Application of CC chemokine receptor 7 inhibitor in preparation of medicine for treating cardiac hypertrophy

Abstract

The invention discloses application of a CC chemokine receptor 7 inhibitor in preparation of a medicine for treating cardiac hypertrophy. The CC type chemokine receptor 7 (chemokine (C-C motif) ligand 7, CCL7) inhibitor comprises a reagent which can be used for inhibiting the expression of a CCL7 gene at the transcription or translation level of the CCL7 gene. Preferably, the CC chemokine receptor 7 inhibitor comprises siRNA (small interfering Ribonucleic Acid), shRNA (short hairpin Ribonucleic Acid), a carrier or a virus containing the siRNA / shRNA, and an antibody of CCL7. According to the application disclosed by the invention, a new function of the CCL7 is found, that is, the CCL7 has an effect of worsening myocardial hypertrophy; the invention further provides application of the CC chemokine receptor 7 as a drug target in screening of drugs for preventing, relieving and / or treating cardiac hypertrophy and application of a CCL7 inhibitor in preparation of drugs for preventing, relieving and / or treating cardiac hypertrophy. The invention provides a new technical means for preventing, relieving and / or treating cardiac hypertrophy.

Description

Technical Field

[0001] The present invention relates to the use of CC chemokine receptor 7 inhibitors in the preparation of drugs for preventing, alleviating, and / or treating myocardial hypertrophy. It also relates to the use of CC chemokine receptor 7 as a drug target in screening drugs for preventing, alleviating, and / or treating myocardial hypertrophy. This invention belongs to the technical field of gene functions and applications. Background Art

[0002] Hypertrophic cardiomyopathy (HCM) is an adaptive response of the myocardium to various physiological and pathological stimuli and a common pathological process in hypertension, valvular disease, and congenital heart disease. The progressive development of ventricular hypertrophy is accompanied by myocardial fibrosis and dysfunction, ultimately leading to pathological ventricular remodeling and heart failure. However, the pathogenesis of HCM remains unclear, and currently, there are no effective clinical treatments. Therefore, the identification of specific molecules and signaling pathways that block HCM is of great theoretical and clinical significance for further elucidating the pathogenesis of HCM and identifying drug targets for its prevention and treatment.

[0003] Myocardial hypertrophy is a complex, dynamic process regulated by multiple factors. Currently, the pathogenesis of myocardial hypertrophy remains incompletely elucidated. Studies have shown that chronic pressure and / or volume overload increases ventricular wall stress, leading to myocardial hypertrophy. Multiple extracellular stimuli, such as angiotensin II (AngII), endothelin (ET), catecholamines, and transforming growth factor-B (TGF-B), can trigger changes in nuclear gene expression, leading to cardiomyocyte hypertrophy. During cardiomyocyte hypertrophy, their phenotype changes, their volume increases, and the types of contractile proteins within the cardiomyocytes also change. At the molecular level, the pathological process of myocardial hypertrophy can be divided into three stages: the generation of extracellular hypertrophic stimuli, intracellular signal transduction, and nuclear gene transcriptional activation, ultimately leading to the phenotypic changes of hypertrophic cells. The calcineurin / NFAT, mitogen-activated protein kinase (MAPK), PI3K / Akt / GSK3β signaling pathways, along with their regulated downstream transcription factors such as MCIP1.4, NF-KB, AP-1, and MEF2, play a key role in the development and progression of cardiac hypertrophy. Calcineurin is a multifunctional signaling enzyme regulated by calcium and calmodulin (CaM). It promotes the translocation of nuclear factor of activated T cells (NFAT) into the nucleus, regulating the expression of nuclear hypertrophy genes (ANP and BNP), potentially inducing cardiac hypertrophy by modulating hypertrophic gene activation. Serine / threonine protein kinases (MAPKs) play a crucial role in the hypertrophic response mediated by various hypertrophic factors. These include the extracellular signal-regulated kinases (ERKs), c-jun N-terminal kinases (JNKs), and p38-MAPK subfamilies. The MAPK pathway is a cascade of three phosphorylating kinases that amplify extracellular signals and transmit them intracellularly. Phosphorylated MAPKs can activate transcriptional factors associated with cardiac hypertrophy, such as NF-κB, AP-1, MEF2, and NFAT, affecting cardiomyocyte gene transcription and protein synthesis, leading to cardiomyocyte hypertrophy. Activation of ERK1 / 2 is a key factor in regulating cardiomyocyte hypertrophy. Another important signaling pathway is the PI3K / Akt / GSK3B pathway. Activated PI3K can increase protein synthesis by activating AKT and its substrates mTOR and GSK3β, while inactivating Fox0, promoting transcription factor translocation, regulating hypertrophic genes, and inducing cardiomyocyte hypertrophy.

