Application of nano-silica combined with bacterial flora in relieving salt stress of plants
By applying nano-silica and inoculating specific microbial communities into the soybean planting soil, the problem of salt stress inhibiting soybean growth was solved, soybean root development was promoted and salt tolerance was improved, and efficient growth of soybeans in saline-alkali land was achieved.
Patent Information
- Application Number
- CN202510529154.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2045-04-25
AI Technical Summary
Soybean growth is limited in saline-alkali soils, and existing technologies are insufficient to effectively mitigate the adverse effects of salt stress on soybean growth, leading to reduced yield and growth inhibition.
The method of combining nano-silica with specific microbial groups, including applying nano-silica to the soil and inoculating with mixed microbial groups, specifically Bacillus sp. NIIST B603, Arthrobacter sp. B1045 and Enterobacter ludwigii, enhances the salt tolerance of soybeans by reducing malondialdehyde content and increasing proline and soluble sugar content.
It promotes soybean root development, improves soybean growth performance under salt stress, increases proline and soluble sugar content, and enhances soybean salt tolerance and growth capacity.
Smart Images

Figure CN120738002B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of agricultural saline-alkali, and relates to application of nano-silicon dioxide combined with a bacterial flora in relieving salt stress of plants, in particular to application of nano-silicon dioxide combined with a bacterial flora in relieving salt stress of soybeans. BACKGROUND
[0002] Soil salinization is one of the important abiotic stress factors that limit global crop growth and productivity improvement. In addition to naturally occurring soil salinization, salinization caused by atmospheric deposition, sea level rise and temperature rise has had an adverse impact on a large part of arable land. In addition, soil salinization is also exacerbated due to excessive fertilization and poor management. China is one of the countries with a wide distribution of saline-alkali land, with an affected land area of about 36 million hectares, mainly distributed in the plains and basins of the northwest, north China, northeast and coastal areas. Soybean (Glycine max (L.)) as a sweet soil crop has limited salt tolerance, and salt-alkali stress can reduce soybean seed germination rate, hinder plant growth and development, and cause soybean yield reduction. The saline-alkali land area in the northwest region is large and has great potential to become a reserve arable land resource. Rational use can alleviate the demand for domestic soybean imports, and is of great significance to the protection of national grain and oil safety and the realization of sustainable use of land resources. Salinized soil contains a large amount of soluble salt, which accumulates in the root zone of plants, causing osmotic stress, reducing the ability of plant root cells to absorb water from the soil, and causing oxidative stress and other secondary stresses. With the accumulation of toxic ions (such as Na+ and Cl-), plants will further suffer from ion toxicity, and at the same time, some secondary stresses will also occur. These adverse effects caused by salt stress, through interfering with the processes of osmotic balance, ion homeostasis, photosynthesis, and normal metabolism of lipids, proteins and nucleic acids of plants, ultimately inhibit the growth and development of plants. Therefore, it is hoped to find a more efficient and environmentally friendly method to alleviate the adverse effects of salt stress on soybeans and further solve the problem of soybean yield.
[0003] The application of nanotechnology in agriculture provides new technologies and means for sustainable agricultural development. Nano-silicon dioxide (SiO2 NPs) as a promising silicon-based nanomaterial is widely used in agriculture. Its size is less than 100 nm, with the special properties of small volume and large specific surface area, which promotes the absorption of SiO2 NPs by plants and makes it a carrier for other essential nutrients. Its improvement of crop growth under salt stress mainly involves improving growth-related parameters (such as germination rate, root length), improving physiological state (such as osmotic balance, ion homeostasis and ROS level), and enhancing metabolic capacity (such as photosynthetic rate, respiration rate) and the like.
[0004] Halophytes growth-promoting bacteria also play an important role in the process of plant resistance to salt stress, mainly including Azotobacter, Bacillus, Enterobacter, etc. These strains help plants resist salt stress through various ways, mainly in the following aspects: (1) dissolving phosphorus, potassium and nitrogen fixation, etc., to provide more nutrients for plant growth under salt stress, and promote growth. For example, phosphorus-dissolving strains provide more absorbable phosphorus nutrients for plants by secreting organic acids and phosphoric acid solubilizing enzymes. (2) Secretion of hormones: such as indole acetic acid (IAA), cytokinin, etc. IAA is involved in the development regulation of plants, and can promote the root development of plants under salt stress, and enhance the absorption and utilization of nutrients in the soil. (3) Secretion of 1-amino-cyclopropane-1-carboxylic acid (ACC) deaminase. Under salt stress, a large amount of ethylene accumulates in the plant body, which is not conducive to its growth. ACC deaminase can degrade the precursor ACC of ethylene synthesis, thereby reducing the content of ethylene. (4) Secretion of osmotic adjustment substances: such as proline, betaine, polysaccharide, etc., which are involved in the regulation of osmotic balance, the degree of stomatal opening and closing, etc., to promote plant growth and development. Salt-tolerant synthetic bacterial flora can reduce oxidative damage under salt stress through various mechanisms, which is a method to improve future agricultural production. SUMMARY
[0005] In order to overcome the shortcomings of the prior art, the purpose of the present application is to provide a method for applying nano-silicon dioxide combined with bacterial flora to relieve salt stress in soybeans. The application of nano-silicon dioxide combined with bacterial flora reduces the content of malondialdehyde in soybean tissue and reduces the level of lipid peroxidation; at the same time, it increases the accumulation of proline and soluble sugar content, osmotic adjustment substances, thereby increasing the salt tolerance of soybeans.
