Recombinant adenovirus vector, replicative adenovirus recombinant based on vector and construction method of replicative adenovirus recombinant

Abstract

The invention discloses a novel recombinant adenovirus vector, a replicative adenovirus recombinant based on the vector and a construction method of the replicative adenovirus recombinant. The virus vector is constructed on the basis of wild chimpanzee adenovirus and can be used for constructing various oncolytic virus drugs or other biological products. A replicative adenovirus recombinant constructed based on the vector is constructed by combining wild chimpanzee adenovirus with a regulatory gene with specificity to tumor cells, early genes E1, E3 and E4 of the vector are completely or partially deleted, and exogenous nucleotide sequences are respectively inserted in the early genes E1, E3 and E4 in an innovative manner. The replicative adenovirus recombinant can be used as an oncolytic virus drug, and the construction method can be used for constructing drugs for treating various tumors, including drugs for treating and preventing kidney cancer, bladder cancer, liver cancer, lung cancer, stomach cancer, pancreatic cancer, brain cancer, rectal cancer, colon cancer, breast cancer, skin cancer, lymphoma, chest adenocarcinoma and the like.

Description

Technical Field

[0001] The present invention relates to immunotherapeutic oncolytic viruses, specifically chimpanzee adenoviruses that are genetically modified to construct recombinant viruses. The recombinant viruses have oncolytic functions, can improve the tumor microenvironment, kill cancer cells, and induce the human body to produce specific anti-tumor immune responses, thereby achieving the purpose of treating and preventing tumors. Background Art

[0002] Malignant tumors (commonly known as cancer) are the number one killer of human health. Statistics from the World Health Organization's International Agency for Research on Cancer (IARC) show that global cancer incidence and mortality rates are rising at an alarming rate. China is one of the countries with the highest number of new cancer cases and deaths. In China, the leading types of cancer in terms of new cases include lung cancer, colorectal cancer, thyroid cancer, and liver cancer. These diseases pose a constant threat to the health and lives of people in China and around the world.

[0003] Traditional treatments for cancer include surgery, chemotherapy, radiotherapy, and targeted therapy. However, due to the diversity and complexity of cancer, the shortcomings of traditional treatments are increasingly exposed. For example, traditional treatments produce drug resistance and the risk of serious side effects, and there are limited effective treatment options for advanced patients. With the development of modern biotechnology and the continuous deepening of research on cancer and immunology, cancer immunotherapy has gradually developed. Cancer immunotherapy is a new treatment model that uses the patient's own immune system to produce or amplify anti-cancer immune responses, aiming to fight tumor cells by stimulating and activating the patient's own immune system. Oncolytic viruses (OVs) are such a new type of tumor immunotherapy that can selectively infect and kill tumor cells while causing relatively little damage to normal cells. At the same time, oncolytic viruses can activate or enhance the body's anti-tumor immune response through multiple pathways, thereby achieving the dual effects of treating tumors and preventing tumor recurrence.

[0004] According to the virus generation process, oncolytic viruses are mainly divided into natural viruses and genetically modified viruses. Natural viruses include Newcastle disease virus, reovirus and measles virus, while most oncolytic viruses are the latter, that is, genetically modified viruses. Because genetic modification can improve the tumor specificity of the virus, thereby reducing its toxic side effects and enhancing the host's anti-tumor immune response. Common genetically modified oncolytic viruses include adenovirus, herpes virus and poxvirus, among which adenovirus is currently the most used virus in clinical trials worldwide. In addition, the world's first approved oncolytic virus drug (Ankorui) is a genetically modified adenovirus, which is mainly used to treat head and neck tumors. The many characteristics of adenovirus vectors give it unique advantages in tumor immunotherapy. These characteristics include: good safety, ability to infect multiple cells, ability to simultaneously activate cellular immune responses and humoral immune responses, in-depth research on the physiological characteristics of adenoviruses, ease of genetic modification, and large-scale commercial production.

[0005] At present, the most studied and applied oncolytic viruses are adenovirus vectors based on human adenovirus type 5 (AdHu5). However, this adenovirus vector also has certain limitations. The main problem is that there is a high proportion of neutralizing antibodies against the virus in the population, and this pre-existing immunity limits its therapeutic effect to a certain extent. Secondly, human adenovirus type 5 has liver tropism and certain liver toxicity, which is mainly caused by the direct binding of its capsid protein Hexon to coagulation factor X. Therefore, it is necessary to find an adenovirus vector that performs better in these two aspects.