[0004] CC-type chemokine receptor 7 (CCL7), also known as monocyte chemoattractant protein (MCP)-3, is a chemokine for monocytes and neutrophils. CCL7 is secreted by endothelial cells, fibroblasts, macrophages, vascular smooth muscle cells, and bone marrow mononuclear cells and is a novel inflammatory mediator. CCL7 and its functional receptors, including CCR1, CCR2, CCR3, and CCR5, play a prominent role in the regulation of immune inflammation in various cardiovascular diseases. However, its role in the pathogenesis of human diseases, such as myocardial hypertrophy, remains unknown. Summary of the Invention

[0005] To address the deficiencies and shortcomings of existing technologies for the clinical prevention and treatment of myocardial hypertrophy, the primary objective of the present invention is to determine the relationship between CCL7 expression and myocardial hypertrophy and to provide a method for using CCL7 as a drug target in screening drugs for protecting cardiac function, combating cardiac fibrosis, and / or preventing, alleviating, and / or treating myocardial hypertrophy.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The present invention selects wild-type mice, injects CCL7 knockout virus (AAV9-CCL7) and its control virus (AAV9-NC) respectively for experiment, and each mouse is divided into sham operation group and operation group, each group of 20 mice. The operation group is given aortic arch coarctation surgery, and the sham operation group is not given aortic arch coarctation. Then, by measuring cardiac hypertrophy, fibrosis and cardiac function of each group of mice in the sham operation group and the operation group, the effect of CCL7 gene knockout on aortic arch coarctation surgery-induced myocardial hypertrophy is studied. The results show that CCL7 gene knockout significantly inhibits aortic arch coarctation surgery-induced myocardial hypertrophy and fibrosis, and protects cardiac function. Therefore, the CCL7 gene can be used as a drug target to construct an in vitro cell model or animal model of CCL7 gene knockout for screening drugs for preventing, alleviating and / or treating myocardial hypertrophic diseases; the CCL7 gene can also be used as a target gene in gene therapy to design and prepare drugs and / or biological reagents for preventing, alleviating and / or treating myocardial hypertrophic diseases, and achieve the purpose of preventing, alleviating and / or treating myocardial hypertrophic diseases through genetic engineering technology. For example, using CCL7 as the target gene, double-stranded siRNA that can interfere with CCL7 expression is designed. After being synthesized by chemical methods, it is injected into the human body to silence the CCL7 gene through RNA interference to treat myocardial hypertrophy. It is also possible to design and construct a mutant of CCL7, which enters the cell after injection and competes for the substrate of the original CCL7, thereby inhibiting the function of CCL7 and achieving the therapeutic purpose. In addition, small molecule compound inhibitors can be designed with CCL7 as the target, and using in vitro cell models or animal models with overexpression of the CCL7 gene, molecules that can specifically inhibit CCL7 can be found through screening, thereby providing new therapeutic molecules for the treatment of myocardial hypertrophy.

[0008] On the basis of the above research, the present invention proposes the use of CC chemokine receptor 7 inhibitors in the preparation of drugs for preventing, alleviating and / or treating myocardial hypertrophy.

