Hz), 17.03. HRMS-ESI, m / z calcd for C 38 H 33 Cl4N4O4 + : 751.1221; found: 751.1269. Figure 6 shown.
[0058] Example 4: Fluorescence Spectra of Non-Planar Perylene Diimide Derivatives Based on the PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride prepared in the above examples, solutions of PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride at varying concentrations were prepared: 0.08 μM, 0.16 μM, 0.31 μM, 0.63 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, and 20 μM, respectively. Samples were diluted to the desired concentration using an appropriate solvent (PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride were dissolved in 3% DMSO and diluted to the final concentration in DMEM or PBS buffer before measurement; the amount of DMSO used depended on the solubility of the compound). Fluorescence intensity of the samples was measured using a fluorescence spectrophotometer. The excitation wavelength was set to an excitation wavelength appropriate for PDIC compounds (e.g., 500 nm). The emission wavelength range was set to 400 nm to 800 nm. Before each measurement, the cuvette was rinsed and zeroed with a blank solvent. Different concentrations of PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride samples were placed in cuvettes and their fluorescence emission spectra were measured in turn. The fluorescence emission intensity of each sample was recorded to ensure that the experimental conditions were consistent each time. The obtained fluorescence emission spectrum data was plotted into a graph with the ordinate being the fluorescence intensity (relative unit) and the abscissa being the wavelength (nm). The results are shown in Figure 2. Figure 7 、 Figure 8 、 Figure 9 As shown, the fluorescence intensity gradually increases with increasing concentration, indicating that PDIC-BL hydrochloride exhibits concentration-dependent fluorescence emission characteristics under the excitation wavelength. The fluorescence emission peak occurs at approximately 550 nm, and the fluorescence intensity reaches a maximum at 20 μM. The fluorescence signal is weak at low concentrations (e.g., 0.08 μM), but the fluorescence intensity rises rapidly with increasing concentration. Similar to PDIC-BL hydrochloride, PDIC-NC also exhibits concentration-dependent fluorescence emission characteristics. The fluorescence emission peak still occurs at approximately 550 nm, but the overall fluorescence intensity is significantly higher than that of PDIC-BL hydrochloride. The fluorescence intensity reaches a maximum of nearly 10,000 relative units at 20 μM, indicating that the fluorescence emission efficiency of PDIC-NC is higher than that of PDIC-BL hydrochloride. Similar to PDIC-BL hydrochloride, PDIC-PD hydrochloride also exhibits concentration-dependent fluorescence emission characteristics. The fluorescence emission peak occurs at approximately 570 nm, and the fluorescence intensity is slightly lower than that of PDIC-NC at the same concentration.
[0059] Example 5: PDIC-BL hydrochloride targeting to mitochondria Based on the PDIC-BL hydrochloride prepared in the above example, in this example, MCF-7 cells were seeded in DMEM medium containing 10% fetal bovine serum (FBS) and cultured in a constant temperature incubator at 37°C and 5% CO2 until the logarithmic growth phase. 4 Cells were seeded at a density of 10 cells / dish and incubated in a 37°C, 5% CO2 incubator for 24 hours to allow attachment. Subsequently, 2 μM of a non-planar perylene imide derivative (PDIC-BL hydrochloride) was added directly to the culture medium in the confocal microscopy dish and incubated under the same conditions for 48 hours to observe the compound's effects on the cells. After incubation, mitochondria were labeled with MitoTracker Deep Red dye. The mitochondrial dye was added to the culture medium at the recommended working concentration (final concentration of 100-200 nM), gently mixed, and incubated at 37°C, 5% CO2 for 30 minutes. Cells were then washed two to three times with prewarmed 1× PBS to remove excess dye, and fresh culture medium or imaging buffer was added for subsequent analysis. Fluorescence intensity and colocalization of PDIC-BL hydrochloride and the mitochondrial dye were captured by confocal microscopy. Fluorescence channels were selected to assess the compound's mitochondrial targeting ability and fluorescence signal. The experimental results showed that the non-planar perylene imide derivative PDIC-BL hydrochloride co-localized significantly with the mitochondrial dye and was enriched in the cell mitochondria ( Figure 10 ).