[0006] Rare chimpanzee adenovirus serotypes offer a promising solution to both of these challenges. First, humans have low pre-existing immunity to chimpanzee adenoviruses. Second, the chimpanzee adenovirus Hexon protein does not bind well to coagulation factor X, thus lacking liver tropism and the resulting hepatotoxicity. Furthermore, chimpanzee adenoviruses are more effective in inducing cellular immunity, which is crucial for clearing tumor cells.

[0007] From a commercial perspective, in order to achieve drug marketing, oncolytic viruses need to be produced on a large scale and accurately quantified. The cells commonly used to produce adenoviruses and test infectious titers are HEK293 cells, which carry the human adenovirus E1 gene. Due to the mismatch between the gene products of human adenovirus and the E4 gene products of chimpanzee adenovirus, the production of chimpanzee adenovirus in HEK293 and the expression of Hexon protein used for infectious titer detection are both low. Therefore, chimpanzee adenovirus needs to be modified to address these two key issues.

[0008] Overall, although chimpanzee adenovirus has been widely used in the field of preventive vaccines, its application in tumor immunotherapy is still very rare. Currently, there is a lack of chimpanzee adenovirus products for tumor immunotherapy on the market, and related research results have many shortcomings, which cannot fully utilize the advantages of chimpanzee adenovirus, especially in terms of therapeutic effect, large-scale production, convenient construction, and reduced toxicity risks. The advantages of chimpanzee adenovirus have not been fully utilized to make it suitable for clinical application. Therefore, further genetic modification research on chimpanzee adenovirus and the development of immunotherapeutic oncolytic viruses for clinical use are necessary, and are also one of the main research directions in this field.

[0009] Due to the above-mentioned problems with current oncolytic viruses and the urgent need for safer, non-toxic and more effective oncolytic virus platforms in clinical tumor treatment, the research results of the present invention on the genetic modification of chimpanzee adenovirus can meet this demand. Summary of the Invention

[0010] To this end, an embodiment of the present invention provides a method for inserting an exogenous sequence specific to tumor cells into a chimpanzee adenovirus. This method can conveniently use chimpanzee adenovirus as an oncolytic virus platform to construct a viral recombinant specific to tumor cells, so that the recombinant has the ability to kill tumor cells and form immunity to cancer cells in the human body.

[0011] According to a first aspect of an embodiment of the present invention, a recombinant adenovirus vector is provided, which uses a chimpanzee adenovirus genome sequence or a modified form thereof as a basic nucleotide sequence; the 458..3413 region of the early gene sequence E1 of the basic nucleotide sequence is deleted, and a first exogenous nucleotide sequence is inserted into the deleted 458..3413 region; the 28008..31024 region of the early gene sequence E3 of the basic nucleotide sequence is deleted, and a second exogenous nucleotide sequence is inserted into the deleted 28008..31024 region; the 33841..34746 region of the early gene sequence E4 of the basic nucleotide sequence is deleted, and a third exogenous nucleotide sequence is inserted into the deleted 33841..34746 region; wherein the first exogenous nucleotide sequence, the second exogenous nucleotide sequence, and the third exogenous nucleotide sequence respectively contain nucleotide sequences that are conducive to the insertion of other exogenous nucleotides or placeholder nucleotide sequences.

[0012] The viral vector proposed by the present invention further comprises: adding a fourth exogenous nucleotide sequence containing multiple enzyme cleavage sites to one end of the basic nucleotide sequence.

[0013] The viral vector proposed by the present invention further comprises: adding a PacI restriction site at the other end of the basic nucleotide sequence.

[0014] In the viral vector proposed by the present invention, the first exogenous nucleotide sequence contains two non-palindromic I-CeuI restriction enzyme cleavage sites, and the use of the two I-CeuI restriction enzyme cleavage sites is highly specific.

[0015] In the viral vector proposed by the present invention, a placeholder nucleotide sequence is inserted between the two I-CeuI restriction sites.

[0016] In the viral vector proposed by the present invention, the placeholder nucleotide sequence is the full-length eGFP encoding gene.

[0017] In the viral vector proposed by the present invention, the second exogenous nucleotide sequence comprises two non-palindromic I-SceI restriction enzyme cleavage sites, and the use of the two I-SceI restriction enzyme cleavage sites is highly specific.