[0006] In order to achieve the above purpose, the technical scheme adopted by the present application is:
[0007] A nano-silicon dioxide combined bacterial flora, characterized in that it comprises a bacterial flora and nano-silicon dioxide, wherein nano-silicon dioxide is first added to the soil at an application amount of 1 g / kg soil, and then the mixed bacterial flora is inoculated at an application amount of 10 mL per plant.
[0008] The bacterial flora is Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62) and Enterobacter ludwigii (ZH144) combined bacterial flora.
[0009] Among them:
[0010] Bacillus sp. NIIST B603 (ZH12), preservation number CCTCC NO: M2025245, China Center for Type Culture Collection, preservation date February 18, 2025;
[0011] Arthrobacter sp. B1045 (ZH62), preservation number CCTCC NO: M2025244, China Center for Type Culture Collection, preservation date February 18, 2025;
[0012] Enterobacter ludwigii (ZH144), preservation number CCTCC NO: M2025246, China Center for Type Culture Collection, preservation date February 18, 2025.
[0013] The sequence of Bacillus sp. NIIST B603 (ZH12) is as follows:
[0014] ACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTCCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCAAGTGTAGCGGTGAAATGCGTAGATATTTGGAGGAACACCAGTGGCGAAGGCGACTTTCTGGTCTGTAACTGACACTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAGAAAATTTGACGG.
[0015] The sequence of Arthrobacter sp. B1045 (ZH62) is as follows:
[0016]
[0017] The sequence of Enterobacter ludwigii (ZH144) is:
[0018]
[0019] The Bacillus sp. NIIST B603 (ZH12) is a gram-positive bacillus with oval-shaped central spores. The colony is round, cream-colored, smooth, and has a neat edge on LB agar.
[0020] The Arthrobacter sp. B1045 (ZH62) is a gram-positive bacterium. The colony is round, yellow, smooth, and has a neat edge on LB agar.
[0021] The Enterobacter ludwigii (ZH144) is a gram-negative bacillus with peritrichous flagella, so it is motile. The colony is round, cream-colored, smooth, convex, and has a neat edge on LB agar.
[0022] The viable bacterial count of the combined bacterial flora of Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62), and Enterobacter ludwigii (ZH144) is 10 8 CFU / mL.
[0023] A preparation method of a nano-silicon dioxide combined bacterial flora, characterized in that it comprises the following steps:
[0024] Step 1: Strain isolation and purification
[0025] Collect saline-alkali soil samples, prepare LB, R-2A, and beef extract peptone liquid medium containing 80 g / L NaCl, and take 5 g of fresh soil sample in each medium for culture. Shake the culture for 1 day, gradient dilute (10 -4 , 10 -5 , 10 -6 , 10 -7 ), coat, invert in an incubator, and culture for 3-7 days. Observe and record the growth of the colonies, pick single colonies with different morphologies, sizes, and colors to the corresponding solid plates for streak culture, purify multiple times until pure strains are isolated, preserve with glycerol, and store in a -80℃ refrigerator.