[0060] Example 6: Antitumor activity detection of non-planar perylene imide derivatives against breast cancer MCF-7 cells Based on the PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride prepared in the above examples, in this example, the 48-hour half-maximal inhibitory concentration ( ) of PDIC-BL hydrochloride, PDIC-PD hydrochloride, and PDIC-NC on MCF-7 cells was determined by MTT assay. The specific experimental steps are as follows: MCF-7 cells were seeded in 96-well plates at 1×10 4Cells were cultured at a density of 100 cells / mL and incubated at 37°C, 5% CO2 for 24 hours to allow cell attachment. Subsequently, PDIC-BL hydrochloride, PDIC-PD hydrochloride, or PDIC-NC were added at different concentrations (0.00457 μM, 0.0137 μM, 0.0411 μM, 0.123 μM, 0.370 μM, 1.111 μM, 3.330 μM, 10 μM, and 30 μM) and incubated under the same conditions for another 48 hours. After the incubation, 20 μL of 5 mg / mL MTT solution (i.e., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide solution, referred to as thiazolium blue solution) was added to each well and incubated at 37°C for another 4 hours to form blue-purple formazan crystals. Afterwards, the culture medium was discarded and 150 μL of DMSO was added to dissolve the formazan crystals. The absorbance (OD value) was measured at a wavelength of 570 nm using a microplate reader, and the cell viability was calculated. By fitting the curve of cell viability and compound concentration, the cell viability was obtained. The experimental results show that ( Figure 11 ), PDIC-BL hydrochloride, PDIC-PD hydrochloride and PDIC-NC on MCF-7 cells The values were 0.59 ± 0.09 μM, 5.0 ± 1.0 μM, and 0.8 ± 0.2 μM, respectively, indicating that PDIC-BL hydrochloride and PDIC-NC had more significant inhibitory effects on MCF-7 cells than PDIC-PD hydrochloride. These results provide quantitative evidence for the antitumor activity of the three non-planar perylene imide derivatives.
[0061] Example 7: Effects of non-planar perylene imide derivatives on mitochondrial transcription in breast cancer MCF-7 cells Based on the non-planar perylene imide derivatives PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride prepared in the above examples, in this example, real-time fluorescence quantitative PCR (rtPCR) was used to detect the inhibitory effects of PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride on mitochondrial gene transcription in MCF-7 cells. The specific experimental steps are as follows: MCF-7 cells were seeded in 6-well plates at 2×10 5Cells were seeded at a density of 100 μM and cultured at 37°C, 5% CO₂ until adherent. Subsequently, 2 μM PDIC-BL hydrochloride was added to the experimental groups, while untreated cells served as the control group (NC). Cells were incubated under the same conditions for an additional 6 hours to observe the effects of the compound. After incubation, total RNA was extracted using Trizol reagent. Specifically, after discarding the culture medium, 1 mL of Trizol reagent was added to each well to lyse the cells. After thoroughly mixing the lysate, the sample was transferred to an enzyme-free EP tube. 200 μL of chloroform was added, the mixture was vigorously shaken, and the tube was allowed to stand for 5 minutes before centrifugation at 12,000 rpm for 10 minutes at 4°C. The supernatant was then added with an equal volume of isopropanol, mixed, and allowed to stand at -20°C for 10 minutes. The supernatant was then discarded, and the pellet was washed once with 75% ethanol. After centrifugation, the ethanol was discarded, the pellet was air-dried, and dissolved in an appropriate amount of RNase-free water. Extracted total RNA was reverse transcribed into cDNA using a commercial reverse transcription kit (in this example, the White Shark Biotech reverse transcription kit, Cat. No. BL699A). Following the kit instructions, total RNA was mixed with the reaction system (including reverse transcriptase, random primers, and reaction buffer) and incubated at 37°C for 30 minutes. The reaction was then terminated by incubation at 85°C for 5 minutes. Primers were designed using the mitochondrial genes mtCO1 (forward primer: TACGTTGTAGCCCACTTCCACT, reverse primer: GGATAGGCCGAGAAAGTGTTGT) and mtND1 (forward primer: AAGTCACCCTAGCCATCATTCTAC, reverse primer: GCAGGAGTAATCAGAGGTGTTCTT) as target genes, and β2-microglobulin (B2M, forward primer: TGCTGTCTCCATGTTTGATGTATCT, reverse primer: TCTCTGCTCCCCACCTCTAAGT) as an internal reference gene. Real-time fluorescence quantitative PCR was performed using SYBR Green PCR Mix. The 20 µL PCR reaction system contained 10 µL SYBRGreen Master Mix, 0.4 µL upstream and downstream primers (0.2 µM each), 1 µL cDNA template, and 8.6 µL RNase-free water. The PCR protocol consisted of a 3-minute initial denaturation at 95°C, followed by 40 cycles of denaturation at 95°C for 10 seconds and annealing and extension at 60°C for 30 seconds. Fluorescence signals were collected after each cycle. The relative expression of the target gene was calculated using the ΔΔCt method and normalized to the control (NC) sample.