[0018] In the viral vector proposed by the present invention, a placeholder nucleotide sequence can be inserted between the two I-SceI restriction sites.

[0019] In the viral vector proposed by the present invention, the placeholder nucleotide sequence is 1-300 bp of the eGFP encoding nucleotide sequence.

[0020] In the viral vector proposed by the present invention, the third exogenous nucleotide sequence is the e4orf6 gene of human adenovirus type 5, which is used to replace the wild-type chimpanzee adenovirus e4orf6 gene.

[0021] According to a second aspect of an embodiment of the present invention, a replicative adenovirus recombinant is provided, which is based on a recombinant chimpanzee adenovirus vector nucleotide sequence. The recombinant is further characterized in that the early gene sequence E1 region of the basic nucleotide sequence is modified, including deleting the 3381...4354 region of the early gene sequence E1 region of the basic nucleotide sequence, and inserting a seventh exogenous nucleotide sequence into the deleted 3381..4354 region; the early gene sequence E3 region of the basic nucleotide sequence is modified, including deleting the 28575..29114 region of the early gene sequence E3 region of the basic nucleotide sequence, and inserting one of an eighth exogenous nucleotide sequence, a ninth exogenous nucleotide sequence, and a tenth exogenous nucleotide sequence into the deleted 28575..29114 region; wherein the seventh exogenous nucleotide sequence, the eighth exogenous nucleotide sequence, the ninth exogenous nucleotide sequence, and the tenth exogenous nucleotide sequence respectively include at least one of the chimpanzee adenovirus E1 gene, a promoter sequence regulating the E1 gene, or an immune regulatory factor gene sequence.

[0022] In the adenovirus recombinant proposed by the present invention, the seventh exogenous nucleotide sequence is a nucleotide sequence comprising the mP-E1AB element.

[0023] In the adenovirus recombinant proposed by the present invention, the mP-E1AB element comprises wild-type chimpanzee adenovirus e1a and e1b genes and a tumor-specific promoter (mP) that controls the expression of the wild-type e1a and e1b genes.

[0024] The adenovirus recombinant proposed by the present invention, wherein the tumor-specific promoter (mP) is one of the modified human telomerase reverse transcriptase (hTERT) promoter, E2F-1 promoter, survivin promoter, AFP promoter, a2bm promoter, CEA promoter and PSA promoter.

[0025] In the adenovirus recombinant proposed by the present invention, the eighth exogenous nucleotide sequence, the ninth exogenous nucleotide sequence and the tenth exogenous nucleotide sequence respectively encode granulocyte monocyte colony-stimulating factor protein (GM-CSF) or one of other sequences containing GM-CSF protein.

[0026] In the adenovirus recombinant proposed by the present invention, the GM-CSF protein encoded is wild-type human GM-CSF protein, a mutant of wild-type human GM-CSF protein, or mouse GM-CSF protein.

[0027] The adenovirus recombinant proposed by the present invention, wherein the encoded GM-CSF protein is an immunomodulatory protein with a wide range of functions, including stimulating the differentiation of various immune cells, stimulating antigen cell presentation, promoting T cell activation, infiltration and B cell differentiation

[0028] According to another aspect of an embodiment of the present invention, a method for constructing a replicative adenovirus recombinant is provided, wherein the method uses a chimpanzee adenovirus nucleotide sequence or a modified product thereof as the basic nucleotide sequence. The recombinant construction method is further characterized in that the early gene sequence E1 region of the basic nucleotide sequence is modified, including deleting the 3381..4354 region of the early gene sequence E1 region of the basic nucleotide sequence and inserting a first exogenous nucleotide sequence into the deleted region of E1; the early gene sequence E3 region of the basic nucleotide sequence is modified, including deleting the 28575..29114 region of the early gene sequence E3 region of the basic nucleotide sequence and inserting one of a second exogenous nucleotide sequence, a third exogenous nucleotide sequence, and a fourth exogenous nucleotide sequence into the deleted region of E3, wherein the first exogenous nucleotide sequence, the second exogenous nucleotide sequence, the third exogenous nucleotide sequence, and the fourth exogenous nucleotide sequence respectively include the chimpanzee adenovirus E1 gene and promoter sequence and the immune regulatory factor nucleotide sequence.