[0026] Step 2: Strain identification
[0027] Take the purified bacterial plate after multiple streaks, pick a single colony in a clean bench, dissolve in 10 μL sterile water, take 1 μL as the template for PCR amplification, use the universal primer 27F (5'-AGAGTTTGATCCTGGCTC-3') and 1492R (5'-CGGCTACCTTGTTACGACTT-3') for PCR amplification, and the PCR stock solution is sequenced. The obtained sequence is compared on the NCBI website to obtain the species information of each strain;
[0028] Step 3, screening of functional strains;
[0029] 1) Screening of phosphorus-dissolving and nitrogen-fixing strains;
[0030] The glycerol-preserved strain was inoculated into LB liquid medium for activation, and was shaken in a 180 r / min, 28℃ shaking bed until the bacterial solution was turbid. The bacterial solution was centrifuged at 6000 r / min for 8 min, the bacterial cells were washed twice with sterile water, and the OD600 of the bacterial solution was adjusted to about 0.8 with sterile water. 10 μL of the bacterial solution was added dropwise to PKO (Meng Jinna) inorganic phosphorus solid medium, PKO (Meng Jinna) organic phosphorus solid medium, and Ashby (Ashby) nitrogen-free solid medium, each treatment was repeated three times, and was cultured at 28℃ for 3-7 days. Whether there was a transparent circle on each solid medium was observed. If a transparent circle appeared, it proved that the strain had the ability to dissolve inorganic phosphorus, organic phosphorus, and nitrogen fixation. The diameter (D) and colony diameter (d) of the transparent circle were recorded, and the ratio of the two diameters (D / d) was used to judge the size of the strain's various abilities.
[0031] 2) Screening of potassium-dissolving strains;
[0032] The bacterial solution with OD600 of 0.8 was inoculated into 20 mL potassium-dissolving liquid medium at a 5% inoculation amount, and each treatment was repeated three times. After 7 days of shaking bed culture, the bacterial suspension was centrifuged, the supernatant was collected, 2 mL of 6% H2O2 was added for digestion for 1 h, and the supernatant was collected again. The soluble potassium content in the supernatant was determined by flame photometry. Compared with the control, it was judged whether the strain had the ability to dissolve insoluble potassium and the size of the ability.
[0033] 3) Screening of exopolysaccharide (EPS)-producing strains;
[0034] (1) The ability of the strain to produce EPS (exopolysaccharide) was quantitatively determined by the phenol-sulfuric acid method. The glucose standard curve was drawn, and the glucose concentration was the horizontal coordinate and OD490 was the vertical coordinate.
[0035] (2) Take the strain frozen in the glycerol tube at -80°C, activate, dilute and spread on LB solid medium plate, invert culture at 28°C for 3 days, use inoculation ring to take the colony to observe whether it has "stickiness", if it has stickiness, it is preliminarily considered to be a strain possibly producing EPS (exopolysaccharide); the above-mentioned potential EPS-producing strain is cultured in a shaker at 180 r / min and 28°C for 2 days, the bacterial suspension is centrifuged, 2 mL supernatant is collected in a centrifuge tube, anhydrous ethanol is added at a ratio of 1:3, and the centrifuge tube is placed in a refrigerator at 4°C for alcohol precipitation overnight, each treatment is repeated three times; the corresponding strain with precipitate appearing in the centrifuge tube is observed and recorded, which is a strain possibly having the ability to produce EPS (exopolysaccharide); the precipitate is further centrifuged and collected, dried, and dissolved in deionized water; concentrated sulfuric acid and 6% phenol solution are added in turn, a yellow reaction is presented, OD490 is measured, and the ability of the corresponding strain to produce EPS (exopolysaccharide) is obtained according to the above-mentioned glucose standard curve;
[0036] 4) Screening of indole acetic acid (IAA)-producing strains;
[0037] (1) Prepare indole acetic acid solutions with different concentration gradients; mix 35% HClO4 and 0.5 mol / L FeCl3 at a ratio of 50:1 to obtain Salkowski colorimetric solution; mix each concentration gradient of indole acetic acid solution with colorimetric solution in equal volume, avoid light reaction for 30 min, and measure OD530; draw a standard curve with the concentration of indole acetic acid solution as the abscissa and OD530 as the ordinate;
[0038] (2) Take bacterial liquid with OD600 of about 0.8; inoculate each bacterial liquid into Kings liquid medium containing 0.2 g / L tryptophan at a 1% inoculation amount, and shake culture for 3 days; centrifuge the bacterial suspension to collect the supernatant, mix the supernatant with colorimetric solution in equal volume, avoid light reaction for 30 min; each 3 repeats; observe whether the mixed solution is pink, if pink appears, it is an IAA (indole acetic acid)-producing strain; record the corresponding strain appearing pink and measure OD530 to obtain the IAA (indole acetic acid) concentration of the supernatant;
[0039] 5) Screening of 1-amino-cyclopropane-1-carboxylic acid (ACC) deaminase-producing strains;
[0040] (1) Qualitative: strains capable of growing in ADF medium with ACC (1-amino-cyclopropane-1-carboxylic acid) as the sole nitrogen source are preliminarily determined to have the ability to produce ACC (1-amino-cyclopropane-1-carboxylic acid) deaminase, each 3 repeats;
