Use of walnut snp loci in detecting and / or identifying walnut high oleic trait

By detecting the SNP sites of the walnut JrFAD2-1 gene, especially SNP1 and SNP2, the problem of oxidative rancidity in walnut oil was solved, enabling rapid identification of high oleic acid traits and molecular marker-assisted breeding, thereby improving the quality and nutritional value of walnut oil.

CN120719055BActive Publication Date: 2025-12-23INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511235222.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-01
Publication Date
2025-12-23
Estimated Expiration
2045-09-01

AI Technical Summary

Technical Problem

Walnut oil contains mainly polyunsaturated fatty acids, which lead to oxidative rancidity, affecting its quality and nutritional value. Furthermore, the variation of high oleic acid has not yet been analyzed, and there is a lack of molecular marker-assisted breeding methods.

Method used

By detecting and identifying SNP sites, especially SNP1 and SNP2 sites, of the walnut JrFAD2-1 gene, and using specific primer pairs and kits, rapid and accurate identification and breeding of the high oleic acid trait in walnuts can be achieved.

Benefits of technology

It provides a rapid and accurate method to predict the oleic acid content of walnut germplasm, enabling molecular marker-assisted breeding of high oleic acid traits, increasing oleic acid content, and extending the shelf life of walnut oil.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120719055B_ABST
    Figure CN120719055B_ABST
Patent Text Reader

Abstract

The present application relates to the application of walnut SNP sites in detecting and / or identifying walnut high oleic acid traits, and belongs to the technical field of molecular biology. The present application provides the application of walnut SNP sites in detecting and / or identifying walnut high oleic acid traits, wherein the walnut SNP sites include SNP1 site and / or SNP2 site. The SNP1 site provided by the present application can be used as a molecular marker for high oleic acid walnut germplasm breeding, and the differentiation of high oleic acid phenotype is converted into the judgment of genotype, and then the genotype of the molecular marker is detected to realize the rapid and accurate prediction of the traits of the walnut germplasm to be detected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to the application of walnut SNP sites in the detection and / or identification of the high oleic acid trait in walnuts. Background Technology

[0002] Walnut( Juglans regia Walnuts are an important woody oilseed tree species, with an oil content of 52%–70%, ranking first among woody oilseeds. Walnut oil is rich in unsaturated fatty acids such as oleic acid, linoleic acid, and α-linolenic acid, possessing abundant nutritional value. However, because the unsaturated fatty acids in walnut oil are mainly polyunsaturated fatty acids, particularly linoleic acid (52%–65%), it is prone to oxidative rancidity during processing and storage. This leads to a decrease in the quality and nutritional value of walnut oil, a shortened shelf life, and the potential toxicity of these oxidation products, which may be harmful to human health. Oleic acid, as a monounsaturated fatty acid, has stronger oxidative stability than linoleic acid. It is less sensitive to oxidation during processing, storage, transportation, and frying, meeting the needs of the food processing industry and extending shelf life. Therefore, increasing the oleic acid content in oilseed crops has always been an important breeding goal for oilseed crops.

[0003] FAD2 The gene-encoded oleic acid dehydrogenase is the core rate-limiting enzyme in the conversion of oleic acid to linoleic acid. Disruptive mutations in this enzyme can increase oleic acid content and decrease linoleic acid content. In oilseed crops such as soybeans, rapeseed, and peanuts, targeted mutations... FAD2 Natural gene variation, genetic transformation, and gene editing have yielded a large number of high-oleic acid germplasm. Identifying functional haplotypes affecting oleic acid content and developing corresponding molecular markers for hybridization breeding remains the primary method for obtaining high-oleic acid germplasm. Woody oilseed trees have a longer growth period compared to oil crops such as soybeans, rapeseed, and peanuts; early marker-assisted selection is key to shortening the breeding cycle. However, the high-oleic acid variation in walnuts remains unresolved, leaving research on molecular markers related to high-oleic acid in walnuts still in its infancy. Our research group previously identified Chr13 as the major gene controlling the difference in oleic and linoleic acid content in walnut germplasm through genome-wide association analysis (GWAS). JrFAD2-1 Genes. Therefore, there is an urgent need to explore them. JrFAD2-1 The functional haplotype of the gene was determined, providing a basis for marker-assisted breeding of high oleic acid. Summary of the Invention