[0029] The method for constructing a replicative adenovirus recombinant proposed by the present invention, wherein the modification of the early gene sequence E1 region includes cloning the basic nucleotide sequence into a vector containing two oligonucleotide chains to obtain a first intermediate plasmid; wherein the two oligonucleotide chains contain SbfI and other enzyme cutting sites.

[0030] The method for constructing a replicative adenovirus recombinant proposed by the present invention further comprises: annealing the two oligonucleotide chains to form a double-stranded DNA fragment with sticky ends.

[0031] The method for constructing a replicative adenovirus recombinant proposed by the present invention further comprises: cloning a double-stranded DNA fragment with sticky ends into a pUC57-Kan vector that has been digested with enzymes.

[0032] The method for constructing a replicative adenovirus recombinant proposed by the present invention further comprises: cloning a fragment containing the I-PI nucleotide sequence into the first intermediate plasmid to obtain a second intermediate plasmid.

[0033] The method for constructing a replicative adenovirus recombinant proposed by the present invention further comprises: connecting a fragment containing the wild-type gene of chimpanzee adenovirus C6 to a fragment of the second intermediate plasmid to obtain a third intermediate plasmid.

[0034] The method for constructing a replicative adenovirus recombinant proposed by the present invention further comprises: constructing a gene segment comprising wild-type e1a and e1b genes of chimpanzee adenovirus C6.

[0035] The method for constructing a replicative adenovirus recombinant proposed by the present invention, wherein the construction of the gene segment containing e1a and e1b further comprises inserting an optimized human telomerase reverse transcriptase promoter (mP) upstream of the e1a and e1b genes.

[0036] The method for constructing a replicative adenovirus recombinant proposed by the present invention, wherein the modification of the early gene sequence E3 region includes restriction endonuclease of the basic nucleotide sequence and then constructing a subcloning vector by self-ligation.

[0037] The method for constructing a replicative adenovirus recombinant proposed by the present invention further comprises: ligating a plasmid fragment containing a GM-CSF protein encoding gene into a fragment of the subcloning vector to obtain a fourth intermediate plasmid; wherein the GM-CSF protein encoding gene sequence is one of a wild-type human GM-CSF protein encoding gene, a wild-type human GM-CSF protein mutant encoding gene, and a mouse GM-CSF protein encoding gene.

[0038] The method for constructing a replicative adenovirus recombinant proposed by the present invention comprises: synthesizing a sequence comprising a GM-CSF protein encoding gene, and cloning the sequence comprising the GM-CSF protein encoding gene into a pUC57-Kan vector to obtain a plasmid comprising the GM-CSF protein encoding gene.

[0039] The method for constructing a replicative adenovirus recombinant proposed by the present invention comprises: connecting the fourth intermediate plasmid into the third intermediate plasmid.

[0040] The method for constructing a replicative adenovirus recombinant proposed by the present invention comprises: enzymatically cutting the fourth intermediate plasmid and linearizing it.

[0041] The present invention utilizes traditional molecular cloning combined with short-fragment gene synthesis to construct plasmids. Therefore, the construction method described below is more economical, convenient, and flexible. The plasmid intermediates generated during the construction process can also be used in other molecular cloning experiments, achieving multiple goals at once. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.

[0043] Figure 1 Schematic diagram of the construction of chimpanzee adenovirus vector pSKM1;

[0044] Figure 2 This is a schematic overview of the construction of the pSKM_KK010 series of plasmids using the pSKM1 nucleotide sequence as a vector;

[0045] Figure 3 Flowchart for transformation of region 3381..4354 of the pSKM1 vector;

[0046] Figure 4 Flowchart for the transformation of region 28575..29114 of the pSKM1 vector;

[0047] Figure 5 Flowchart for the construction of pSKM_KK010(h);

[0048] Figure 6 Shown is a schematic diagram of the enzyme digestion identification results of the pSKM_KK010(h) plasmid;

[0049] Figure 7Shown is a schematic diagram of the enzyme digestion identification results of the pSKM_KK010(m) plasmid:

[0050] Figure 8 Shown is a schematic diagram of the enzyme digestion identification results of the pSKM_KK010(v) plasmid;

[0051] Figure 9 Shown is a schematic diagram of the results of the cesium chloride density gradient centrifugation experiment of SKM_KK010 virus;

[0052] Figure 10 -A to 10-C are the AseI and BglII restriction maps of the viral genomes of SKM_KK010(h), SKM_KK010(m), and SKM_KK010(v), respectively;