[0041] (2) Quantitative: the amount of a-ketobutyric acid produced per milligram of bacterial protein per hour (pmol) is defined as the activity of the ACC (1-amino-cyclopropane-1-carboxylic acid) deaminase enzyme produced by the strain, with the unit of pmol / (mg h); the strain preliminarily determined to have the ability to produce ACC (1-amino-cyclopropane-1-carboxylic acid) deaminase is activated in LB liquid medium, centrifuged to collect the bacterial cells, washed twice with 0.1 mol / L Tris-HCl (pH 7.5), resuspended in ADF liquid medium, and cultured on a shaker for 2-3 days; the bacterial cells are collected and washed twice again with Tris-HCl (pH 7.5); the obtained bacterial cells are mixed with 0.1 mol / L Tris-HCl (pH 8.5) and pure toluene, and ultrasonically broken to obtain a crude enzyme solution; the crude enzyme solution is reacted with ACC (1-amino-cyclopropane-1-carboxylic acid), and finally the OD540 is determined; an a-ketobutyric acid standard solution is prepared, and a standard curve is drawn; in addition, the content of bacterial protein therein is determined by the Coomassie brilliant blue method, and finally the ACC (1-amino-cyclopropane-1-carboxylic acid) deaminase activity of each strain is calculated;
[0042] Step 4, constructing a combined bacterial flora;
[0043] The OD600 of each bacterial strain of Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62) and Enterobacter ludwigii (ZH144) is adjusted to about 0.8, and mixed in equal volumes according to 1:1:1 (v / v / v) and shaken well;
[0044] The Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62) and Enterobacter ludwigii (ZH144) culture medium comprises LB liquid medium.
[0045] The Bacillus sp. NIIST B603 (ZH12) is applied in relieving plant salt stress.
[0046] The Arthrobacter sp. B1045 (ZH62) is applied in relieving plant salt stress.
[0047] The Enterobacter ludwigii (ZH144) is applied in relieving plant salt stress.
[0048] The application of the Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62) and Enterobacter ludwigii (ZH144) combined microbial flora in relieving salt stress of plants.
[0049] The plant is soybean.
[0050] The application amount of the combined microbial flora is 10 mL per plant.
[0051] The beneficial effects of the application are:
[0052] Nano-silicon dioxide is applied to the soil where soybeans are to be planted, and then the soybeans are planted in the soil, and a simplified salt-tolerant growth-promoting synthetic microbial flora agent is added; wherein the synthetic microbial flora is isolated from saline-alkali soil and its growth-promoting functions such as nitrogen fixation, phosphorus solubilization and potassium solubilization are determined, and the growth-promoting effects of single bacteria are verified through pot experiment. The simplified microbial flora SynC1 is constructed to evaluate the relieving effect of nano-silicon dioxide and microbial flora combined application on salt stress of soybeans through pot experiment. It is found that the combined application of nano-silicon dioxide and SynC1 can better promote root development, increase proline content and promote the growth of soybeans under salt stress, and has excellent application potential in agricultural soybean production. BRIEF DESCRIPTION OF DRAWINGS
[0053] Figure 1 Photos of pot experiment inoculated with 7 functional bacteria
[0054] Figure 2 Photos of pot experiment inoculated with 7 functional bacteria Figure 2 A of FIG. 1 shows the stem and leaf fresh weight column chart of soybeans inoculated with 7 functional bacteria; Figure 2 B of FIG. 1 shows the root fresh weight column chart of soybeans inoculated with 7 functional bacteria; Figure 2 C of FIG. 1 shows the stem and leaf dry weight column chart of soybeans inoculated with 7 functional bacteria; Figure 2 D of FIG. 1 shows the root dry weight column chart of soybeans inoculated with 7 functional bacteria.
[0055] Figure 3 Photos of pot experiment inoculated with 7 functional bacteria Figure 3 A of FIG. 2 shows the total root length column chart; Figure 3 B of FIG. 2 shows the root tip number column chart; Figure 3 C of FIG. 2 shows the root surface area column chart; Figure 3 D of FIG. 2 shows the root volume column chart.
[0056] Figure 4 Photos of soybean pot experiment treated with SiO2NPs combined growth-promoting microbial flora.
[0057] Figure 5 Figure 1A shows the soybean growth index determination results under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 5 Figure 1A shows the soybean growth index determination results under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 5 Figure 1A shows the soybean growth index determination results under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 5 Figure 1A shows the soybean growth index determination results under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 5 Figure 1A shows the soybean growth index determination results under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 5 Figure 1A shows the soybean growth index determination results under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 5 Figure 1A shows the soybean growth index determination results under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein,
[0058] Figure 6 Figure 2 shows the scanning electron microscopy images of the soybean root system under the treatment of SiO2 NPs combined with the growth-promoting bacterial population.
