Allosteric DNA ribozyme and application thereof

Abstract

The invention discloses allosteric DNA ribozyme and application thereof. The nucleotide sequence of the allosteric DNA ribozyme is selected from SEQ ID NO.01 to SEQ ID NO.10. The invention further discloses a preparation method of the allosteric DNA ribozyme The allosteric DNA ribozyme provided by the invention adopts a DNA structure, and compared with RNA ribozyme, the allosteric DNA ribozyme has higher chemical stability, is not easily degraded by nuclease, can complete theophylline detection within 60 minutes, does not need complex pretreatment or expensive instruments, is simple and convenient to operate, is suitable for bedside detection and household monitoring scenes, and greatly improves the detection efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of biosensors, and in particular relates to an allosteric DNA ribozyme and applications thereof. Background Art

[0002] Theophylline is a widely used bronchodilator in clinical practice, primarily for the treatment of respiratory diseases such as asthma and chronic obstructive pulmonary disease (COPD). Its mechanism of action is to relax bronchial smooth muscle and improve respiratory function by inhibiting phosphodiesterase and antagonizing adenosine receptors. However, theophylline has a narrow therapeutic window, and its blood concentration must be strictly controlled between 5-20 μg / mL (28-111 μM). If the concentration is too low, the efficacy is insufficient; if the concentration is too high, it may cause serious adverse reactions such as nausea, tachycardia, and even epilepsy. Therefore, the development of accurate and rapid methods for measuring theophylline concentration in body fluids is of great significance for optimizing clinical treatment plans and ensuring patient safety.

[0003] Currently, the detection of theophylline concentration mainly relies on traditional analytical methods, such as high-performance liquid chromatography (HPLC), gas chromatography (GC), and mass spectrometry (MS). These methods have high accuracy and sensitivity and can quantitatively detect theophylline content in biological samples. However, their application is limited by the following shortcomings: First, they require expensive instruments and highly skilled professional technicians to operate, making them difficult to popularize in primary medical institutions or home use scenarios; second, the sample pretreatment process is complicated and time-consuming, which cannot meet the needs of rapid testing; third, when testing complex biological samples such as urine, they are easily interfered by other components in the matrix, resulting in decreased specificity or sensitivity. These limitations have prompted researchers to seek simpler and more efficient detection technologies.

[0004] In recent years, biosensors have received extensive attention in the field of biomedical testing due to their high sensitivity, specificity and portability. Among them, biosensors based on nucleic acid aptamers (Aptamers) have become a research hotspot due to their advantages such as easy synthesis, good chemical stability and flexible modification. Nucleic acid aptamers are single-stranded DNA or RNA molecules obtained through in vitro screening technology (SELEX, Systematic Evolution of Ligands by Exponential Enrichment) that can specifically bind to target molecules. However, the traditional SELEX method has problems such as long screening cycle (usually 10-15 rounds), complex operation, and insufficient stability or sensitivity of the screened aptamers in complex matrices, which limit its application in actual detection.

[0005] Allosteric DNAzymes are novel nucleic acid molecules that combine the recognition capabilities of aptamers with the catalytic activity of ribozymes. Their unique characteristics are that in the absence of ligand, allosteric DNAzymes are inactive; upon binding of a specific ligand, their conformation changes, restoring catalytic activity and enabling detection of target molecules. This "on-off" mechanism gives allosteric DNAzymes unique advantages in biosensor design. However, traditional methods for screening allosteric DNAzymes still rely on multiple rounds of tedious positive and negative screening, resulting in low screening efficiency. To overcome these problems, Expression-SELEX technology has been developed in recent years. By directly integrating the catalytic activity of the ribozyme into the screening process, it simplifies the operational process and improves screening efficiency.

[0006] Prior art has reported the use of SELEX to screen theophylline aptamers and develop detection methods. However, these methods are often limited to the recognition function of a single aptamer, fail to fully utilize the catalytic properties of ribozymes, and have insufficient validation for use in complex biological samples (such as urine). Therefore, developing an efficient screening technology based on allosteric DNA ribozymes and applying it to the construction of fluorescent biosensors for theophylline, particularly for rapid detection in complex matrices such as urine, remains an urgent challenge in the current technology. Summary of the Invention

[0007] The present invention aims to overcome the defects of the prior art and provide an allosteric DNA ribozyme.

[0008] Another object of the present invention is to provide the application of the allosteric DNA ribozyme.