[0004] Based on the deficiencies in the prior art, the purpose of this invention is to provide the application of walnut SNP sites in the detection and / or identification of high oleic acid traits in walnuts, so as to fill the research gap in the field of high oleic acid variation in walnuts.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] The application provides application of a walnut SNP site in detection and / or identification of a walnut high-oleic trait, and the walnut SNP site comprises an SNP1 site and / or an SNP2 site.

[0007] The SNP1 site is located at the 269th nucleotide of a walnut JrFAD2-1 gene, is located at the 27107770th nucleotide of Zhongmucha-1 walnut reference genome Chr13, and the allele is A / G.

[0008] The SNP2 site is located at the 327th nucleotide of a walnut JrFAD2-1 gene, is located at the 27107828th nucleotide of Zhongmucha-1 walnut reference genome Chr13, and the allele is T / A.

[0009] The walnut JrFAD2-1 gene has a nucleotide sequence as shown in SEQ ID NO. 11.

[0010] Preferably, the genotype of the SNP1 site is AA, AG or GG, and the oleic acid content of the genotype AA or AG is higher than that of the genotype GG.

[0011] The genotype of the SNP2 site is TT, TA or AA, and the oleic acid content of the genotype TT or TA is higher than that of the genotype AA.

[0012] Preferably, the SNP1 site and the SNP2 site constitute an SNP1-SNP2 linkage site.

[0013] The application further provides a primer pair for detecting the walnut SNP site, comprising a DNABoxI-F primer and a DNABoxI-R primer.

[0014] The nucleotide sequence of the DNABoxI-F primer is shown in SEQ ID NO. 9.

[0015] The nucleotide sequence of the DNABoxI-R primer is shown in SEQ ID NO. 10.

[0016] The walnut SNP site comprises the SNP1 site and / or the SNP2 site.

[0017] The application further provides application of the primer pair in preparation of a product for detecting the walnut SNP site.

[0018] The application further provides a kit for detecting a walnut SNP site, and the walnut SNP site comprises an SNP1 site and / or an SNP2 site.

[0019] The kit comprises the primer pair.

[0020] The application also provides the walnut JrFAD2-1 gene.

[0021] The application also provides a primer set for detecting and / or identifying the splice variant, comprising a UTR Iso-F primer and a UTR Iso-R primer.

[0022] The nucleotide sequence of the UTR Iso-F primer is shown as SEQ ID NO. 5.

[0023] The nucleotide sequence of the UTR Iso-R primer is shown as SEQ ID NO. 6.

[0024] The application also provides the primer pair, the kit, the splice variant, and the primer set for use in any one of (1)-(5) below:

[0025] (1) detecting and / or identifying the walnut high oleic acid trait;

[0026] (2) determining the walnut oleic acid content;

[0027] (3) breeding walnut single plants, strains, lines or varieties with the high oleic acid trait;

[0028] (4) walnut breeding;

[0029] (5) preparing a product for detecting and / or identifying the walnut high oleic acid trait.

[0030] The application has the following technical effects and advantages:

[0031] The application shows that the walnut JrFAD2-1 The SNP1 site variation of the 5' UTR intron 3' splicing site of the walnut FAD2-4C gene is significantly related to the oleic acid and linoleic acid content in walnut germplasm, the oleic acid content of walnut germplasm with the SNP1 site variation of AA and AG genotypes is significantly higher than that of walnut germplasm without the SNP1 site variation of GG genotype, and the genotype and phenotype are highly consistent in the population;

