Application of MARCH2 gene as a target in inhibiting avian leukosis virus replication

By constructing cell lines using the MARCH2 gene overexpression vector, the problem of difficulty in blocking avian leukosis virus was solved, and effective inhibition of different subgroups of avian leukosis virus was achieved, providing new antiviral drugs and breeding programs.

CN120738215BActive Publication Date: 2026-02-03HARBIN VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES (CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER HARBIN BRANCH CENTER)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511156273.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2026-02-03
Estimated Expiration
2045-08-19

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively block the spread of avian leukosis virus (ALV), especially due to its latent infection and genome integration characteristics, which lead to lifelong carrier status and rebound infection rates. There is a lack of effective vaccines or drug control measures.

Method used

Using the MARCH2 gene or its encoded protein as a target, drugs were designed to upregulate MARCH2 gene expression. Cell lines were constructed using MARCH2 gene overexpression vectors, especially lentiviral expression vectors such as pLVX-mCherry vector, to construct the MARCH2 gene overexpression DF-1 cell line for inhibiting the replication of avian leukosis virus.

Benefits of technology

It significantly inhibits the replication of different subgroups of avian leukosis virus, providing a new antiviral strategy that can be used to prepare drugs to inhibit avian leukosis virus and for animal breeding, significantly reducing viral load and protein levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120738215B_ABST
    Figure CN120738215B_ABST
Patent Text Reader

Abstract

The application discloses application of MARCH2 gene as a target point in inhibition of replication of avian leukosis virus (ALV), and further discloses a MARCH2 gene overexpression cell line, a construction method thereof and application of the MARCH2 gene overexpression cell line in inhibition of infection of different subgroups of ALV. The MARCH2 gene overexpression cell line is successfully constructed by a lentivirus packaging infection technology, and experimental results show that the cell line can significantly inhibit replication of different subgroups of ALV. The application proposes that overexpression of the MARCH2 gene or expression of a coded protein of the MARCH2 gene can effectively inhibit replication of different subgroups of ALV. The finding provides a technical means for future anti-disease breeding work against ALV infection by taking the MARCH2 gene as a target point, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a new target for inhibiting avian leukosis virus replication, in particular to the application of MARCH2 gene or its encoded protein in inhibiting avian leukosis virus replication. The present application belongs to the technical field of biological genetic engineering. BACKGROUND

[0002] Avian leukosis virus (ALV) is the main pathogen of avian leukosis, which mainly spreads vertically, and there is no effective vaccine or drug control measure at present, and only the continuous purification of breeding chicken flocks can be relied on. However, ALV has the characteristics of latent infection and genome integration, once infected, it will be lifelong, and once the purification measure is interrupted, the infection rate will rebound easily. Therefore, the traditional purification method is difficult to completely block the spread of ALV, and it is urgent to develop new prevention and control technology. From the perspective of the host, targeting the key host factors dependent on virus replication, establishing a new anti-virus strategy is expected to fundamentally block ALV infection and provide a new idea and direction for breeding disease-resistant poultry.

[0003] MARCH2 (Membrane-Associated RING-CH-Type Finger 2) is one of the members of the E3 ubiquitin ligase MARCH family, which is located in membrane structures such as cell membrane and Golgi apparatus, and regulates the stability, endocytosis and degradation of membrane proteins through ubiquitination modification, and is involved in immune response, cell signal transduction and membrane transport processes. Studies have shown that MARCH2 can ubiquitinate viral or host proteins, directly or indirectly affecting virus replication. For example, in hepatitis B virus (HBV) infection, MARCH2 promotes the lysosomal degradation of viral surface proteins (such as HBsAg) through ubiquitination, thereby inhibiting the secretion of virus particles; while in the infection of some RNA viruses (such as dengue virus), MARCH2 may enhance the host's anti-virus immunity by regulating the interferon signaling pathway or the internalization of viral receptors. In addition, the activity of MARCH2 is hijacked by viruses, and some viruses (such as HIV-1) may use the host ubiquitination system to promote the stability or immune escape of their own proteins. Therefore, MARCH2 has a bidirectional regulation potential in the interaction between virus and host, and is a potential target for anti-virus drug development.

[0004] Based on this, the present application focuses on the host MARCH2 molecule, explores its regulation effect and molecular mechanism on ALV replication, aims to provide a theoretical basis for screening new anti-virus targets and developing efficient anti-ALV technology, and helps the safety of poultry breeding sources and the revitalization of the poultry industry in China. SUMMARY

[0005] The purpose of the present application is to provide a new target for inhibiting avian leukosis virus replication.

[0006] In order to achieve the above object, the present application adopts the following technical means.