[0062] The experimental results showed that the non-planar perylene imide derivatives PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride all significantly inhibited the transcription levels of the mitochondrial genes mtCO1 and mtND1. Among them, PDIC-BL hydrochloride showed the strongest transcriptional inhibitory effect. After 6 hours of treatment with 2 μM PDIC-BL hydrochloride, the relative expression levels of mtCO1 and mtND1 were reduced to approximately 20% of the control genes (P<0.01). The above results indicate that PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride can significantly inhibit the transcription of mitochondrial genes in a short period of time, providing strong evidence for their mitochondrial targeting mechanism (see Figure 12 ).
[0063] Example 8 This example discusses the solubility of different perylene imide derivatives.
[0064] Prepare PDI-NN, PDI-NC, PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride respectively, wherein: 1) The structural formulas of planar perylene PDI-NN and PDI-NC are as follows:
[0065] 2) The preparation method of planar perylene PDI-NN and PDI-NC is as follows: Perylene-3,4,9,10-tetracarboxylic dianhydride (392.1 mg, 1.0 mmol) and N,N-dimethylethylenediamine (1 mL, 9.1 mmol) were added sequentially to a reaction flask filled with deionized water. The reaction was carried out under argon. After stirring at 100°C for 24 hours, the insoluble precipitate was filtered and washed with 1% KOH (50 mL) and water to obtain PDI-NN as a dark purple solid. The resulting PDI-NN solid was dissolved in methanol containing 2 mol / L hydrochloric acid, and the reaction mixture was stirred at room temperature for 24 hours. After recrystallization from an appropriate amount of diethyl ether, PDI-NC was obtained as an orange-red solid.
[0066] 3) PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride were prepared according to the above Examples 1-3.
[0067] Each perylene imide derivative was dissolved in 500 μL of dimethyl sulfoxide (DMSO) solution at a concentration of 5 mM. After dissolution, centrifugation was performed. Figure 13As shown, both PDI-NN and PDI-NC, two traditional planar perylene imide compounds, formed precipitates. However, PDIC-BL hydrochloride, PDIC-NC, and PDIC-PD hydrochloride formed homogeneous solutions with no solid precipitate. This indicates that non-planar PDIC compounds exhibit superior solubility compared to traditional planar perylene imide derivatives.
[0068] Example 9: Single-molecule magnetic tweezers measurements demonstrate that PDIC-BL hydrochloride, PDIC-PD hydrochloride, PDIC-NC, and PDI-NC can intercalate and bind to double-stranded DNA This example uses single-molecule magnetic tweezers technology to evaluate the interaction properties of the non-planar imide derivatives PDIC-BL hydrochloride, PDIC-PD hydrochloride, and PDIC-NC, as well as the reference compound PDI-NC, with double-stranded DNA at a concentration of 1 µM. The experiment strictly adheres to the core steps of a prior patent (Method for Single-Molecule Manipulation Detection of In Vitro Drug-Metabolizing Enzyme-Catalyzed DNA Adduct Formation, Authorization Publication No.: CN 115166131 B). First, a double-stranded DNA sample for single-molecule experiments was prepared: a 6618-base-pair DNA fragment was amplified by PCR using primers modified with biotin and thiol at the 5' end. Subsequently, a single-molecule DNA tethering system was constructed: a glass coverslip was treated with an aminosilane (e.g., APTES) to introduce amino groups. The surface was then activated with the heterobifunctional crosslinker sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (Sulfo-SMCC) to impart maleimide groups. Purified thiol-modified DNA molecules are added to an activated glass surface. One end of the DNA molecule is immobilized to the glass surface through a specific covalent reaction between the maleimide and thiol groups. Next, streptavidin-coated superparamagnetic microspheres (such as Dynabeads™ M-280) are added, specifically binding to the biotin group on the other end of the DNA, thereby forming a single-molecule DNA link between the glass surface and the magnetic beads. In a microfluidic sample cell filled with a standard buffer (such as PBS), a magnetic tweezers device is used to apply a series of known external forces (e.g., from 1 piconewton (pN) to 70 pN) by precisely controlling the distance between a permanent magnet and the sample cell. Simultaneously, the three-dimensional position of the magnetic beads is tracked using a high-resolution microscope and CCD camera. The elongation of the DNA molecule (i.e., the height of the magnetic beads) under different external forces is precisely measured, and force-elongation curves of the DNA in pure buffer solution are obtained as a baseline. Next, a buffer solution containing 1 µM PDIC-BL hydrochloride (a minimal amount of a cosolvent, such as DMSO, may be added if necessary, ensuring that the cosolvent concentration is consistent across all tests and has no effect on the DNA itself) is injected into the sample cell. The solution is incubated for approximately 5 minutes to ensure that the compound and DNA reach binding equilibrium. Subsequently, the force-elongation curve of the DNA molecule is remeasured under the exact same mechanical conditions as the baseline measurement. Following this, the force-elongation curves of 1 µM PDIC-PD hydrochloride, 1 µM PDIC-NC, and 1 µM PDI-NC are measured using the same procedure. By comparing the changes in DNA elongation under the same external force before and after the addition of each compound, the interaction between the compound and DNA is analyzed. If the addition of PDIC-BL hydrochloride, PDIC-PD hydrochloride, or PDIC-NC results in a significant increase in DNA length, this indicates that these compounds may bind to DNA, potentially through intercalation or other mechanisms, and alter its physical properties.The results of planar perylene imide PDI-NC are used for comparison.