[0009] The technical solutions of the present invention are as follows:

[0010] An allosteric DNA ribozyme, whose nucleotide sequence is selected from SEQ ID NO.01 to SEQ ID NO.10.

[0011] The allosteric DNA ribozyme is used in the preparation of a fluorescent biosensor for detecting theophylline. The 5' end of the allosteric DNA ribozyme II-T-6 is labeled with a fluorescent group, and the 3' end is labeled with a corresponding quenching group.

[0012] In a preferred embodiment of the present invention, the fluorescent group is FAM, and the quencher group is BHQ1.

[0013] A fluorescent biosensor for detecting theophylline comprises the above-mentioned allosteric DNA ribozyme, the 5' end of which is marked with a fluorescent group, and the 3' end of which is marked with a corresponding quenching group.

[0014] In a preferred embodiment of the present invention, the fluorescent group is FAM, and the quencher group is BHQ1.

[0015] The application of the theophylline detection fluorescent biosensor in detecting theophylline in urine.

[0016] A method for detecting theophylline in urine is carried out using the theophylline detection fluorescent biosensor.

[0017] The beneficial effects of the present invention are:

[0018] 1. The allosteric DNA ribozyme (such as the representative sequence II-T-6) screened by the Expression-SELEX technology in the present invention can specifically recognize theophylline and effectively distinguish structurally similar compounds (such as caffeine and 3-methylxanthine). Experimental results show that the dissociation constant (K) of II-T-6 for theophylline is D ) is low, showing excellent binding affinity; the fluorescent biosensor constructed based on it has a low detection limit and can meet the clinical detection needs of micromolar theophylline concentrations.

[0019] 2. The allosteric DNA ribozyme in this invention utilizes a DNA structure, which makes it more chemically stable than RNA ribozymes and less susceptible to nuclease degradation. In complex buffers containing 1%-5% urine, the fluorescent biosensor maintains stable catalytic activity with a linear detection range of less than 3 μM, demonstrating excellent anti-interference capabilities and suitability for biological sample analysis.

[0020] 3. Compared with traditional HPLC, GC and other methods that require several hours of sample pretreatment and analysis, the fluorescent biosensor of the present invention can complete theophylline detection within 60 minutes without complex pretreatment or expensive instruments. It is easy to operate and suitable for bedside detection and home monitoring scenarios, greatly improving detection efficiency.

[0021] 4. The present invention uses Expression-SELEX technology to simplify the screening process. The screened allosteric DNA ribozymes can be quickly prepared by chemical synthesis. The construction of fluorescent biosensors only requires conventional modification groups such as FAM and BHQ 1. The raw materials are easily available, the preparation cost is low, and it is feasible for large-scale production and promotion and application.

[0022] 5. The allosteric DNA ribozymes screened and obtained in this invention can not only be used for theophylline detection in fluorescent biosensors, but can also serve as artificial riboswitches, inserted into the 5' or 3' ends of genes to regulate gene expression. This dual functionality holds broad application prospects in gene therapy, synthetic biology, and other fields.

[0023] 6. This invention successfully demonstrated the feasibility of a fluorescent biosensor for detecting theophylline in urine, demonstrating high sensitivity and specificity in a 1%-5% urine background. With further optimization, this technology is expected to become a routine tool for clinical monitoring of theophylline concentrations, enhancing the safety and effectiveness of treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The design of the allosteric DNA ribozyme library in Example 1 of the present invention is shown.

[0025] Figure 2 The screening process design in Example 1 of the present invention is shown.

[0026] Figure 3 The design of the fluorescent biosensor in Example 1 of the present invention is shown.

[0027] Figure 4 The secondary structures of the ten allosteric DNA ribozymes in Example 1 of the present invention are shown.

[0028] Figure 5 Specificity analysis of the ten allosteric DNA ribozymes described in Example 1 of the present invention is shown. (A) Gel electrophoresis analysis of the specificity of the ten allosteric DNA ribozymes. Autocleavage measurements derived from gel-based shear bands are shown. (B) Quantitative analysis of the autocleavage activity of the ten allosteric DNA ribozymes in the absence of ligand or in the presence of 250 μM theophylline. Data represent the mean of three independent replicates, and error bars represent standard deviations (SD).