[0053] Figure 11 -A to 11-D are experimental results of enzyme digestion identification of SKM_KK010(h) viral genome and viral genome passage stability;

[0054] Figure 12 Shown are comparison images of HEK293 cells transfected with the recombinant chimpanzee adenovirus before and after the modification of the 33841..34746 (e4orf6) region of the chimpanzee adenovirus SAdV23 genome by the present invention;

[0055] Figure 13 The figure shows a comparison of the yield of well-packaged virus particles obtained by cesium chloride density gradient centrifugation before and after virus e4orf6 modification;

[0056] Figure 14 Shown is a comparison of the killing effects of the chimpanzee adenovirus modified form SKM_KK010 (h) on normal cells and cancer cells;

[0057] Figure 15 Shown is a schematic diagram of the replication of different cells after 72 h of infection with SKM_KK010(h);

[0058] Figure 16 Shown is a diagram of the dynamic killing experiment analysis of cells by the virus modification SKM_KK010 (h);

[0059] Figure 17 Shown is a schematic diagram of the experimental results of SKM_KK010(h)'s inhibitory effect on tumors in nude mice bearing LoVo tumors;

[0060] Figure 18 Shown are the experimental results of cell survival after different cells were infected with different doses of SKM_KK010(h) for 10 days. DETAILED DESCRIPTION

[0061] The following describes the embodiments of the present invention by means of specific embodiments in conjunction with the accompanying drawings. Those skilled in the art can easily understand the other advantages and effects of the present invention from the contents disclosed in this specification. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. All other embodiments obtained by persons of ordinary skill in the art based on the embodiments of the present invention without creative work are within the scope of protection of the present invention.

[0062] The present invention includes two aspects. One aspect discloses a molecular cloning structure pSKM1 and a construction process thereof. The other aspect discloses a viral recombinant constructed based on the molecular cloning structure pSKM1 and a corresponding construction process thereof.

[0063] First, in the process of constructing the molecular cloning structure pSKM1 of the present invention, by selecting optimized restriction sites, this molecular cloning structure perfectly solves the problem of combining chimpanzee adenovirus as an oncolytic virus vector with various exogenous genes. The molecular cloning structure pSKM1 can be used as a basic nucleotide sequence for constructing various viral vector biological products, including but not limited to therapeutic oncolytic viruses, tumor vaccines, and preventive vaccines. pSKM1 is a recombinant adenovirus vector platform that is designed and modified based on the chimpanzee adenovirus nucleotide sequence available on the market and constructed using a gene synthesis method. As a viral basic nucleotide sequence, pSKM1 can be used to construct a series of conditionally replicating oncolytic viruses, and can also be used to construct non-replicating viruses, etc. More specifically, pSKM1 is a recombinant chimpanzee adenovirus vector platform constructed by the above method based on the nucleotide sequence of wild-type chimpanzee adenovirus SAdV23 (also known as C6 or AdC6), wherein the SAdV23 gene sequence is at the National Center for Biotechnology Information (NCBI) with an accession number (ACCESSION No.) of AY530877.1.

[0064] 1. Description of the construction of the pSKM1 molecular clone

[0065] Figure 1 Shown is a schematic diagram of the construction of pSKM1 nucleotide sequence using the chimpanzee adenovirus SAdV23 genome sequence. Figure 1 As shown in the middle mark ①, the length of the SAdV23 genome sequence AY530877.1 is 36604 bp, which includes the regions 458..3413, 28008..31024, 33841..34746, etc. that are replaced in the present invention.

[0066] like Figure 1As shown, pSKM1④ is a recombinant chimpanzee adenovirus vector platform designed and modified based on the wild-type chimpanzee adenovirus SAdV23 genome sequence, and constructed using the whole gene synthesis method. The DNA sequence of this platform has at least the following five characteristics: first, the 458..3413 region of the wild-type chimpanzee adenovirus SAdV23 genome sequence is deleted, and the SEQ1 sequence is inserted into the deleted region; second, the 28008..31024 region of the wild-type chimpanzee adenovirus SAdV23 genome sequence is deleted, and the SEQ2 sequence is inserted into the deleted region; third, the 33841..34746 region of the wild-type chimpanzee adenovirus SAdV23 genome sequence is deleted, and SEQ3 is inserted into the deleted region; fourth, a SEQ4 sequence containing some restriction sites is added to the 5' end of the wild-type chimpanzee adenovirus SAdV23 genome sequence; fifth, a PacI restriction site is added to the 3' end of the wild-type chimpanzee adenovirus SAdV23 genome sequence. The above five-step design work was all performed in professional software The above was completed, and the final nucleotide sequence was named SKM_C6Syn1 (hereinafter referred to as SEQ5). The designed nucleotide sequence was subjected to gene synthesis to form Figure 1 The nucleotide sequence shown in the middle mark ② is SEQ5. The nucleotide sequence is 31750 bp long, includes SEQ1-SEQ4, and contains a PacI restriction site at the 3' end.