[0009] Among them, preferably, the CC chemokine receptor 7 inhibitor includes an agent that can inhibit the expression of CCL7 gene at the transcription or translation level of CCL7 gene.

[0010] Among them, preferably, the inhibitors of CC chemokine receptor 7 include siRNA, shRNA, vectors or viruses containing the siRNA / shRNA, and CCL7 antibodies.

[0011] Among them, preferably, the inhibitor of CC chemokine receptor 7 is adeno-associated virus type 9 carrying CC chemokine receptor 7 shRNA.

[0012] Among them, preferably, the sequence of the CC chemokine receptor 7 shRNA is: 5'-ACGCCTAAGGAATGGTCTTTACTCGAGTAAAGACCATTCCTTAGGCGT-3'.

[0013] Furthermore, the present invention also proposes the use of CC chemokine receptor 7 as a drug target in screening drugs for preventing, alleviating and / or treating myocardial hypertrophy.

[0014] Among them, preferably, the drug can inhibit or reduce the expression of CC chemokine receptor 7.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] (1) The present invention discovered a new function of CCL7, namely, that CCL7 has the effect of exacerbating myocardial hypertrophy;

[0017] (2) Based on the function of CCL7 in exacerbating myocardial hypertrophy, it provides a target for developing drugs to prevent, alleviate and / or treat myocardial hypertrophy diseases.

[0018] (3) CCL7 inhibitors can be used to prepare drugs for preventing, alleviating and / or treating myocardial hypertrophy. The present invention provides a new technical means for preventing, alleviating and / or treating myocardial hypertrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the Real-time PCR result;

[0020] Figure 2 Injection of AAV9-CCL7 virus can significantly improve the cardiac remodeling phenotype induced by aortic arch constriction surgery in mice;

[0021] Among them, A is a representative image of the heart shape of the AAV9-Ctrl+Sham group, AAV9-Ctrl+TAC group, AAV9-CCL7+Sham group and AAV9-CCL7+TAC group; B, C are the HW / BW (mg / g) and HW / TL (mg / mm) ratios of the AAV9-Ctrl+Sham group, AAV9-Ctrl+TAC group, AAV9-CCL7+Sham group and AAV9-CCL7+TAC group, as well as the Real-time PCR results of CCL7; D is a representative HE staining image of the mouse heart of the AAV9-Ctrl+Sham, AAV9-Ctrl+TAC, AAV9-CCL7+Sham and AAV9-CCL7+TAC groups, as well as the histological analysis and cell cross-sectional area statistics of each group; E is the Real-time PCR analysis of ANP, BNP, and β-MHC mRNA expressions in the hearts of the AAV9-Ctrl+Sham, AAV9-Ctrl+TAC, AAV9-CCL7+Sham, and AAV9-CCL7+TAC groups;

[0022] Figure 3 Results of Masson staining and picrosirius red (PSR) staining;

[0023] Among them, A is the picrosirius red and Masson staining of heart sections in the AAV9-Ctrl+Sham, AAV9-Ctrl+TAC, AAV9-CCL7+Sham, and AAV9-CCL7+TAC groups, as well as the quantification of cardiac fibrosis area in each group; B is the real-time PCR analysis of Col1a1, Col3a1, and Fn1 mRNA expression in the hearts of the AAV9-Ctrl+Sham, AAV9-Ctrl+TAC, AAV9-CCL7+Sham, and AAV9-CCL7+TAC groups. The results showed that there was a large amount of collagen deposition and the transformation of cardiac fibroblasts into myofibroblasts in the myocardial tissue of mice in the aortic arch constriction surgery group. Injection of AAV9-CCL7 knockdown virus improved myocardial fibrosis induced by aortic arch constriction surgery and reduced the mRNA levels of Col1a1, Col1a3, and Fn1, myocardial fibrosis-related indicators, in mice with aortic arch constriction surgery.