[0032] The SNP1 site provided by the application can be used as a molecular marker for breeding walnut germplasm with high oleic acid, and the differentiation of the high oleic acid phenotype is converted into the determination of the genotype, and then the genotype of the molecular marker is detected to quickly and accurately predict the traits of the walnut germplasm to be tested. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 The walnut FAD2-4C gene JrFAD2-1 SNP1 site variation comparison results of the 5' UTR intron 3' splicing site of the walnut FAD2-4C gene

[0034] Figure 2 The walnut FAD2-4C geneJrFAD2-1 Gene structure schematic diagram

[0035] Figure 3 For walnut JrFAD2-1 The proportion of different alleles of SNP1 at the 5'UTR intron 3' splicing site of the gene in 815 walnut germplasms

[0036] Figure 4 For the oil and linoleic acid content of 280 walnut germplasms

[0037] Figure 5 For the genotype identification result based on walnut kernel cDNA

[0038] Figure 6 For walnut JrFAD2-1 The LD Block identification result corresponding to SNP1 at the 5'UTR intron 3' splicing site of the gene

[0039] Figure 7 For the genotype identification result of 18 walnuts based on walnut kernel cDNA

[0040] Figure 8 For walnut JrFAD2-1 The abnormal splicing of walnut caused by SNP1 at the 5'UTR intron 3' splicing site of the gene JrFAD2-1

[0041] Figure 9 For the genotype identification result based on walnut JrFAD2-1 The identification result of high-oleic walnut germplasms caused by the variation of SNP1 at the 5'UTR intron 3' splicing site of the gene. DETAILED DESCRIPTION

[0042] The technical solutions provided by the present application will be described in detail below in combination with the embodiments, but they should not be understood as limiting the scope of protection of the present application.

[0043] In the test materials of the present application, the X2-178 strain in the walnut offspring population of the Xin Xin 2 variety comes from a walnut orchard of a hybrid population in Yixian County, Hebei Province, the high-oleic single plant E6S5, the Za 343 variety walnut and the Wen 185 variety walnut come from the Xinjiang Jiamu Walnut Germplasm Resource Orchard;

[0044] In the reagents of the present application, the high-efficiency plant genomic DNA extraction kit and the RNA Easy Fast plant RNA rapid extraction kit are purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd., the PrimeScript FAST RT reagent Kit with gDNA Eraser is purchased from Takara Company, Japan, and the FastDigest BoxI is purchased from Thermo Fisher Scientific Company, USA. ​

[0045] Example 1: Juglans regia L. JrFAD2-1 Obtaining of 5' UTR intron splicing site variation of gene

[0046] X2-178 strain of the new Xinxin 2 variety walnut offspring population was used as the material, genomic DNA was extracted using a high-efficiency plant genomic DNA extraction kit, and a walnut JAG1 gene 5' UTR intron was amplified by PCR using a walnut Zhongmucha-1 reference genome (J. regia genome v1.0) as a reference. J regia JrFAD2-1 Primer for 5' UTR intron of gene JrFAD2-1 UTR+Intron-F / R, and was synthesized by Shengong Bioengineering (Shanghai) Co., Ltd., and the nucleotide sequences of the primers are shown in Table 1.

[0047] The PCR amplification system was 20 μL, including TaKaRa high-fidelity amplification enzyme mixture PrimeSTAR 10 μL, genomic DNA 1 μL, JrFAD2-1 UTR+Intron-F primer (10 μmol / L) 1 μL, JrFAD2-1 UTR+Intron-R primer (10 μmol / L) 1 μL, and the rest was sterile ddH2O; the PCR amplification conditions were: 98°C pre-denaturation for 3 min, followed by 98°C denaturation for 10 s→56°C annealing for 5 s→72°C extension for 2 min, a total of 35 cycles, and finally 72°C extension for 10 min, to obtain the 5' UTR intron of the walnut JAG1 gene. JrFAD2-1 The 5' UTR intron of the walnut JAG1 gene was sent to Beijing Qikexin Biotechnology Co., Ltd. for Sanger sequencing, and the results are shown in Figures 1-2 JrFAD2-1 The nucleotide sequence of the 5' UTR intron of the walnut JAG1 gene is shown in SEQ ID NO. 3.