[0007] The present application provides the application of the drug designed with MARCH2 gene or its coded protein as a target in the preparation of the drug for inhibiting avian leukosis virus, and the drug designed with MARCH2 gene as a target can up-regulate the expression of MARCH2 gene.

[0008] Preferably, the NCBI Gene ID of the MARCH2 gene is 420062.

[0009] Further, the present application also provides the application of the overexpression vector of MARCH2 gene in the preparation of the drug for inhibiting avian leukosis virus.

[0010] Preferably, the overexpression vector of MARCH2 gene is a lentiviral expression vector containing MARCH2 gene.

[0011] Preferably, the lentiviral expression vector is a pLVX-mCherry vector containing MARCH2 gene.

[0012] Further, the present application also provides a construction method of MARCH2 gene overexpression DF-1 cell line, comprising the following steps:

[0013] (1) Vector construction

[0014] According to the MARCH2 gene sequence in NCBI, the primers are designed:

[0015] ;

[0016] The MARCH2 coding sequence is amplified, the amplified MARCH2 coding sequence is inserted into the pLVX-mCherry vector, the lentiviral packaging plasmid is constructed, and is named as pLVX-MARCH2-Flag.

[0017] (2) Construction and screening of MARCH2 overexpression cell line

[0018] The pLVX-MARCH2-Flag, pcGP and pVSV-G plasmids are co-transfected into 293T cells to package the lentivirus. The packaged MARCH2 lentivirus is used to infect DF-1 cells, and after 48 h of culture, the cells with mCherry fluorescence are screened by using a flow cytometry sorting instrument, and are inoculated into 96-well plates. After 7 days, the monoclonal cell line is observed and cultured under an optical microscope; whether MARCH2 is successfully overexpressed is detected by Western Blot, and the MARCH2 gene overexpression DF-1 cell line is obtained.

[0019] The MARCH2 gene overexpression DF-1 cell line constructed according to the method is also within the protection scope of the present application.

[0020] Further, the present application also provides the application of the MARCH2 gene overexpression DF-1 cell line in inhibiting the replication of avian leukemia virus.

[0021] And the application of the MARCH2 gene overexpression DF-1 cell line in animal breeding against avian leukemia virus.

[0022] Preferably, the avian leukemia virus is subgroup A avian leukemia virus, subgroup B avian leukemia virus or subgroup J avian leukemia virus.

[0023] Compared with the prior art, the present application has the following beneficial effects:

[0024] 1. The present application first discovers that overexpression of MARCH2 gene can inhibit the replication of avian leukemia virus of different subgroups, and can be used for preparing a medicine for inhibiting the replication of avian leukemia virus.

[0025] 2. The present application successfully constructs a MARCH2 gene overexpression cell line by lentivirus packaging infection technology, and experimental results show that the cell line can significantly inhibit the replication of ALV of different subgroups, and can be used for animal breeding against avian leukemia virus of different subgroups. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 for Western blot detection of MARCH2 overexpression cell line;

[0027] Figure 2 for fluorescence quantitative PCR detection of the influence of MARCH2 overexpression on ALV-A replication;

[0028] Figure 3 for Western blot detection of the influence of MARCH2 overexpression on ALV-A replication;

[0029] Figure 4 for fluorescence quantitative PCR detection of the influence of MARCH2 overexpression on ALV-B replication;

[0030] Figure 5 for Western blot detection of the influence of MARCH2 overexpression on ALV-B replication;

[0031] Figure 6 for fluorescence quantitative PCR detection of the influence of MARCH2 overexpression on ALV-J replication;

[0032] Figure 7To detect the effect of MARCH2 overexpression on ALV-J replication using Western blot. Detailed Implementation

[0033] The experimental method of the present invention will be described in detail below with reference to embodiments, so as to more clearly illustrate its technical features and implementation steps. Those skilled in the art should understand that the embodiments are merely typical examples of the present invention and do not constitute any limitation on the scope of the present invention. Adjustments or substitutions can be made to the technical details without departing from the spirit and scope of the present invention, and such adjustments and substitutions all fall within the protection scope of the present invention.

[0034] Example 1: Construction and Identification of MARCH2 Overexpressing Cell Lines

[0035] Materials and Methods

[0036] 1. Main experimental materials

[0037] DF-1 cells, ALV-A, ALV-B, and ALV-J were preserved in our laboratory; the anti-ALV p27 murine monoclonal antibody was prepared in our laboratory; RNAiso Plus was purchased from Takara Bio Inc.; NP40 lysis buffer was purchased from Beyotime Biotechnology Co., Ltd.; THUNDERBIRD™ SYBR® Qpcr Mix was purchased from TOYOBO; reverse transcription reagent was purchased from Vazyme; 5×SDS PAGE loading buffer was purchased from Solarbio; murine anti-β-actin monoclonal antibody was purchased from Sigma-Aldrich; pLVX-mCherry, pcGP, and pVSV-G plasmids were preserved in our laboratory.