[0029] Figure 6 The ligand binding affinity analysis of the representative allosteric DNA ribozymes II-T-6, II-T-5, and II-T-10 in Example 1 of the present invention is shown. (A) Affinity analysis of II-T-6. (B) Affinity analysis of II-T-5. (C) Affinity analysis of II-T-10. The left figure is a PAGE gel analysis of the autolytic activity of the allosteric DNA ribozymes in the presence of increasing concentrations of theophylline and 3-methylxanthine (0.3-300 μM). The right figure is a quantitative determination of the dissociation constant (K) of the allosteric DNA ribozymes binding to theophylline and 3-methylxanthine. D ), as shown by gel analysis. K D The values ​​are the mean ± SD of three independent experiments. Error bars indicate standard deviation.

[0030] Figure 7The ligand-induced enzymatic cleavage rate analysis of the representative allosteric DNA ribozymes II-T-6, II-T-5, and II-T-10 in Example 1 of the present invention is shown. (A) Enzymatic cleavage rate analysis of II-T-6. (B) Enzymatic cleavage rate analysis of II-T-5. (C) Enzymatic cleavage rate analysis of II-T-10. The left figures are all PAGE analyses of the self-cleavage activity of allosteric DNA ribozymes at the specified time points in lysis buffers without ligand or containing 250 μM theophylline, 3-methylxanthine, or caffeine. M1 and M2 represent ssDNA markers (87 nucleotides and 77 nucleotides, respectively). The right figures are all observed rate constants (k obs ). Data represent the mean ± SD of three independent experiments.

[0031] Figure 8 Binding affinity analysis of the fluorescent biosensor in Example 1 of the present invention is shown. (A) Gel electrophoresis analysis. The left panel shows the fluorescence of the remaining precursor, while the right panel shows the dissociation constant (K) derived from the gel-based quantification of the precursor fluorescence. D ) measurement. (B) Analysis in solution. The left panel shows the fluorescence emitted primarily from the 5' cleavage product containing the FAM group after theophylline binding. The right panel shows K D The linear range of the graph and the corresponding R 2 Values. Gel electrophoresis and solution experiments were performed in triplicate, and only one representative gel image is shown. Error bars represent the standard deviation of three replicates.

[0032] Figure 9 The binding affinity of the allosteric DNAzyme II-T-6 in Example 1 of the present invention is shown in a buffer solution containing 1% to 5% urine. (A) Analysis of unlabeled allosteric DNAzyme on a PAGE gel. The left panel shows the lysate gel image of theophylline binding to II-T-6 at various concentrations in a buffer solution containing 1% to 5% urine. The right panel presents the corresponding K values ​​derived from the results in the left panel. D (B) Fluorophore-labeled II-T-6 was analyzed on a PAGE gel. The left panel shows the fluorescence from the remaining precursor in a buffer containing theophylline and 1% urine. The right panel presents the dissociation constant (K) calculated based on the gel results. D ), represents the estimated fluorescence of the remaining precursor. (C) Liquid phase analysis of fluorophore-labeled II-T-6 in 1% urine. The left panel shows the fluorescence from the 5'FAM-labeled cleavage product after theophylline incorporation. The right panel highlights the linear range of the left curve (0-3 μM theophylline), including R 2 value. DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further illustrated and described below through specific implementation methods in conjunction with the accompanying drawings.

[0034] Example 1

[0035] like Figure 1 and Figure 2 As shown, this embodiment uses a Class II ribozyme (II-R1), in which the stem II of the Class II ribozyme is modified and replaced with 30 random bases N to produce an allosteric DNA ribozyme that binds to a specific ligand. When the stem of the ribozyme is destroyed, its stability is reduced and shearing cannot occur; and when the ligand is added, a conformational change occurs after binding to the random sequence, and the ribozyme recovers its complete structure and shears, and then the sequence that can bind to the target ligand is recovered, and a new DNA library is obtained by PCR amplification and splitting the single-strand reaction, and a new round of screening can be performed. Generally, allosteric DNA ribozymes that bind tightly to the ligand can be obtained through 6-14 rounds of screening. Subsequently, the specific allosteric DNA ribozyme obtained based on the screening is modified with a fluorescent group-quenching group, and the micromolar concentration of theophylline is detected by measuring the fluorescent group on the cleavage product or precursor. Allosteric DNA ribozymes with or without fluorescent labels can reliably detect micromolar concentrations of theophylline, and the linear range is within 3 μM even in the presence of 3% urine, which emphasizes their clinical potential.