[0048] SEQ ID NO. 3:

[0049] ​​

[0050] Table 1 Primer sequences for amplifying various nucleic acid molecules

[0051]

[0052] The results showed that the X2-178 strain in walnut... JrFAD2-1 A SNP site, labeled SNP1, exists at the 3' splice site of the 5' UTR intron of the gene, specifically located at 1962 bp of SEQ ID NO. 3. SNP1 can cause the AG mutation at the original 3' splice site to be changed to AA.

[0053] Example 2: Walnut JrFAD2-1 Population proportion analysis of SNPs at 3' splicing sites of 5'UTR introns of genes

[0054] SNP loci were extracted from 815 walnut germplasm SNP maps (GVM000177) previously uploaded to the National Genome Science Data Center in the Chr13 walnut genome. JrFAD2-1 The SNP variation information between 27105812 and 27109187 bp in the 5'UTR intron of the gene is shown in the following results. Figure 3 As shown.

[0055] The results showed that the SNP1 locus is located at position 27,107,770 of Chr13 in the Zhongmucha-1 walnut reference genome. Among 815 walnut germplasms, homozygous variants accounted for 0.37%, heterozygous variants accounted for 13.25%, and the remaining walnut germplasms showed no variation. This indicates that the variation at the SNP1 locus is a rare variation in the walnut population.

[0056] Example 3: Walnut JrFAD2-1 Identification of high oleic acid phenotype by SNP variation at the 3' splice site of the 5'UTR intron of a gene

[0057] Our research group previously identified [a specific type of walnut]. JrFAD2-1 A variation at the SNP position 27108275 of gene Chr13 can affect the oleic acid and linoleic acid content of walnuts. Therefore, to exclude the influence of this SNP variation, the genotypes of 280 walnut germplasms at the SNP1 locus were analyzed from 815 publicly available oleic acid and linoleic acid content data. The results are as follows: Figure 4 As shown.

[0058] The results showed that 10 out of 159 walnut germplasm accessions were in walnut... JrFAD2-1The heterozygous variant genotype was observed at the SNP1 site, the 3' splice site of the 5'UTR intron, while the remaining 149 copies showed a homozygous non-variant genotype. This indicates that the heterozygous variant genotype had significantly higher oleic acid content and significantly lower linoleic acid content than the homozygous non-variant genotype.

[0059] Example 4: Walnut JrFAD2-1 Abnormal splicing caused by SNP variation at the 3' splice site of the 5'UTR intron of a gene

[0060] 815 walnut germplasm accessions in walnut JrFAD2-1 Haplotype analysis of SNPs in gene Chr13 between positions 27105812 and 27109187 bp revealed that SNP1 at position 27107770 of the Zhongmucha-1 walnut reference genome, along with five nearby SNPs, is located in LD Block 8 and is highly linked to SNP2 at position 27107828 of Chr13. Box Ⅰ. Specific restriction enzyme sites can be used to identify the genotype of walnut kernel cDNA;

[0061] RNA was extracted from 18 walnut kernels of the Xinxin 2 variety using the RNA Easy Fast Plant RNA Rapid Extraction Kit. cDNA was synthesized using the PrimeScript FAST RT reagent Kit with gDNA Eraser. The cDNA was then amplified using a walnut reference genome designed based on the Zhongmucha-1 walnut genome. JrFAD2-1 Primers for internal segments of gene mRNA JrFAD2-1 -UTRBoxⅠ-F / R, and was commissioned to Sangon Biotech (Shanghai) Co., Ltd. to synthesize the primers. The nucleotide sequences of each primer are shown in Table 1.