[0067] like Figure 1 As shown, plasmid pUC57-Brick③ is used as the vector backbone. The plasmid is 5424bp in length and contains at least nucleotide sequences such as the ampicillin resistance gene promoter (AmpR promoter), the ampicillin resistance gene (AmpR) and the replication origin (ori), and contains an EcoRV restriction site. The nucleotide sequence SEQ5② is cloned into the EcoRV site of the pUC57-Brick plasmid③ to form the recombinant chimpanzee adenovirus platform plasmid pSKM1 (SEQ6)④. Figure 1 As shown, the platform plasmid pSKM1④ is 37174 bp in length, and contains the nucleotide sequences of SEQ1-4, pUC57-Brick③, 3'-ITR, 5'-ITR, etc., and also contains restriction sites such as PacI.

[0068] The above-mentioned design and transformation for the construction of pSKM1 (SEQ6) are of extraordinary significance for the construction of oncolytic virus products, and the logic behind it and the corresponding uses are reflected in each step. Specifically, first, the wild-type chimpanzee adenovirus 458..3413 region is deleted, that is, the chimpanzee adenovirus e1a and e1b early genes are deleted, wherein the e1b gene is composed of two proteins encoding 19kDa and 55kDa, so that the chimpanzee adenovirus is converted into a replication-defective virus. This operation enhances the safety of the virus as a viral vector while releasing about 2.9kb of space for the insertion of exogenous nucleotide sequences. At the same time, in order to facilitate the insertion of exogenous nucleotide sequences into the space formed by the deletion, the SEQ1 sequence replaced here contains two non-palindromic enzyme cutting sites I-CeuI. The use of these two enzyme cutting sites is both highly specific and clarifies the directionality of the insertion of exogenous nucleotide sequences, making cloning more convenient and accurate. Any placeholder nucleotide sequence of suitable length can be inserted between the two I-CeuI restriction enzyme sites to accurately distinguish whether the enzyme cutting is complete. The placeholder nucleotide sequence provided here is the full-length eGFP coding gene. Second, delete the virus 28008..31024 region. That is, the open reading frame 3-7 (E3ORF3-7) of the wild chimpanzee adenovirus E3 region. This operation can further release about 3kb of space for exogenous nucleotide sequences in the viral vector. To facilitate the insertion of exogenous nucleotide sequences, the SEQ2 sequence replaced here contains two non-palindromic restriction enzyme sites I-SceI. The use of these two sites is highly specific and clarifies the directionality of the insertion of exogenous nucleotide sequences, making cloning more convenient and accurate. Any placeholder nucleotide sequence of suitable length can be inserted between the two I-SceI to accurately distinguish whether the enzyme cutting is complete. The placeholder nucleotide sequence provided here is 1-300bp of the eGFP coding gene. Third, replacing the wild-type chimpanzee adenovirus region 33841..34746 with SEQ3 effectively replaces the e4orf6 gene (encoding the E4ORF6 protein) of wild-type chimpanzee adenovirus SAdV23 with the e4orf6 gene of human adenovirus type 5; this manipulation could theoretically further improve the growth and virus yield of the recombinant chimpanzee adenovirus in human embryonic cells, such as human embryonic kidney 293 (HEK293) cells. Fourth, this step introduces PacI restriction sites at both ends of the genome. Subsequent enzyme digestion of the recombinant viral vector using the PacI restriction sites exposes the linear viral genome for HEK293 cell transfection and recombinant virus rescue.

[0069] The following uses the construction process of the pSKM_KK010 series oncolytic virus vectors as an example to illustrate the process of constructing recombinant chimpanzee adenovirus based on the pSKM1④ nucleotide sequence through gene synthesis and traditional molecular cloning methods.