[0024] Figure 4 The results of cardiac ultrasound;

[0025] The results showed that tail injection of AAV9-CCL7 virus could alleviate the significant decrease in cardiac ejection fraction (EF) and short-axis shortening rate (FS) in mice caused by aortic arch stenosis surgical modeling.

[0026] Figure 5Real-time PCR test results of the hearts of mice in each group;

[0027] The results showed that tail injection of AAV9-CCL7 virus could significantly alleviate the increased levels of IL-1β, IL-6 and MCP-1 mRNA in the mouse heart caused by aortic arch stenosis surgical modeling. DETAILED DESCRIPTION

[0028] The present invention will be described in further detail below with reference to the embodiments and accompanying drawings. However, the embodiments of the present invention are merely illustrative of the method of the present invention and are not intended to limit the remainder of the present invention in any way.

[0029] The experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual, 3rd edition (New York: Cold Spring Harbor Laboratory Press, 2005).

[0030] Example 1 Construction of AAV9-CCL7 virus and AAV9-NC virus

[0031] The present invention synthesizes shRNA sequences through vector information:

[0032] shRNA1:

[0033] ACGCCTAAGGAATGGTCTTTACTCGAGTAAAGACCATTCCTTAGGCGT;

[0034] shRNA2:

[0035] CATGCTGCTATGTCAAGAAACCTCGAGGTTTCTTGACATAGCAGCATG;

[0036] shRNA3:

[0037] TGTTATCTTCAAGACAAAGAACTCGAGTCTTTGTCTTGAAGATAACA.

[0038] NC:

[0039] ACCGGTGGGATCCTGTACACTTAAGGGGCCCGGTACCACGCGTCACGTCCATGgCATATGCTAGCGGCCGTTAATTAACACGTGGAGCTCGTCGACAATTGACTAGTTCTAGA

[0040] The backbone plasmid pAAV-U6-MCS-CMV-EGFP (purchased from Cytoxan) was digested with AgeI and XbaI to recover a 5505bp fragment. The shRNAs 1-3 and NC sequences were ligated to the recovered backbone plasmid using T4 ligase. The plasmids were then transformed and plated, and single colonies were selected to obtain the following four target plasmids:

[0041] pAAV-U6-mCcl7-shRNA1-CMV-EGFP-hGHpolyA

[0042] pAAV-U6-mCcl7-shRNA2-CMV-EGFP-hGHpolyA

[0043] pAAV-U6-mCcl7-shRNA3-CMV-EGFP-hGHpolyA

[0044] pAAV-U6-mCcl7-NC-CMV-EGFP-hGHpolyA

[0045] Subsequently, the above four target plasmids were transformed into competent bacteria for plasmid amplification and extraction. The extracted plasmids were transfected into mouse cell lines by electroporation. 48 hours or 72 hours after transfection, the cells were collected and lysed to extract total RNA. RT-qPCR was performed to detect the mRNA knockdown of the target gene. According to the RT-qPCR results, the pAAV-U6-mCcl7-shRNA1-CMV-EGFP-hGHpolyA with the highest knockdown efficiency was screened. At the same time, the screened plasmids and the control plasmid pAAV-U6-mCcl7-NC-CMV-EGFP-hGHpolyA were transfected into 293T cells simultaneously with the auxiliary plasmid (pHelper plasmid) and the AAV9 serotype plasmid. After 72 hours of transfection, the virus particles were harvested and then purified, concentrated, and the virus titer detected by qPCR was 3.50×10 13 GC / mL, the virus was named AAV9-CCL7, and the control virus was named AAV9-NC.