[0069] The force-extension curves of the interaction between PDIC-BL hydrochloride, PDIC-PD hydrochloride, PDIC-NC and PDI-NC and double-stranded DNA measured by the above-mentioned single-molecule magnetic tweezers technique are shown in the figure. Figure 14 As shown. The black curve represents the control measurement results in PBS solution, and the red curve represents the measurement results after adding 1 µM of the corresponding compound. The experimental results show that within the range of applied external force (for example, from 1 pN to 60 pN before the DNA undergoes overstretching transition), the addition of 1 µM PDIC-BL hydrochloride, PDIC-PD hydrochloride, PDIC-NC, or PDI-NC significantly increased the magnetic ball height of the DNA molecule (i.e., the amount of DNA elongation) compared to the control group. The increase in the elongation of DNA molecules under force is a typical characteristic of small molecules intercalating between base pairs in the DNA double helix, resulting in an increase in the DNA contour length. Therefore, the experimental results demonstrate that the compounds PDIC-BL hydrochloride, PDIC-PD hydrochloride, PDIC-NC, and PDI-NC can intercalate and bind to double-stranded DNA at a concentration of 1 µM, and that this binding leads to an increase in the effective length of the DNA molecule.
[0070] Comparative Example 1 Prepare the traditional planar perylene imide derivative PDI-NC, the structural formula of which is as follows:
[0071] Preparation method: same as Example 8.
[0072] Referring to the method in Example 6, the anti-tumor activity of PDI-NC on breast cancer MCF-7 cells was tested. The results are as follows: Figure 15 As shown, it can be seen that the anti-tumor activity of the traditional planar perylene imide derivative PDI-NC on breast cancer MCF-7 cells is not as good as that of PDIC-NC.
[0073] The above embodiments are merely illustrative. For example, in addition to using the non-planar perylene imide derivatives themselves, they can also be used in the form of pharmaceutically acceptable salts or pharmaceutically acceptable solvates of the non-planar perylene imide derivatives (the corresponding pharmaceutical compositions include pharmaceutically acceptable salts or solvents) to produce diagnostic pharmaceutical compositions, all of which can be used for mitochondrial-targeted anti-tumor treatment. Taking pharmaceutically acceptable salts of non-planar perylene imide derivatives as an example, the salts can be organic acid salts, inorganic acid salts, organic base salts, or inorganic base salts. In organic acid salts, the organic acid used can be selected from one or more of acetic acid, methanesulfonic acid, citric acid, fumaric acid, maleic acid, glycolic acid, lactic acid, salicylic acid, succinic acid, p-toluenesulfonic acid, tartaric acid, methanesulfonic acid, malonic acid, and thioctic acid; in inorganic acid salts, the inorganic acid used can be selected from one or more of hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid; in organic base salts, the organic base used can be selected from meglumine and / or glucosamine; in inorganic base salts, the inorganic base used can be selected from alkaline compounds of alkali metals or alkaline earth metals, such as hydroxides or carbonates of sodium, potassium, calcium, magnesium, and zinc.
[0074] It will be easily understood by those skilled in the art that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A non-planar perylene imide derivative or a pharmaceutically acceptable salt or solvate thereof, characterized in that: The structural formula of the non-planar perylene imide derivative satisfies the general formula (I) or (II), In the general formula (I), the four R1 groups are selected from H or halogen atoms, and at least one of the R1 groups is a halogen atom; In the general formula (II), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom.