[0038] 2. Carrier Construction

[0039] Based on the MARCH2 gene (Gene ID: 420062) sequence in NCBI (https: / / www.ncbi.nlm.nih.gov / ), primers (MARCH2-F: AGAGGATCTATTTCCGGTGAATTCatgacgacgggcgactgc (SEQ ID NO.1) and MARCH2-R: TCTAGAACTAGTCTCGAGGAATTCTTACTTATCGTCGTCATCCTTGTAATCgacagtggtctcatccgc (SEQ ID NO.2)) were designed. Using DF-1 cell cDNA as a template, the MARCH2 coding sequence was amplified and inserted into the pLVX-mCherry vector to construct the pLVX-MARCH2-Flag lentiviral packaging plasmid.

[0040] 3. Construction and screening of MARCH2 overexpressing cell lines

[0041] The pLVX-MARCH2-Flag, pcGP, and pVSV-G plasmids were co-transfected into 293T cells to package lentivirus. The packaged MARCH2 lentivirus was used to infect DF-1 cells (chicken embryo fibroblasts). After 48 h of culture, cells exhibiting mCherry fluorescence were selected using flow cytometry and inoculated into 96-well plates at a dilution ratio of 5 cells / well. After 7 days, single-clonal cell lines were observed under an optical microscope and expanded. Western blotting was used to detect successful MARCH2 overexpression. Specifically, MARCH2-overexpressing cells were lysed with 100 μL of NP40 cell lysis buffer on ice for 30 min. Then, 25 μL of 5×loading protein loading buffer was added, and the cells were boiled at 100°C for 15 min. 10 μL of the lysate was subjected to SDS-PAGE gel electrophoresis, and the protein was then transferred to an NC membrane and blocked with 5% skim milk powder for 1 h. After incubation at room temperature for 1 h with mouse anti-Flag antibody and mouse anti-β-actin as primary antibodies, the NC membrane was washed 5 times with 1×PBST. Then, the membrane was incubated at room temperature for 1 h with goat anti-mouse IgG as secondary antibody, washed 5 times with 1×PBST, and then imaged using a near-infrared fluorescence scanning imaging system.

[0042] 4. Virus infection experiment

[0043] MARCH2 overexpressing cell lines and wild-type DF-1 cell lines were each selected and cultured at 5 × 10⁻⁶ cells / year. 5 The cells were laid in a 12-well plate at a density of 1 cell / well. After 16 h, ALV-A, ALV-B and ALV-J strains were inoculated at an inoculation dose of 0.1 MOI, with three parallel wells set up for each strain.

[0044] 5. Real-time quantitative PCR detection

[0045] Cells were collected 72 h post-infection using 200 μL PBS, and total RNA was extracted using the Trizol lysis method. Viral RNA was reverse transcribed using a Vazyme reverse transcription kit. First, 1 μg of viral RNA was mixed with 4 μL of 4×gDNA wiper Mix and brought to a final volume of 16 μL with RNase-free ddH2O. Genomic DNA was removed by incubation at 42°C for 2 min. Then, 4 μL of 5×HiscniptⅡqRT SupermixⅡ reverse transcriptase was added to the tube, and the mixture was incubated at 50°C for 15 min followed by incubation at 85°C for 5 s to obtain cDNA. Using cDNA as a template and β-actin as an internal reference gene, the relative quantification of ALV mRNA levels was performed using THUNDERBIRD™SYBR® Qpcr Mix fluorescent quantitative enzyme, following a procedure of 40 cycles at 95℃ for 30 s; 95℃ for 10 s; and 60℃ for 25 s. (Primers: RT-ALV-F: GCAGCGAGATGCGAAGAT (SEQ ID NO. 3), RT-ALV-R: CCGCCAGGGAAGGATACA (SEQ ID NO. 4); RT-actin-F: CAACACAGTGCTGTCTGGTGGTA (SEQ ID NO. 5), RT-actin-R: ATCGTACTCCTGCTTGCTGATCC (SEQ ID NO. 6).

[0046] 6. Western Blot Detection

[0047] Cells were lysed 72 h post-infection using 100 μL NP40 cell lysis buffer on ice for 30 min. Then, 25 μL of 5×loading protein loading buffer was added, and the cells were boiled at 100°C for 15 min. 10 μL of the lysate was subjected to SDS-PAGE gel electrophoresis, and the protein was transferred to an NC membrane and blocked with 5% skim milk powder for 1 h. After incubation at room temperature for 1 h with mouse anti-ALV p27 antibody and mouse anti-β-actin as primary antibodies, the NC membrane was washed 5 times with 1×PBST. Then, the membrane was incubated at room temperature for 1 h with goat anti-mouse IgG as secondary antibody, washed 5 times with 1×PBST, and finally imaged using a near-infrared fluorescence scanning imaging system.