[0046] Example 2 Application of AAV9-CCL7 Virus in Treating Myocardial Hypertrophy

[0047] 1. Experimental Animals and Their Husbandry

[0048] 1.1 Experimental Animals

[0049] Wild-type male C57BL / 6 mice (named WT) aged 8-10 weeks and weighing 23.5-27.5 g were selected and injected into the tail of WT mice for 10 11vg / ml, 100μl dose of AAV9-CCL7 virus or AAV9-NC virus, and the aortic arch constriction surgery model (TAC) was established 4 weeks later. The samples were collected 8 weeks after the aortic arch constriction surgery mice were modeled.

[0050] 1.2 Rearing environment

[0051] All experimental mice were housed in the SPF-grade experimental animal center at the Qunli Campus of the First Affiliated Hospital of Harbin Medical University. SPF-grade mouse feed was purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. Housing conditions included a room temperature between 22-24°C, a humidity between 40-70%, a 12-hour light-dark cycle, and free access to food and water.

[0052] 1.3 Experimental Grouping

[0053] ①AAV9-NC+Sham group of mice; ②AAV9-NC+TAC group of mice; ③AAV9-CCL7+Sham group of mice; ④AAV9-CCL7+TAC group of mice

[0054] 2. Establishing a Myocardial Hypertrophy Model Using Aortic Arch Stenosis Surgery

[0055] 2.1 Preoperative preparation

[0056] (1) Anesthesia: Weigh the mouse first, calculate the required amount of anesthetic (3% sodium pentobarbital) at 90 mg / kg body weight, and inject it intraperitoneally. Record the injection time. Successful anesthesia is determined by the absence of noticeable reactions to tail or toe clamping and the mouse being in good condition (generally, no noticeable reaction occurs approximately 10 minutes after injection, and a toe clamping reaction occurs approximately 50 minutes after anesthesia. The optimal surgical time is approximately 30 minutes after anesthesia).

[0057] (2) Preparation of the surgical area: Remove the hair from the left chest, left thorax, and left forelimb of the mouse. After shaving, wipe the surgical area with wet gauze to remove the hair without affecting the surgical field of view.

[0058] (3) Intubation: Use a rubber band to secure the mouse's upper incisors to the slope of the V-shaped plate, and quickly insert the endotracheal tube accurately through the glottis into the trachea. Then, place the mouse in a right lateral position on a heating pad (the heating pad must be preheated in advance). Then, connect the endotracheal tube to the ventilator and secure the mouse. If the mouse's chest rise and fall is consistent with the ventilator frequency, it indicates that the endotracheal tube is successful.

[0059] 2.2 Descending aortic arch ligation

[0060] Take the right side decubitus position, with the left forelimb of the mouse placed above the right forelimb, and both forelimbs are fixed with medical tape. Cotton swabs are placed under the right chest, the chest is raised, and the skin of the surgical area is disinfected with iodine and 75% alcohol by volume in sequence. Ophthalmic forceps are held in the left hand to pinch the skin of the left chest, and ophthalmic scissors are held in the right hand to cut the skin about 1 cm, and muscles and soft tissues are separated in sequence. The chest cavity is opened at the 2nd-3rd rib level, and the left lung is slightly opened with cotton swabs. The descending aortic arch is freed, and 7-0 surgical sutures are passed through the blood vessels, and a 26G (25.0-27.5g mouse) or 27G (23.5-25.0g) syringe needle is placed parallel above the blood vessels. The blood vessels and needle are tied together, and then the needle is withdrawn to achieve the corresponding degree of vascular constriction. After ligation, suture is sutured in sequence, the chest cavity is closed, and a syringe is inserted into the chest cavity from the suture and 1cc of gas is withdrawn to restore the negative pressure in the chest cavity. The skin incision is quickly sutured after the syringe is withdrawn. In the sham operation group (Sham), after freeing the descending aorta, only threading was performed without ligation, and the rest of the steps were the same as those in the TAC model group.

[0061] 2.3 Postoperative Care

[0062] After ligation of the descending aortic branch, when the mice showed spontaneous breathing and a strong reaction to toe pinching, the endotracheal tube was removed and the mice were placed in a cage containing autoclaved bedding, feed and drinking water and continued to be raised and observed in the breeding room.