2. The non-planar perylene imide derivative or a pharmaceutically acceptable salt or solvate thereof according to claim 1, wherein: The non-planar perylene imide derivative is PDIC-BL, whose structural formula satisfies the general formula (I), and the four R1 groups in the general formula (I) are all chlorine atoms; Alternatively, the non-planar perylene imide derivative is PDIC-PD, whose structural formula satisfies the general formula (II), and the four R1 groups in the general formula (II) are all chlorine atoms; Preferably, the pharmaceutically acceptable salt is PDIC-BL hydrochloride or PDIC-PD hydrochloride.
3. The method for preparing the non-planar perylene imide derivative or a pharmaceutically acceptable salt or solvent compound thereof according to claim 1 or 2, characterized in that: The preparation method of the non-planar perylene imide derivatives is to use halogenated 3,4,9,10-perylenetetracarboxylic dianhydride as a first raw material, react the first raw material with a second raw material in an organic solvent containing an acid; and separate and purify after the reaction to obtain the non-planar perylene imide derivatives. Wherein, the second raw material is 1-(2-aminoethyl)pyrrolidine or 1-(2-aminoethyl)piperidine; when the second raw material is 1-(2-aminoethyl)pyrrolidine, the obtained non-planar perylene imide derivative satisfies the general formula (I); when the second raw material is 1-(2-aminoethyl)piperidine, the obtained non-planar perylene imide derivative satisfies the general formula (II); Preferably, the first raw material is selected from 1,6,7,12-tetrachloro-3,4,9,10-perylenetetracarboxylic dianhydride, 1,6,7,12-tetrafluoro-3,4,9,10-perylenetetracarboxylic dianhydride, and 1,7-dibromo-3,4,9,10-perylenetetracarboxylic dianhydride.
4. The preparation method according to claim 3, wherein The acid-containing organic solvent is preferably N-methylpyrrolidone containing acid, and the acid is any one of glacial acetic acid, formic acid, propionic acid, and butyric acid; preferably, the acid is glacial acetic acid; The reaction temperature of the reaction is 100-120 ° C.
5. A fluorescent compound that targets mitochondria, binds to mitochondrial DNA and inhibits mitochondrial DNA transcription, characterized in that: Including non-planar perylene imide derivatives as shown in general formula (I) or (II): In the general formula (I), the four R1 groups are selected from H or halogen atoms, and at least one of the R1 groups is a halogen atom; In the general formula (II), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom.
6. Use of a non-planar perylene imide derivative or a pharmaceutically acceptable salt thereof in the preparation of a drug for inhibiting mitochondrial DNA transcription and thereby exerting an anti-tumor effect, characterized in that: In the general formula (I), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom; In the general formula (II), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom; In the general formula (III), the four R1 groups are selected from H or halogen atoms, and at least one R1 group is a halogen atom.
7. The use according to claim 6, characterized in that Pharmaceutically acceptable salts of non-planar perylene imide derivatives, specifically salts formed by the reaction of non-planar perylene imide derivatives with other compounds, wherein the other compounds are organic acids, inorganic acids, organic bases or inorganic bases; Preferably, the organic acid corresponding to the organic acid salt is one or more selected from acetic acid, methanesulfonic acid, citric acid, fumaric acid, maleic acid, glycolic acid, lactic acid, salicylic acid, succinic acid, p-toluenesulfonic acid, tartaric acid, methanesulfonic acid, malonic acid, and lipoic acid; the inorganic acid corresponding to the inorganic acid salt is one or more selected from hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid; the organic base corresponding to the organic base salt is meglumine and / or glucosamine; and the inorganic base corresponding to the inorganic base salt is an alkaline compound of an alkali metal or an alkaline earth metal.
8. The use according to claim 6, characterized in that The application is to induce tumor cell apoptosis by inhibiting mitochondrial DNA transcription.
9. The use according to claim 6, characterized in that The drug is an anti-tumor drug for treating breast cancer; Preferably, the application is to induce tumor cell apoptosis by inhibiting the expression of mitochondrial DNA encoding genes mtCO1 and mtND1 in breast cancer cells.
10. A pharmaceutical composition that can be used for mitochondrial-targeted anti-tumor treatment, characterized in that: The invention comprises the non-planar perylene imide derivative as claimed in claim 1 or a pharmaceutically acceptable salt or solvent compound thereof.
Citation Information
Patent Citations
A single-molecule method for detecting the formation of DNA adducts catalyzed by drug-metabolizing enzymes in vitro
CN115166131B