[0059] Figure 7 Figure 2 shows the scanning electron microscopy images of the soybean root system under the treatment of SiO2 NPs combined with the growth-promoting bacterial population. Figure 7 Figure 2 shows the scanning electron microscopy images of the soybean root system under the treatment of SiO2 NPs combined with the growth-promoting bacterial population. Figure 7 Figure 2 shows the scanning electron microscopy images of the soybean root system under the treatment of SiO2 NPs combined with the growth-promoting bacterial population. Figure 7 Figure 2 shows the scanning electron microscopy images of the soybean root system under the treatment of SiO2 NPs combined with the growth-promoting bacterial population. Figure 7 Figure 2 shows the scanning electron microscopy images of the soybean root system under the treatment of SiO2 NPs combined with the growth-promoting bacterial population.
[0060] Figure 8 Figure 3 shows the determination results of the proline content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 8 Figure 3 shows the determination results of the proline content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 8 Figure 3 shows the determination results of the proline content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein,
[0061] Figure 9 Figure 4 shows the determination results of the soluble sugar content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 9 Figure 4 shows the determination results of the soluble sugar content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 9 Figure 4 shows the determination results of the soluble sugar content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein,
[0062] Figure 10 Figure 5 shows the determination results of the malondialdehyde (MDA) content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 10 Figure 5 shows the determination results of the malondialdehyde (MDA) content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein, Figure 10 Figure 5 shows the determination results of the malondialdehyde (MDA) content of the soybean tissue under the treatment of SiO2 NPs combined with the growth-promoting bacterial population; wherein,
[0063] Figure 11 For preservation.
[0064] Figure 12 For preservation.
[0065] Figure 13 For preservation. DETAILED DESCRIPTION
[0066] The application will be further described below in combination with specific examples.
[0067] A preparation method of a nano-silicon dioxide combined flora, characterized in that the method comprises the following steps:
[0068] Example 1: The screening method of the growth-promoting bacteria is as follows:
[0069] 1. Strain separation and purification
[0070] Soil samples were collected from saline-alkali lands in Gansu and Xinjiang, and LB, R2A and beef extract peptone liquid medium containing 80 g / L NaCl were prepared. 5 g of fresh soil sample was taken into each medium for culture, and the culture was enriched on a shaking table for 1 day. The bacterial liquid was gradiently diluted and coated, and then inverted in a culture box for culture for 3-7 days. The growth of the colonies was observed and recorded, and single colonies with different morphologies, sizes and colors were picked and streaked on corresponding solid plates for culture. The streaking and purification were repeated multiple times until pure strains were separated. The strains were preserved by glycerol and stored in a -80℃ refrigerator.
[0071] 2. Strain identification
[0072] The single colonies on the bacterial plate that had been purified by multiple streaking were picked in a super-clean bench, dissolved in 10 μL of sterile water, and 1 μL of the solution was taken as a template for PCR amplification. Universal primers 27F (5'-AGAGTTTGATCCTGGCTC-3') and 1492R (5'-CGGCTACCTTGTTACGACTT-3') were used for PCR amplification. The PCR stock solution was sent to Xi'an Jingke Biotechnology Co., Ltd. for sequencing, and the obtained sequences were compared on the NCBI website to obtain the species information of each strain.
[0073] 3. Screening of functional strains
[0074] 1) Screening of phosphorus-dissolving and nitrogen-fixing strains
[0075] The glycerol-preserved strain was inoculated into LB liquid medium for activation, and was shaken in a 180 r / min, 28°C shaker until the bacterial solution was turbid. The bacterial solution was centrifuged at 6000 r / min for 8 min, and the bacterial cells were collected, washed twice with sterile water, and the OD600 of the bacterial solution was adjusted to about 0.8 with sterile water. 10 μL of the bacterial solution was added dropwise to PKO inorganic phosphorus solid medium, Mengjina organic phosphorus solid medium, and Ashby nitrogen-free solid medium, and each treatment was repeated three times, and was cultured at 28°C for 3-7 d. Whether transparent circles appeared on each solid medium was observed, and if transparent circles appeared, it was proved that the strain had the ability to dissolve inorganic phosphorus, organic phosphorus, and nitrogen fixation. The diameter (D) of the transparent circle and the diameter (d) of the colony were recorded, and the ratio of the two diameters (D / d) was used to judge the size of the ability of the strain.
[0076] 2) Screening of potassium-dissolving strains
[0077] The bacterial solution with OD600 of 0.8 was inoculated into 20 mL potassium-dissolving liquid medium at a 5% inoculation amount, and each treatment was repeated three times. After 7 days of shaker culture, the bacterial suspension was centrifuged, the supernatant was collected, 2 mL of 6% H2O2 was added for digestion for 1 h, centrifugation was performed again, and the supernatant was taken. The soluble potassium content in the supernatant was determined by a flame photometer, and the treatment inoculated with the bacterial suspension was compared with the control to determine whether the strain had the ability to dissolve insoluble potassium and the size of the ability.