[0063] 3. Get materials

[0064] (1) Preliminary work: Prepare a urine cup filled with 20 mL of 10% formaldehyde and label it with mouse number, group, surgery type, and date of collection. Place a Petri dish filled with 10% KCl solution at the collection site. Turn on the analytical balance and adjust it to zero. Weigh and sacrifice the mouse.

[0065] (2) Sampling: Use ophthalmic curved forceps to grasp the vascular pedicle below the auricle, cut the heart, and quickly place it in a 10% KCl solution. After the heart stops beating and is in diastole, place it on sterile gauze. Gently squeeze the fluid in the cardiac cavity, wipe off the surface liquid, weigh it, and record the weight. Place the heart in a corresponding urine cup and fix it for 48 hours before pathological examination.

[0066] (3) Related measurements and calculations: Remove the mouse lungs, trim them, blot them dry with filter paper, weigh them, and record their weight. Cut the skin at the tibia of the mouse hind limb, and measure and record the tibia length. Calculate the ratio of heart weight to body weight (HW / BW), the ratio of lung weight to body weight (LW / BW), and the ratio of heart weight to tibia length (HW / TL).

[0067] 4. Pathological testing

[0068] 4.1 Preparation of paraffin specimen sections

[0069] The main operating procedures include trimming the heart → embedding frame processing → running water rinsing → dehydration → transparency → wax dipping → embedding → slicing → spreading slices → drying or baking for later use.

[0070] 4.2 Hematoxylin-eosin (HE) staining

[0071] The main steps are as follows: baking at 55°C for 30 min → xylene for 5 min, 3 times → 100% alcohol for 1 min → 95% alcohol for 1 min → 70% alcohol for 1 min → double-distilled water for 1 min → hematoxylin solution (Zhuhai Beso, BA-4021) for 5 min → washing with water for 1 min → 1% hydrochloric acid alcohol (take 3 mL of concentrated hydrochloric acid and mix thoroughly with 297 mL of 70% alcohol) for 1-3 s → washing with water for 1 min → Scott solution (0.35 g of sodium bicarbonate, 2 g of magnesium sulfate heptahydrate, both dissolved in 100 mL of distilled water) for 1 min → washing with water for 1 min → eosin solution (Zhuhai Beso, BA-4024) for 3-5 min → washing with distilled water to remove floating color → 70% alcohol for 1 s → 95% alcohol for 1 s → 100% alcohol for 30 s, 3 times → xylene for 2 min, 3 times → immediately seal the slides while the xylene is still wet → blow dry in a fume hood and photograph under a microscope.

[0072] HE staining image statistics: For each image, at least three cells with clear boundaries and nuclei roughly located in the center were selected and the cell area was circled using Image-Pro Plus 6.0 software.

[0073] 4.3 Sirius Red (PSR) staining

[0074] The main steps are: baking at 55°C for 30 minutes → xylene for 2 minutes, 3 times → 100% alcohol for 1 minute → 95% alcohol for 1 minute → 70% alcohol for 1 minute → rinsing with running water for 10 minutes → double distilled water for 1 minute → 0.2% phosphomolybdic acid for 2 minutes → drop 0.1% picric acid solution of picrosirius red on the tissue and stain in a wet box for 90 minutes → remove residual liquid → 0.01N hydrochloric acid for 4 seconds → 70% alcohol once → 90% alcohol once → 100% alcohol for 30 seconds, 3 times → xylene for 2 minutes, 3 times → cover the slide with a glass slip while the xylene is still wet and take pictures under a microscope.

[0075] PSR staining image statistics (Image-Pro 6.0 software): collagen ratio = collagen area / (total area - blank area) × 100%.