[0062] The PCR amplification system, in 20 μL volumes, includes 10 μL of TaKaRa high-fidelity amplification enzyme mixture PrimeSTAR, 1 μL of cDNA, JrFAD2-1 -UTRBoxⅠ-F primer (10μmol / L) 1μL, JrFAD2-1 - 1 μL of UTRBoxⅠ-R primer (10 μmol / L) and the remaining sterile ddH2O; PCR amplification conditions were: 98℃ pre-denaturation for 3 min, followed by 98℃ denaturation for 10 s → 56℃ annealing for 5 s → 72℃ extension for 5 s, for a total of 33 cycles, and a final extension at 72℃ for 10 min to obtain walnuts. JrFAD2-1 The internal fragments of the gene mRNA were then digested using FastDigest Box I enzyme. The digestion system was set as follows: walnut JrFAD2-1The nucleotide sequence of the internal fragment of the mRNA of the gene is shown as SEQ ID NO. 4. Figures 5-7 As shown in the figure, the walnut JrFAD2-1 The nucleotide sequence of the internal fragment of the mRNA of the gene is shown as SEQ ID NO. 4.

[0063] SEQ ID NO. 4:

[0064] CTGCTAGAATTGCTTTCTGGTTAAGAGCTTCTATATCTCCTGGATTGCACATAGGCTGGCATTATTGGAAAACCAACAATGGGTGCCGGAGCCCAAATGACTGTCGTCAACAAGAGTGAAGAACAGAAAGCCACTCTCCAGCGAGTGCCACACACAAAGCCTCCATTCACACTTAGCCAACTTAAGAAAGCCATCCCACCACACTGTTTCCAACGTTCCCTCTTCCGCTCATTCTCCTAT

[0065] The results show that among the 18 walnuts, 1 is a homozygous variant genotype at the 3' splice site SNP1, showing that the fragment is completely uncut, 5 are heterozygous variant genotypes at the 3' splice site SNP1, showing that the fragment is partially cut and has an abnormal splicing band, and the rest are homozygous non-variant genotypes, showing that the fragment is completely cut and does not contain an abnormal splicing band.

[0066] Example 5: Walnut JrFAD2-1 Identification of splicing variant types caused by SNP variation of 5' UTR intron 3' splice site of walnut gene

[0067] Primer for identifying splicing variant types designed with reference to Zhongmucha-1 walnut reference genome JrFAD2-1 -UTRIso-F / R, and entrusted with the synthesis by Shengong Bioengineering (Shanghai) Co., Ltd., and the nucleotide sequences of the primers are shown in Table 1;

[0068] The PCR amplification system is 20 μL, including TaKaRa high-fidelity amplification enzyme mixture PrimeSTAR 10 μL, cDNA 1 μL, JrFAD2-1 -UTRIso-F primer (10 μmol / L) 1 μL, JrFAD2-1-UTR Iso-R primer (10 μmol / L) 1 μL and the rest sterile ddH2O; PCR amplification conditions: 98°C pre-denaturation for 3 min, followed by 98°C denaturation for 10 s→ 60°C annealing for 5 s→ 72°C extension for 40 s, a total of 35 cycles, finally 72°C extension for 10 min, to obtain the amplification product, and electrophoresis detection, the results are shown in Figure 8 .

[0069] The results show that specific bands of uncut and mis-cleavage can be amplified from the cDNA containing 3' cleavage site SNP1.

[0070] Example 6: Identification of SNP variation of 5' UTR intron 3' cleavage site of walnut gene based on high oleic acid walnut germplasm JrFAD2-1

[0071] The high oleic acid single plant E6S5, Za343 and Wen185 were used as the walnut germplasm to be detected, and the high-efficiency plant genomic DNA extraction kit was used to extract the walnut germplasm DNA. The primers for identifying high oleic acid walnut germplasm were designed according to Zhongmachua-1 walnut reference genome JrFAD2-1 -DNABox I-F / R, and the company Shengong Bioengineering (Shanghai) Co., Ltd. was entrusted to synthesize, and the nucleotide sequences of the primers are shown in Table 1;