[0078] 3) Screening of exopolysaccharide (EPS)-producing strains
[0079] (1) The ability of the strain to produce EPS was quantitatively determined by the phenol-sulfuric acid method. A glucose standard curve was drawn, with glucose concentration as the horizontal coordinate and OD490 as the vertical coordinate.
[0080] (2) The strain stored in a glycerol tube at -80°C was activated, diluted, and spread on LB solid medium plates, and was cultured at 28°C for 3 d. A loop was used to pick up the colonies to observe whether they were sticky. If they were sticky, it was preliminarily considered that they might be EPS-producing strains. The above-mentioned potential EPS-producing strains were cultured in a 180 r / min, 28°C shaker for 2 d, the bacterial suspension was centrifuged, 2 mL of supernatant was collected in a centrifuge tube, anhydrous ethanol was added at a ratio of 1:3, and the tube was placed in a 4°C refrigerator for alcohol precipitation overnight, and each treatment was repeated three times. The corresponding strains that appeared precipitates in the centrifuge tube were observed and recorded, and the strain was the one that might have the ability to produce EPS. The precipitate was further centrifuged and collected, dried, and dissolved in deionized water. Concentrated sulfuric acid and 6% phenol solution were added in sequence, a yellow reaction was observed, OD490 was measured, and the ability of the corresponding strain to produce EPS was calculated according to the above-mentioned glucose standard curve.
[0081] 4) Screening of indole acetic acid (IAA)-producing strains
[0082] (1) Prepare IAA solutions with different concentration gradients. Mix 35% HCIO4 and 0.5 mol / L FeCl3 at a ratio of 50:1 to obtain Salkowski colorimetric solution. Mix each concentration gradient of IAA solution with colorimetric solution in equal volume, avoid light for 30 min, and measure OD530. Draw standard curve with IAA solution concentration as abscissa and OD530 as ordinate.
[0083] (2) Take bacterial liquid with OD600 of about 0.8. Inoculate each bacterial liquid into Kings liquid medium with 1% inoculation amount, the medium contains tryptophan with a concentration of 0.2 g / L, and shake culture for 3 d. Centrifuge the bacterial suspension to collect supernatant, mix the supernatant with colorimetric solution in equal volume, avoid light for 30 min. Each 3 repeats. Observe whether the mixed solution is pink, if pink appears, it is IAA-producing strain. Record the corresponding strain with pink and measure OD530 to obtain the IAA concentration of supernatant.
[0084] 5) Screening of 1-amino-cyclopropane-1-carboxylic acid (ACC) deaminase-producing bacterial strains
[0085] (1) Qualitative: strains capable of growing in ADF medium with ACC as the sole nitrogen source are preliminarily determined to have the ability to produce ACC deaminase. Each 3 repeats.
[0086] (2) Quantitative: the amount of α-ketobutyric acid produced per milligram of bacterial protein per hour (µmol) is defined as the activity of ACC deaminase enzyme produced by the strain, with the unit of µmol / (mg·h). Take the strains preliminarily determined to have the ability to produce ACC deaminase, activate them in LB liquid medium, centrifuge to collect the bacterial cells, wash them twice with 0.1 mol / L Tris-HCl (pH7.5), resuspend them in ADF liquid medium, and shake culture for 2~3 d. Collect the bacterial cells, wash them twice with Tris-HCl (pH7.5) again. Mix the obtained bacterial cells with 0.1 mol / L Tris-HCl (pH8.5) and pure toluene, and ultrasonicate to obtain crude enzyme solution. React the crude enzyme solution with ACC, and finally measure OD540. Prepare α-ketobutyric acid standard solution, and draw standard curve. In addition, determine the content of bacterial protein by Coomassie brilliant blue method, and finally calculate the ACC deaminase activity of each strain.
[0087] 6) Functional bacteria promote growth pot experiment
[0088] As shown in Table 1, a total of 7 functional bacteria were screened, and pot experiments were carried out using the 7 bacteria.
[0089] Table 1 Functional bacterial strains
[0090]
[0091] 1. The potting experiment method for relieving salt stress of soybean by functional bacteria inoculation is as follows:
[0092] Test plant: soybean (Zhonghuang 13). Culture conditions: 14 h light / 10 h darkness, temperature 25°C day / 20°C night, artificial control of water. Test soil: collected from Caoxinzhuang test field in Yangling.