[0070] 2. Description of molecular cloning and construction of pSKM_KK010 series oncolytic virus vectors

[0071] 2.1 Overview of pSKM_KK010 Series Plasmid Transformation

[0072] Figure 2 This is an overview of the transformation of the oncolytic virus pSKM_KK010 series plasmids, where the pSKM_KK010 series includes pSKM_KK010(h)②, pSKM_KK010(m)③, and pSKM_KK010(v)④, etc.

[0073] like Figure 2 As shown, the oncolytic virus pSKM_KK010 series is a series of oncolytic viruses designed and modified based on the recombinant adenovirus vector pSKM1①, and constructed by combining gene synthesis and traditional molecular cloning methods. The pSKM_KK010 series viruses include but are not limited to pSKM_KK010(h)②, pSKM_KK010(m)③ and pSKM_KK010(v)④, etc. The nucleotide sequence of this series of oncolytic viruses has at least the following characteristics: first, the 3381..4354 region of the recombinant chimpanzee adenovirus vector pSKM1① is deleted, and a sequence containing the mP-E1AB element is inserted into the deleted region (hereinafter referred to as SEQ7); second, the 28575..29114 region of the recombinant chimpanzee adenovirus vector pSKM1① is deleted, and a sequence containing the granulocyte monocyte colony stimulating factor protein (GM-CSF protein) is inserted into the deleted region (hereinafter referred to as SEQ8, SEQ9 or SEQ10).

[0074] According to the sequences SEQ6-SEQ10 provided by the present invention, the above characteristics can be designed and the whole gene synthesis method can be used to directly obtain Figure 2 The pSKM_KK010(h)②, pSKM_KK010(m)③, or pSKM_KK010(v)④ plasmids shown are shown. However, such construction methods are extremely costly and time-consuming, and the synthesis of long nucleotide fragments carries a certain risk of failure. Furthermore, the flexibility for subsequent plasmid modification is greatly reduced. The present invention, however, utilizes traditional molecular cloning combined with short-fragment gene synthesis to achieve plasmid construction. Therefore, construction using the following methods of the present invention is more economical, convenient, and flexible. The plasmid intermediates generated during the construction process can also be used in other molecular cloning experiments, achieving multiple goals at once.

[0075] The above-mentioned design and modification of the oncolytic virus are very important for constructing the oncolytic virus of the present invention, and the logic behind it and the corresponding uses are reflected in each step. Specifically, firstly, the mP-E1AB element replacing the 3381..4354 region contains wild-type e1a, e1b genes and a tumor-specific promoter (mP) that controls their expression. The reintroduced e1a and e1b genes can restore the replication ability of the recombinant virus, but this replication ability is regulated by the tumor-specific promoter, so that the recombinant virus only selectively proliferates in tumor cells, while having almost no effect on normal cells, thereby reducing or even eliminating the toxicity of the oncolytic virus used as a drug. Tumor-specific promoters can have many options, such as human telomerase reverse transcriptase (hTERT) promoter, E2F-1 promoter, survivin promoter, AFP promoter, a2bm promoter, CEA promoter and PSA promoter nucleotide sequences, etc. Here, the human telomerase reverse transcriptase (hTERT) promoter is selected to be transformed to form an mP promoter with better tumor specificity.

[0076] Secondly, the GM-CSF protein encoding sequence (cDNA) is introduced here. Its expression is regulated by the viral E3 gene promoter, further enhancing the specific expression of GM-CSF in tumor cells. GM-CSF is an immunomodulatory protein with broad functions. It can stimulate the differentiation of various immune cells, including granulocytes, monocytes, macrophages, and dendritic cells. It can also stimulate the function of antigen-presenting cells, promote T cell activation and infiltration, and B cell differentiation. Therefore, it is used in clinical practice in combination with immune checkpoint inhibitors for tumor immunotherapy. The three GM-CSF encoding genes used here include wild-type human GM-CSF (hereinafter referred to as "hCSF2"), a mutant human GM-CSF (hereinafter referred to as "hCSF2v"), and mouse GM-CSF (hereinafter referred to as "mCSF"). Because human GM-CSF cannot bind to the mouse GM-CSF receptor and function, a recombinant virus expressing mouse GM-CSF was constructed specifically to test the recombinant virus's ability to activate anti-tumor immunity in immunocompetent mice. There are also many options for immunomodulatory proteins expressed here, such as cytokines IL-2, IL-12, IL-15, etc.; chemokines CXCL10, CCL5, etc.; co-stimulatory molecules CD40L, 4-1BBL, etc.; immune checkpoint inhibitors PD-1 / PD-L1 antibodies and other nucleotide sequences.