[0036] The specific steps of this embodiment are as follows:

[0037] (1) Construction of allosteric DNA ribozyme library: Stem II of class II ribozyme was replaced by N 30 The replaced II-random-library sequence is used as the allosteric DNA ribozyme library, and the library construction should be at least 1×10 15 The nucleotide sequence of the II-random-library is: 5'-gaccactaggagcatctttggcga (SEQ ID NO.11)-N30-ctaggggaataaatctttgggcacctagtggtc (SEQ ID NO.12)-3'

[0038] (2) Negative screening incubation: The allosteric DNA ribozyme library was mixed in 2× HEPES buffer (0.1 M NaCl, 0.04 M MgCl2, 1 mM ZnCl2, pH 7.05) and incubated at 37°C for 12 h. The reaction system is shown in Table 1 below:

[0039] Table 1 Reaction system for negative screening incubation

[0040]

[0041] After incubating the allosteric DNA ribozyme library according to the reaction system in Table 1 above, the reacted single-stranded DNA was removed, and then the full-length single-stranded DNA was purified by gel excision.

[0042] (3) Positive Screening Incubation: The full-length single-stranded DNA purified from the gel excision obtained in the negative screening incubation was added with the target ligand (theophylline, final concentration 1 mM) and incubated at 37°C for 20 min. The 3'-end cleavage products were then separated by 10% polyacrylamide gel filtration and gel purified. (The final concentrations of the target ligand added in the sixth and tenth rounds were 0.5 mM and 0.25 mM, respectively. Starting from the eighth round, the positive screening incubation time was 10 min.)

[0043] (4) PCR amplification: The 3'-end cleavage product obtained by gel purification from the positive screening incubation was dissolved in 24 μL of DEPC2O and PCR amplified using the upstream primer II-forward: 5'-gaccactaggagcatctttggcga-3' (SEQ ID NO. 13) and the downstream primer II-reverse: 5'-P-gaccactaggtgcc-3' (SEQ ID NO. 14). The resulting DNA solution was subjected to PCR amplification using the reaction system shown in Table 2 and the procedure shown in Table 3 below:

[0044] Table 2 PCR reaction system

[0045]

[0046]

[0047] Table 3 PCR reaction program

[0048]

[0049] The obtained PCR amplification product was purified using ethanol precipitation.

[0050] (5) Obtaining a secondary library: The above PCR amplification product was split into single strands using Lambda Exonuclease. The reaction system and procedure are shown in Table 4 below:

[0051] Table 4 Single-stranded DNA splitting reaction system

[0052]

[0053] The obtained single-stranded DNA is subjected to gel excision and purification to obtain the allosteric DNA ribozyme library required for a new round of screening.

[0054] (6) Illumina second-generation sequencing: The 3' end product gel-purified DNA obtained in the fourteenth round of screening was used as a template for PCR amplification using the upstream primer P5-forward and downstream primer P7-reverse. The specific sequence information of the upstream and downstream primers is as follows:

[0055] P5-forward:

[0056] 5'-aatgatacggcgaccaccgagatctacacacctagtcctacactctttccctacacgacgctcttccgatcttaatacgactcactataggacccactaggagcatctttggcga-3' (SEQ ID NO. 15)

[0057] P7-reverse:

[0058] 5'-caagcagaagacggcatacgagatggtagatcgagtgactggagttcagacgtgtgctcttccgatctgaccactaggtgccc-3' (SEQ ID NO.16)

[0059] The library was constructed using the upstream and downstream primers mentioned above, and the PCR products were purified and then subjected to Illumina second-generation sequencing.

[0060] (7) Secondary structure analysis of allosteric DNA enzyme candidates: High-throughput sequencing data were collected from the enriched libraries and processed using a custom Perl script to compile and rank all unique read sequences. To identify homologous sequences and conserved structural patterns, random regions of 30 nucleotides were extracted from the top 3000 most abundant sequences, and BLAST searches were performed to detect sequences with more than 80% similarity to each of the top 10 most abundant sequences. This approach grouped each top sequence with its homologous sequence to form clusters of structurally related variants. Subsequently, the full-length sequences of these clusters were retrieved using a Perl script and aligned using Clustal Omega. The resulting multiple sequence alignments were subjected to RNAalifold for secondary structure prediction, which combines minimum free energy calculations and covariance analysis to infer conserved structural elements. Finally, the alignment files were visualized using R2 R to generate secondary structure maps.