[0093] (1) Select uniform and plump corn seeds, disinfect the seeds with 1% NaClO solution, after disinfection, rinse with distilled water for three times. After disinfection, select the seeds with wrinkled and complete seed coat, evenly spread on 1% water agar plate, seal the dish mouth with sealing film, place in 28°C incubator, cultivate for three days in the dark.
[0094] (2) Add 200 mL of 200 mmol / L NaCl solution to the soil, stir evenly, and stand for seven days to make the salt evenly distributed in the soil.
[0095] (3) Divide the prepared soil into pots, 500 g per pot, plant the germinated soybean seedlings in the soil, adjust the soil moisture by adding tap water to reach the target water content (60% of field water holding capacity). After growing for one week, thin the seedlings, and reserve three seedlings with good growth and uniformity.
[0096] (4) After thinning, inoculate the bacteria. Adjust the OD600 of the bacterial liquid of each strain to about 0.8. Inoculate the bacteria by root irrigation, 10 mL of bacteria per plant per strain.
[0097] To verify the effect of the screened functional bacteria on the aboveground and underground parts of soybean plants under salt stress, eight treatment groups were set up, namely: (1) CK: salt stress treatment group (200 mL of 200 mmol / L NaCl solution); (2) 12: salt stress (200 mL of 200 mmol / L NaCl solution) + ZH12; (3) 46: salt stress (200 mL of 200 mmol / L NaCl solution) + ZH46; (4) 62: salt stress (200 mL of 200 mmol / L NaCl solution) + ZH62; (5) 117: salt stress (200 mL of 200 mmol / L NaCl solution) + ZH117; (6) 127: salt stress (200 mL of 200 mmol / L NaCl solution) + ZH127; (7) 143: salt stress (200 mL of 200 mmol / L NaCl solution) + ZH143; and (8) 144: salt stress (200 mL of 200 mmol / L NaCl solution) + ZH144. Six replicates were set up for each group. After 4 weeks, the aboveground and underground parts of the soybean plants were collected for determination of relevant indicators.
[0098] 2. Determination results:
[0099] The growth indicators (fresh weight and dry weight) and root development (total root length, root tip number, total root volume, and total root surface area) of the soybean plants were determined.
[0100] The determination results of the growth indicators of the soybean plants are shown in Table 1 and FIG. 1. Figure 1 and Figure 2 As shown in Table 1 and FIG. 1, the biomass of the stems and leaves and roots of the soybean plants was significantly increased under salt stress after inoculation with the functional bacteria, especially in the three treatments of Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62), and Enterobacter ludwigii (ZH144).
[0101] The determination results of the root development indicators of the soybean plants are shown in Table 2 and FIG. 2. Figure 3 As shown in Table 2 and FIG. 2, the root development was significantly promoted, and the total root length, root tip number, total root surface area, and total root volume were increased in the three treatments of Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62), and Enterobacter ludwigii (ZH144) under salt stress.
[0102] Example 2: Combined application of the prepared synthetic bacterial community and nano-silicon dioxide to relieve salt stress of soybean
[0103] Two growth-promoting bacterial communities were constructed
[0104] Consortium 1: Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62) and Enterobacter ludwigii (ZH144)
[0105] Consortium 2: Bacillus sp. NIIST B603 (ZH12), Metabacillus litoralis (ZH46), Arthrobacter sp. B1045 (ZH62), Priestia megaterium (ZH117), Priestia aryabhattai (ZH127), Pseudomonas extremorientalis (ZH143) and Enterobacter ludwigii (ZH144)
[0106] 1. The method for relieving salt stress of soybean by combined application of synthetic consortium and nano-silica is as follows:
[0107] Test plant: soybean (Zhonghuang 13). Culture condition: 14 h light / 10 h darkness, temperature 25°C day / 20°C night, artificial control of water. Test soil: collected from Yangling Caocinxinzhuang test field.
[0108] (1) Select uniform and plump corn seeds, disinfect the seeds with 1% NaClO solution, after disinfection, rinse with distilled water for three times. After disinfection, select seeds with wrinkled and intact seed coat, evenly spread on 1% water agar plate, the mouth of the culture dish is sealed with sealing film, and placed in a 28°C incubator, avoiding light for three days.
[0109] (2) Mix nano-silica into the soil, and add 200 mL of 200 mmol / L NaCl solution, stir uniformly, and stand for seven days to make the salt evenly distributed in the soil.
[0110] (3) Divide the prepared soil into pots, 500 g per pot, plant the germinated soybean seedlings in the soil, adjust the soil moisture by adding tap water to reach the target moisture content (60% of field water holding capacity). After one week of growth, thin the seedlings, and reserve three seedlings with good growth and uniformity.