[0072] The PCR amplification system was 20 μL, including TaKaRa high-fidelity amplification enzyme mixture PrimeSTAR 10 μL, each walnut germplasm 1 μL, JrFAD2-1 -DNABox I-F primer (10 μmol / L) 1 μL, JrFAD2-1 - DNABox I-R primer (10 μmol / L) 1 μL and the rest sterile ddH2O; PCR amplification conditions: 98°C pre-denaturation for 3 min, followed by 98°C denaturation for 10 s→ 58°C annealing for 5 s→ 72°C extension for 10 s, a total of 35 cycles, finally 72°C extension for 10 min, to obtain the DNA molecule (as shown in SEQ ID NO. 11), and then use FastDigest BoxI for enzyme digestion, set the enzyme digestion system as: DNA molecule 10 μL, FastDigest BoxI 1 μL, 10×FastDigest Buffer 1 μL, and the enzyme digestion program is 37°C for 15 min; After enzyme digestion, electrophoresis detection was performed, and the results are shown in Figure 9 .

[0073] SEQ ID NO. 11:

[0074] ​GACTCGTACATGTTGGCTGGAAAGAAATTCCACTTGCTCTAGAGTTCATTGGCTGCAATTGCCTGTTATATTGCTTATCTTGTTTTGGTGTTGAGAATTCCTCAATAAATTTGTATGCCACTCAATTTCTATCTACATATATCAGTTAGTAAACCTGACTCTGAAACTGTCTTTCAGCCACACCATCTTGAAGATCGATTTTGTTTTTCATCTGTGTCTCGGCGTTTTACCTAGATAGCAACTTAATTTGTCACATTGACTGTTTTCAGGATTGCACATAGGCTGGCATTATTGGAAAACCAACAATGGGTGCCGGAGCCCAAATGACTGTCGTCAACAAGAGTGAAGAACAGAAAGCCACTCTCCAGCGAGTGCCACACACAAAGCCTCCATTCACACTTAGCCAACTTAAGAAAGCCATCCCACCACACTGTTTCCAACGTTCCCTCTTCCGCTCATTCTCCTATGTTGCTTACGACCTCTTCTTCGCCTTCCTCTTCTACTACATTGCTACCTCTTACTTCCACCTCCTCCCTCAC

[0075] The results show that the walnut germplasm of the high-oleic single strain E6S5 which is not digested by the enzyme is homozygous variation type at the SNP1 variation site, and the walnut germplasm of the Zha343 strain which is partially digested by the enzyme is heterozygous variation type at the SNP1 variation site, and both correspond to the high-oleic property; the walnut germplasm of the Wen185 strain which is completely digested by the enzyme is homozygous non-variation type at the SNP1 variation site, and corresponds to the low-oleic property.

[0076] It can be known from the above examples that the application provides the application of the walnut SNP site in detection and / or identification of the high-oleic property of the walnut. The SNP1 site provided by the application can be used as a molecular marker and applied to the breeding of the high-oleic walnut germplasm, and the discrimination of the high-oleic phenotype is converted into the judgment of the genotype, and then the genotype of the molecular marker is detected to realize the rapid and accurate prediction of the property of the walnut germplasm to be detected.

[0077] The above only describes the preferred embodiments of the application, and it should be noted that, for those skilled in the art, some improvements and refinements can be made without departing from the principles of the application, and these improvements and refinements should also be considered as the protection scope of the application.

Claims

1. Use of a walnut SNP locus in detecting and / or identifying a walnut high oleic acid trait, characterized in that, The walnut SNP site includes SNP1 site and / or SNP2 site; The SNP1 site is located at the 269th position of the walnut JrFAD2-1 gene, and the allele is A / G; The SNP2 site is located in the 327th position of the walnut JrFAD2-1 gene, and the allele is T / A; The walnut JrFAD2-1 The nucleotide sequence of the gene is shown as SEQ ID NO. 11; The genotype of the SNP1 site is AA, AG, GG, and the oleic acid content of the genotype AA or AG is higher than that of the genotype GG; The genotype of the SNP2 site is TT, TA, AA, and the oleic acid content of the genotype TT or TA is higher than that of the genotype AA.