[0061] Thus, this example obtained multiple sequences that bind to the target ligand (theophylline) and undergo cleavage, among which the nucleotide sequences of the top ten enriched allosteric DNA ribozymes are as follows:

[0062] 5'-gaccactaggagcatctttggcgatccgggggcacctatgtgcgacgctgggctaggggaataaatctttgggcacctagt ggtc-3'(II-T-1,SEQ ID NO.01);

[0063] 5'-gaccactaggagcatctttggcgacaatggagcgacggtgtggtcgagtcctactaggggaataaatctttgggcacctagtg gtc-3'(II-T-2,SEQ ID NO.02);

[0064] 5'-gaccactaggagcatctttggcgatcagggggccttgatggcgactcagtgggctaggggaataaatctttgggcacctagt ggtc-3'(II-T-3,SEQ ID NO.03);

[0065] 5'-gaccactaggagcatctttggcgatccgggggcatgctatgcgacgcttatgggctaggggaataaatctttgggcacctagt ggtc-3'(II-T-4,SEQ ID NO.04);

[0066] 5'-gaccactaggagcatctttggcgatccgggggtcacaagtgacggctagggctaggggaataaatctttgggcacctag tggtc-3'(II-T-5,SEQ ID NO.05);

[0067] 5'-gaccactaggagcatctttggcgatccgggggccactgaggcgacgctaatgggctaggggaataaatctttgggcacctag tggtc-3'(II-T-6,SEQ ID NO.06);

[0068] 5'-gaccactaggagcatctttggcgaacatcgtggtcggaaggcgtcggcggagtgctaggggaataaatctttgggcacctagt ggtc-3'(II-T-7,SEQ ID NO.07);

[0069] 5'-gaccactaggagcatctttggcgacagccgaagggaccagaagggagtcactgtctaggggaataaatctttgggcacctag tggtc-3' (II-T-8, SEQ ID NO. 08);

[0070] 5'-gaccactaggagcatctttggcgatccgggggtcacatcaggacgacgctagggctaggggaataaatctttgggcacctag tggtc-3' (II-T-9, SEQ ID NO. 09);

[0071] 5'-gaccactaggagcatctttggcgatccggggggctgtgcagccgacgcaaagggctaggggaataaatctttgggcaccta gtggtc-3' (II-T-10, SEQ ID NO. 10);

[0072] Its secondary structure is Figure 4 shown.

[0073] (8) Specificity analysis of ten representative allosteric DNA ribozymes: The sequences of the ten representative allosteric DNA ribozymes obtained above were synthesized by Genewiz (Suzhou, China) and reacted with ligand-free or 250 μM theophylline at 37°C for 30 min. The cleavage bands were separated by urea-denaturing PAGE gel electrophoresis. The grayscale values ​​of the cleavage bands were measured with the help of ImageJ software, and the self-cleavage activities of the ten allosteric DNA ribozymes were calculated.

[0074] The specific steps are as follows:

[0075] The sequences of ten representative allosteric DNA ribozymes were dissolved in water to 10 ng for later use, 1 mM theophylline was prepared, and a total system of 20 μL of reaction system was set. The specific information is shown in Table 5 below.

[0076] Table 5 Allosteric DNA ribozyme specific reaction system

[0077]

[0078] After thorough mixing, incubate at 37°C for 30 min. After incubation, add an equal volume of 2× loading buffer and mix thoroughly, then perform 15% denaturing polyacrylamide gel electrophoresis.

[0079] Based on the 15% denaturing polyacrylamide gel, the cleavage activities of the ten allosteric DNA ribozymes were visualized. The grayscale values ​​of the cleavage bands were measured with the help of ImageJ software, and then the cleavage activities of the ten allosteric DNA ribozymes were calculated. The average value of the three independent experiments was repeated. The specific results are as follows Figure 5 shown.

[0080] (9) Binding affinity analysis of allosteric DNA ribozymes II-T-6, II-T-5, and II-T-10: Taking three representative allosteric DNA ribozymes II-T-6, II-T-5, and II-T-10 as examples, a concentration gradient was designed to conduct binding affinity experiments. The grayscale value of the sheared band was measured using ImageJ software, and the equilibrium dissociation constant K was obtained using GraphPad Prism software. D value.

[0081] The specific steps are as follows:

[0082] A 10 mM stock solution of theophylline solution (solvent: water) and a 3-methylxanthine solution (solvent: DMSO, ultrasonic dissolution) were prepared, and then diluted to 3 mM, 1 mM, 0.3 mM, 0.1 mM, 0.03 mM, 0.01 mM, and 0.003 mM theophylline solution and 3-methylxanthine solution, respectively. The total system was set to a 20 μL reaction system. The specific information is shown in Table 6 below.