[0076] 4.4 Wheat germ agglutinin (WGA) staining

[0077] After dehydration, sectioning, dewaxing, and hydration of paraffin-embedded cardiac blocks, wash twice with PBS for 5 minutes each. Add trypsin working solution (trypsin: diluent = 1:3). Incubate at 37°C for 15-20 minutes. Wash three times with PBS for 5 minutes each. Add WGA working solution and incubate in a humidified chamber at 37°C for 2 hours. Discard the working solution and wash three times with PBS for 5 minutes each. Stain nuclei with DAPI and then mount the slides.

[0078] 4.5 Heart Masson staining

[0079] After dehydration, sectioning, and dewaxing, heart paraffin blocks were stained using a Masson staining kit. The procedure was as follows: stain in Weigert's hematoxylin solution for 8 minutes, followed by rinsing with running water. Differentiate with 1% hydrochloric acid and alcohol for 3 seconds, and then rinse with running water for 5 minutes. Stain with Ponceau acid fuchsin solution for 8 minutes, followed by rinsing with running water. Treat with phosphomolybdic acid solution for 5 minutes, then counterstain with aniline blue solution for 4 minutes. Rinse sections with 1% glacial acetic acid solution until no blue color is lost. Dehydrate with 95% alcohol and then 100% anhydrous ethanol, then clear with xylene for 2 minutes three times. While the xylene is still wet, mount the sections with neutral gum.

[0080] 5. Heart function test

[0081] All mice were anesthetized with aflototin and subjected to chest hair removal. Cardiac function was assessed using a Vevo 2100 Image System small animal ultrasound. The left ventricular long-axis view was selected for assessment of parameters including left ventricular fractional shortening (FS), left ventricular ejection fraction (EF), left ventricular anterior wall thickness at end-diastole (LVAWd), left ventricular anterior wall thickness at end-systole (LVAWs), left ventricular posterior wall thickness at end-diastole (LVPWd), and left ventricular posterior wall thickness at end-systole (LVPWs). Statistical analysis was performed using the average values ​​of 3-5 cardiac cycles. After adjusting the probe angle, the left ventricular short-axis view was selected and the above procedure repeated.

[0082] 6. Real-time PCR

[0083] Total RNA was extracted from myocardial tissue, and its content and purity were measured spectrophotometrically. Two micrograms of total RNA were used to synthesize cDNA using random primers according to the ABI kit instructions. PCR was performed using the ABI 7500 system. Each reaction contained 2 microliters of MasterMix (Taq enzyme, dNTPs, and SYBR buffer), 1 pM upstream and downstream primers, 2.5 mM MgCl2, and 2 microliters of cDNA template. Reaction conditions included a 94°C hot start for 10 minutes, followed by 45 cycles of 94°C for 15 seconds, 55°C for 10 seconds, and 72°C for 20 seconds.

[0084] Myocardial tissue is composed of cardiomyocytes and interstitial tissue. The heart is a terminally differentiated organ, and cardiomyocytes have lost their ability to proliferate. The response of myocardial cells to various physiological or pathological stimuli is limited to an increase in the volume of individual cells, but not in their number. Therefore, the pathophysiological process of myocardial hypertrophy is primarily manifested by an increase in cardiomyocyte volume, an increase in the number of sarcomeres, and a disordered cell arrangement. Interstitial changes include the proliferation and transformation of cardiac fibroblasts, increased collagen fiber density, increased collagen secretion, and an imbalance in the collagen ratio.