[0048] result

[0049] 1. Construction and screening of MARCH2 overexpressing cell lines

[0050] Wild-type DF-1 cells were infected with packaged MARCH2 lentivirus. After 48 hours, mCherry fluorescence was clearly observed under an inverted fluorescence microscope. Cells exhibiting mCherry fluorescence were selected using a flow cytometry sorting system, and then expanded for single-cloning. Western blot analysis of the selected cell lines showed that a specific band was detected in the MARCH2 overexpression cell line, while no band was detected in the wild-type control group, indicating that the MARCH2 gene overexpression cell line was successfully constructed. Figure 1 ).

[0051] 2. MARCH2 overexpression inhibits ALV-A replication

[0052] To investigate the effect of MARCH2 gene overexpression on ALV-A replication, wild-type DF-1 cell lines and MARCH2-overexpressing DF-1 cell lines were infected with ALV-A, respectively. Cells were collected 72 h post-infection, and total RNA was extracted and reverse transcribed for RT-qPCR analysis. The results showed that, compared with the wild-type cell line, the viral load of ALV-A in the MARCH2-overexpressing DF-1 cell line was significantly reduced. Figure 2 This indicates that overexpression of MARCH2 can effectively inhibit ALV-A replication. To further verify this result, cells were collected 72 h post-infection for Western blot analysis to detect the expression of the viral structural protein p27. The results showed that in the DF-1 cell line overexpressing MARCH2, the viral protein level was significantly reduced ( Figure 3 This indicates that the DF-1 cell line overexpressing MARCH2 can effectively inhibit ALV-A replication compared to the wild-type cell line.

[0053] 3. MARCH2 overexpression inhibits ALV-B replication

[0054] To investigate the effect of MARCH2 gene overexpression on ALV-B replication, wild-type DF-1 cell lines and MARCH2-overexpressing DF-1 cell lines were infected with ALV-B, respectively. Cells were collected 72 h post-infection, and total RNA was extracted and reverse transcribed for RT-qPCR analysis. The results showed that, compared with the wild-type cell line, the viral load of ALV-B in the MARCH2-overexpressing DF-1 cell line was significantly reduced. Figure 4 This indicates that overexpression of MARCH2 can effectively inhibit ALV-B replication. To further verify this result, cells were collected 72 h post-infection for Western blot analysis to detect the expression of the viral structural protein p27. The results showed that the viral protein level was significantly reduced in the DF-1 cell line overexpressing MARCH2. Figure 5This indicates that, compared with wild-type cell lines, the DF-1 cell line overexpressing MARCH2 can effectively inhibit ALV-B replication.

[0055] 4. MARCH2 overexpression inhibits ALV-J replication.

[0056] To investigate the effect of MARCH2 gene overexpression on ALV-J replication, wild-type DF-1 cell lines and MARCH2-overexpressing DF-1 cell lines were infected with ALV-J. Cells were collected 72 h post-infection, and total RNA was extracted and reverse transcribed for RT-qPCR analysis. The results showed that, compared with the wild-type cell line, the viral load of ALV-J in the MARCH2-overexpressing DF-1 cell line was significantly reduced. Figure 6 This indicates that overexpression of MARCH2 can effectively inhibit ALV-J replication. To further verify this result, cells were collected 72 h post-infection for Western blot analysis to detect the expression of the viral structural protein p27. The results showed that the viral protein level was significantly reduced in the MARCH2-overexpressing DF-1 cell line. Figure 7 This indicates that the DF-1 cell line overexpressing MARCH2 can effectively inhibit ALV-J replication compared to the wild-type cell line.

Claims

1. The application of the MARCH2 gene overexpression vector in the preparation of a drug to inhibit the replication of avian leukosis virus, wherein the NCBI Gene ID of the MARCH2 gene is 420062, and the avian leukosis virus is subgroup A avian leukosis virus, subgroup B avian leukosis virus, or subgroup J avian leukosis virus.

2. The application according to claim 1, characterized in that, The MARCH2 gene overexpression vector is a lentiviral expression vector containing the MARCH2 gene.

3. The application according to claim 2, characterized in that, The lentiviral expression vector is a pLVX-mCherry vector containing the MARCH2 gene.

Citation Information

Patent Citations

  • Inhibitor for inhibiting virus replication and cancer cell proliferation

    CN115845038A