[0083] Table 6 Allosteric DNA ribozyme affinity reaction system

[0084]

[0085] After thorough mixing, the final concentrations of theophylline solution and 3-methylxanthine solution were adjusted to 300 μM, 100 μM, 30 μM, 10 μM, 3 μM, 1 μM, 0.3 μM, and 0.1 μM. The mixture was incubated at 37°C for 30 min. After incubation, an equal volume of 2× loading buffer was added, mixed thoroughly, and electrophoresis was performed on a 15% denaturing polyacrylamide gel.

[0086] The binding affinity of theophylline and 3-methylxanthine to the allosteric DNA ribozyme was quantitatively analyzed. The grayscale value of the sheared bands was measured using ImageJ software, and the equilibrium dissociation constant K was obtained using GraphPad Prism software. D Value, K D The values ​​were determined by three replicate PAGE gels, and the specific results are shown in Figure 2. Figure 6 shown.

[0087] (10) Analysis of the enzymatic cleavage rates of allosteric DNA ribozymes II-T-6, II-T-5, and II-T-10: Taking three representative allosteric DNA ribozymes II-T-6, II-T-5, and II-T-10 as examples, the effects of different ligands on the enzymatic cleavage rates of the three representative allosteric DNA ribozymes at different time periods were designed. The grayscale values ​​of the cleavage bands were measured using ImageJ software, and the apparent rate constant k was obtained using GraphPadPrism software. obs value.

[0088] The specific steps are as follows:

[0089] Theophylline, 3-methylxanthine, and caffeine were used as ligands to study whether the cleavage rate of allosteric DNA ribozymes was increased after induction by theophylline, 3-methylxanthine, and caffeine. Therefore, different incubation times were set. In the different ligand-induced experimental reaction systems, the final concentration of the ligand was 0.25 mM, and Zn 2+ The final concentration of 1 mM was 20 μL. The specific information of the reaction system is shown in Table 7.

[0090] Table 7 Different ligand-induced allosteric DNA ribozyme II-T-6 enzyme digestion reaction system

[0091]

[0092] After thorough mixing, incubate at 37°C for 0 min, 1 min, 2.5 min, 5 min, 10 min, 20 min, 40 min, and 80 min, respectively. After incubation, add an equal volume of 2× loading buffer, mix thoroughly, and perform 15% denaturing polyacrylamide gel electrophoresis.

[0093] The effects of different ligands on the cleavage rate of allosteric DNA ribozymes at different time periods were quantitatively analyzed. The grayscale value of the cleavage band was measured using ImageJ software, and the apparent rate constant k was obtained using GraphPad Prism software. obs value, k obs The values ​​were determined by three replicate PAGE gels, and the specific results are shown in Figure 2. Figure 7 shown.

[0094] (11) Construction of theophylline allosteric DNA ribozyme biosensor labeled with fluorescent group (FAM) and quenching group (BHQ 1) and signal detection: Allosteric DNA ribozyme II-T-6 (e.g., 5′-terminal FAM labeling and 3′-terminal BHQ 1 modification) with fluorescent group (FAM) and quenching group (BHQ 1) was synthesized by Genewiz (Suzhou, China). Figure 3As shown). The prepared fluorescent biosensor allosteric DNA ribozyme II-T-6 was reacted with the target ligand (theophylline) at 37°C for 60 min, and the reaction mixture was quantitatively analyzed by urea denaturing PAGE gel electrophoresis and fluorescence intensity, or transferred to a 96-well plate for fluorescence measurement using a Varioskan Lux microplate reader (excitation at 480 nm and emission at 520 nm). For 96-well plate measurements, background fluorescence (from the buffer containing the ligand) was subtracted from the total fluorescence signal. Finally, K was calculated using GraphPad software. D and k obs value.

[0095] The specific steps are as follows:

[0096] 1) Binding affinity of fluorescent biosensors

[0097] a. A concentration gradient was designed for shear experiments. The experimental system set up was the binding affinity experimental system of the allosteric DNA ribozymes II-T-6, II-T-5, and II-T-10 (the allosteric DNA ribozymes were replaced with fluorescent biosensors). The cells were incubated at 37°C for 60 minutes. After electrophoresis on a 15% denaturing polyacrylamide gel, the fluorescent grayscale value of the remaining precursor was measured using ImageJ software, and the equilibrium dissociation constant K was obtained using GraphPad Prism software. D Value, K D Values ​​were determined from triplicate PAGE gels.