[0111] (4) After thinning, inoculate the bacteria. Adjust the OD600 of each bacterial strain to about 0.8, and mix in equal volume. Inoculate the bacteria by root irrigation, and the inoculation amount of each strain is 10 mL per plant.
[0112] To verify the effect of the synthetic microbial community combined with nano-silica on the aboveground and underground parts of soybean plants under salt stress, five treatment groups were set up: (1) CK: salt stress treatment group (200 mL of 200 mmol / L NaCl solution); (2) SynCl: salt stress (200 mL of 200 mmol / L NaCl solution) + SynCl; (3) SynCl + NPs: salt stress (200 mL of 200 mmol / L NaCl solution) + SynCl + nano-silica (1 g / kg soil); (4) SynC2: salt stress (200 mL of 200 mmol / L NaCl solution) + SynC2; (5) SynC2 + NPs: salt stress (200 mL of 200 mmol / L NaCl solution) + SynC2 + nano-silica (1 g / kg soil). Each group had 6 replicates. After 4 weeks, the aboveground and underground parts of soybean plants were collected for determination of relevant indicators.
[0113] 2. Determination results:
[0114] The growth indicators of soybean (plant height, fresh weight, dry weight, and nodule number), root development (total root length, root tip number, total root surface area, and total root volume), and the contents of malondialdehyde and osmotic adjustment substances (proline and soluble sugar) in soybean tissues were determined.
[0115] The determination results of soybean growth indicators are shown in Figure 4 and Figure 5 The combined application of nano-silica and SynCl significantly increased the plant height, nodule number, fresh weight, and dry weight of soybean stems, leaves, and roots.
[0116] The determination results of soybean root development are shown in Figure 6 and Figure 7 Under salt stress, the combined application of nano-silica and SynCl significantly promoted root development.
[0117] The determination results of proline, soluble sugar, and malondialdehyde are shown in Figures 8-10 Osmotic adjustment substances are important factors in regulating metabolism and osmotic pressure in plants during salt stress. Salt stress reduces the activity of antioxidant enzymes in soybean tissues and accumulates osmotic adjustment substances to increase salt tolerance. The combined application of nano-silica and SynCl reduces the content of malondialdehyde and lipid peroxidation level in soybean tissues, while increasing the accumulation of proline and soluble sugar as osmotic adjustment substances, thereby increasing the salt tolerance of soybean.
Claims
1. A nano-silica-associated bacterial community, characterized in that, Including microbial communities and nano-silica, first add nano-silica to the soil at an application rate of 1 g / kg soil, and then inoculate the mixed microbial community at an application rate of 10 mL per plant. The bacterial community consists of Bacillus sp. NIIST B603 (ZH12), Arthrobacter sp. B1045 (ZH62) and Enterobacter ludwigii (ZH144); in: Bacillus sp. NIIST B603 (ZH12), accession number CCTCC NO: M2025245; Arthrobacter sp. B1045 (ZH62), accession number CCTCC NO: M2025244; Enterobacter ludwigii (ZH144), accession number CCTCC NO: M2025246.
2. The nano-silica-associated bacterial community according to claim 1, characterized in that, The aforementioned Bacillus sp. NIIST B603 (ZH12) is a Gram-positive bacillus that forms oval central spores. On LB agar, the colonies are round, cream-colored, smooth, and have regular edges.
3. The nano-silica-associated bacterial community according to claim 1, characterized in that, The Arthrobacter sp. B1045 (ZH62) is a Gram-positive bacterium that forms round, yellow, smooth colonies with regular edges on LB agar.
4. The nano-silica-associated bacterial community according to claim 1, characterized in that, Enterobacter ludwigii (ZH144) is a Gram-negative rod-shaped bacterium with peritrichous flagella, thus exhibiting motility. On LB agar, its colonies are round, milky white, smooth, raised, and have regular edges.
5. The application of nano-silica combined with bacterial flora according to claim 1 in alleviating plant salt stress, characterized in that, The aforementioned combined microbial community includes microbial community and nano-silica, wherein the microbial community consists of Bacillus sp. NIISTB603 (ZH12), Arthrobacter sp. B1045 (ZH62) and Enterobacter ludwigii (ZH144); in: Bacillus sp. NIIST B603 (ZH12), accession number CCTCC NO: M2025245; Arthrobacter sp. B1045 (ZH62), accession number CCTCC NO: M2025244; Enterobacter ludwigii (ZH144), accession number CCTCC NO: M2025246; The plant in question is soybean.
Citation Information
Patent Citations
Screening methods
CN103607884A
Bacillus aryabhattai MB15 and application thereof
CN118581015A