[0085] AAV9-CCL7 virus or AAV9-NC virus was injected into the tail of WT mice, and the aortic arch stenosis surgical model was established 4 weeks later. The samples were collected 8 weeks after the aortic arch stenosis surgical model was established. The results are shown in the figure. Figure 1 Real-time PCR results showed that the expression of CCL7 mRNA in mice injected with AAV9-CCL7 virus was significantly lower than that in mice injected with AAV9-NC virus. Figure 2 The results showed that there were no statistically significant differences in HW / BW, LW / BW, and HW / TL between the sham-operated mice and the AAV9-NC-injected mice. Eight weeks after aortic arch constriction surgery, the HW / BW, LW / BW, and HW / TL ratios of the AAV9-NC-injected mice were higher than those of the AAV9-NC+Sham group. Compared with the AAV9-NC+TAC group, the HW / BW, LW / BW, and HW / TL ratios of the AAV9-CCL7-injected mice were significantly lower eight weeks after aortic arch constriction surgery. HE staining sections showed that the hearts of the AAV9-CCL7+TAC group were significantly smaller than those of the AAV9-NC+TAC group. In the sham-operated group, myocardial myofibrils were neatly arranged and dense, with intact morphology and clear nuclei and nucleoli. In the AAV9-NC+TAC group, myofilaments were disordered and loose, myocardial cells were significantly enlarged, with irregular morphology, darkly stained, enlarged, and deformed nuclei, and blurred nucleoli. Cell hypertrophy in the AAV9-CCL7+TAC group was significantly improved compared with that in the AAV9-NC+TAC group, and the difference was statistically significant ( Figure 2 After PSR staining, it was found that the collagen content of the ventricular myocardial interstitial tissue in the AAV9-NC+TAC group was higher than that in the AAV9-NC+Sham group, and the collagen content around the arterial vessels increased more significantly, with collagen thickening and disordered arrangement in a network-like pattern. The collagen content in the heart and around the vessels of the mice in the AAV9-CCL7+TAC group was significantly lower than that in the mice in the AAV9-NC+TAC group ( Figure 3 Cardiac ultrasound examinations were performed on mice in each group, and the results showed that tail injection of AAV9-CCL7 virus could alleviate the significant decrease in the ejection fraction (EF) and fractional shortening (FS) of the mice caused by aortic arch stenosis surgery. Figure 4At the same time, Real-time PCR examination of the hearts of mice in each group showed that tail injection of AAV9-CCL7 virus could significantly alleviate the elevated levels of IL-1β, IL-6, and MCP-1 mRNA in the hearts of mice induced by aortic arch stenosis surgery ( Figure 5 The above results show that after the aortic arch stenosis surgery model, mice developed obvious myocardial hypertrophy, and the degree of myocardial hypertrophy was significantly improved in mice injected with the AAV9-CCL7 virus.

[0086] These results indicate that in a model of myocardial hypertrophy caused by aortic arch stenosis, CCL7 gene deficiency significantly inhibits myocardial hypertrophy and fibrosis, worsening cardiac function. Therefore, the CCL7 gene has the potential to protect cardiac function and inhibit myocardial hypertrophy and fibrosis, particularly in inhibiting the development of myocardial hypertrophy-related diseases caused by aortic arch stenosis.

[0087] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Use of CC chemokine receptor 7 (CCL7) inhibitors in the preparation of drugs for preventing, alleviating and / or treating myocardial hypertrophy.

2. The use according to claim 1, characterized in that The CC chemokine receptor 7 inhibitor includes an agent capable of inhibiting the expression of CCL7 gene at the transcription or translation level of CCL7 gene.

3. The use according to claim 1, characterized in that The CC chemokine receptor 7 inhibitors include siRNA, shRNA, vectors or viruses containing the siRNA / shRNA, and CCL7 antibodies.

4. The use according to claim 1, wherein The CC chemokine receptor 7 inhibitor is an adeno-associated virus type 9 carrying CC chemokine receptor 7 shRNA.

5. The use according to claim 1, characterized in that The sequence of the CC chemokine receptor 7 shRNA is: 5'-ACGCCTAAGGAATGGTCTTTACTCGAGTAAAGACCATTCCTTAGGCGT-3'.

6. Application of CC chemokine receptor 7 as a drug target in screening drugs for preventing, alleviating and / or treating myocardial hypertrophy.

7. The use according to claim 6, characterized in that The drug can inhibit or reduce the expression of CC chemokine receptor 7.

Images