[0098] b. The reaction system was modified according to step a, and the liquid phase after the reaction was transferred to a 96-well plate for fluorescence measurement. The background fluorescence (from the buffer containing the ligand) was subtracted from the total fluorescence signal using a Varioskan Lux microplate reader (excitation at 480 nm and emission at 520 nm). Finally, K was calculated using GraphPad software. D The linear range of the curve (0-3 μM theophylline) was calculated, including R 2 The specific results are as follows Figure 8 shown.

[0099] 2) Binding affinity of fluorescent biosensors in urine

[0100] a. Using 1%-5% urine as the background condition, prepare 3 mM, 1 mM, 0.3 mM, 0.1 mM, 0.03 mM, 0.01 mM, and 0.003 mM theophylline solutions. Set the total system to a 20 μL reaction system. Specific information is shown in Table 7 below.

[0101] Table 7 Binding affinity assay reaction system for allosteric DNA ribozyme II-T-6 in urine

[0102]

[0103]

[0104] After thorough mixing, the final concentration of theophylline solution in 1%-5% urine was adjusted to 300μM, 100μM, 30μM, 10μM, 3μM, 1μM, 0.3μM, and 0.1μM. The solution was incubated at 37°C for 60 minutes. After incubation, an equal volume of 2× loading buffer was added, mixed thoroughly, and electrophoresis was performed on a 15% denaturing polyacrylamide gel.

[0105] The binding affinity of theophylline to allosteric DNA ribozyme II-T-6 in 1%-5% urine was quantitatively analyzed. The grayscale value of the sheared bands was determined using ImageJ software, and the equilibrium dissociation constant K was obtained using GraphPad Prism software. D Value, K D Values ​​were determined from triplicate PAGE gels.

[0106] b. Analysis of the binding affinity of theophylline to the fluorescent biosensor in 1% urine. After replacing the allosteric DNA ribozyme II-T-6 in step a with a fluorescent biosensor, the reaction was carried out according to the experimental system set up in step 1. The mixture was incubated at 37°C for 60 min. After electrophoresis on a 15% denaturing polyacrylamide gel, the fluorescent grayscale value of the remaining precursor was measured using ImageJ software, and the equilibrium dissociation constant K was obtained using GraphPad Prism software. D Value, K D Values ​​were determined from triplicate PAGE gels.

[0107] c. The reaction system modified in step b was used to react, and the reaction solution in 1% urine was transferred to a 96-well plate for fluorescence measurement. The background fluorescence (from the buffer containing the ligand) was subtracted from the total fluorescence signal using a Varioskan Lux microplate reader (excitation at 480 nm and emission at 520 nm). Finally, K was calculated using GraphPad software. D The linear range of the curve (0-3 μM theophylline) was calculated, including R 2 The specific results are as follows Figure 9 shown.

[0108] The above description is merely a preferred embodiment of the present invention and therefore cannot be used to limit the scope of the present invention. In other words, equivalent changes and modifications made within the scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. An allosteric DNA ribozyme, characterized in that: The nucleotide sequence thereof is selected from SEQ ID NO.01 to SEQ ID NO.

10.

2. Use of the allosteric DNA ribozyme according to claim 1 in preparing a fluorescent biosensor for theophylline detection, characterized in that: The 5' end of the allosteric DNA ribozyme is labeled with a fluorescent group, and the 3' end is labeled with a corresponding quenching group.

3. The use according to claim 2, characterized in that: The fluorescent group is FAM, and the quenching group is BHQ1.

4. A fluorescent biosensor for theophylline detection, characterized in that: The allosteric DNA ribozyme according to claim 1 is characterized in that its 5' end is labeled with a fluorescent group and its 3' end is labeled with a corresponding quenching group.

5. A fluorescent biosensor for detecting theophylline according to claim 4, characterized in that: The fluorescent group is FAM, and the quenching group is BHQ1.

6. Use of the theophylline detection fluorescent biosensor according to claim 4 or 5 in detecting theophylline in urine.

7. A method for detecting theophylline in urine, characterized in that: The method is carried out using the theophylline detection fluorescent biosensor according to claim 4 or 5.

Images