[0077] In a preferred embodiment, the various nucleotide sequence fragments required for the transformation of pSKM1① are obtained by gene synthesis and cloned into commonly used cloning vectors pUC57, pUC19 or their derivative vectors, and then inserted into pSKM1① through commonly used molecular cloning methods to complete the final transformation.

[0078] 2.2 Detailed process of pSKM_KK010 series plasmid construction

[0079] Figure 3-Figure 5 Detailed flow chart for the construction of pSKM_KK010 series plasmids. To transform the pSKM1 vector into the pSKM_KK010 series plasmids, the 3381..4354 region of the pSKM1 vector ② needs to be modified, such as Figure 3 As shown; the 28575..29114 region of the pSKM1 vector must also be transformed, as shown Figure 4 As shown; Finally, Figure 3 and Figure 4 The products are connected together, Figure 5 Plasmid pSKM1-sub-E3(hCSF2)①( Figure 4 ④) and pUC-SKM1-subl.2-mP-E1AB②( Figure 3 Each transformation process includes several steps. The following describes each specific step in detail.

[0080] 2.2.1 pSKM1 vector 3381.4354 region modification

[0081] Figure 3 The figure is a flow chart for modifying the 3381..4354 region of the pSKM1 vector. Figure 3 As shown, the transformation of the ②3381..4354 region of the pSKM1 vector includes at least the following three steps.

[0082] like Figure 3 As shown, the first step is to construct the pUC57AddSbfI vector①. The construction process is: first design and synthesize two oligonucleotide chains containing SbfI and some other restriction sites:

[0083] MCS-TOP GATCCGTTTAAACCCTGCAGGACGCGTATTTAAATT and

[0084] MCS-BOTTOM CTAGAATTTAAATACGCGTCCTGCAGGGTTTTAAACG.

[0085] Then, the oligonucleotide chains were annealed to form double-stranded DNA fragments with sticky ends: the pUC57-Kan vector (length 2579 bp, its nucleotide sequence can be obtained at https: / / www.snapgene.com / plasmids / bbasic_cloning_vectors / pUC57-Kan) was digested with BamHI and XbaI, and the double-stranded gene fragment was cloned into the pUC57-Kan vector after digestion (length 2569 bp), thereby obtaining the above-mentioned pUC57_AddSbfI vector①. Then, pSKM1 vector ② is digested with restriction endonuclease SbfI, and a 20,527 bp nucleotide fragment is obtained after digestion. pUC57-AddSbfI vector ① is taken, and the 20,527 bp nucleotide fragment of pSKM1 vector ② is cloned into the SbfI site of pUC57-AddSbfI vector ① to form plasmid pUC-SKM1-sub1.1③ (the "first intermediate plasmid" in the claims), as shown in Step 1.1 in the figure. pUC57_AddSbfI vector ① is modified from pUC57-Kan, which (not shown) can be purchased from Wuhan Miaoling Biotechnology Co., Ltd. under the product number #P0089.

[0086] The plasmid pUC-SKM1-subl.1③ is 23132bp in length, and includes at least the kanamycin resistance gene (KanR) gene sequence, the ori nucleotide sequence, and also includes at least a SnaBI restriction site, two I-CeuI restriction sites, and an FseI restriction site.

[0087] Step 2, see Figure 3Step 1.2. Take the plasmid pUC19-I-PI④, which is 4146bp in length and includes at least the AmpR gene sequence and the ori nucleotide sequence, and also includes at least one SnaBI and one FseI restriction enzyme site. The pUC19-I-PI④ is formed by cloning a gene-synthesized sequence I-PI (hereinafter referred to as SEQ11) into the SmaI restriction enzyme site of pUC19 (not shown in the figure). The I-PI sequence includes at least one SnaBI, one I-CeuI restriction enzyme site, one PI-SceI restriction enzyme site and one FseI restriction enzyme site; between the I-CeuI restriction enzyme site and the PI-SceI restriction enzyme site, a full-length eGFP coding sequence (not shown in the figure) is also included as a placeholder nucleotide sequence. In this step, the plasmid pUC19-I-PI④ was digested with SnaBI and FseI to obtain a 1457 bp fragment; the plasmid pUC-SKM1-subl.1③ obtained in the first step was digested with SnaBI and FseI to obtain a 22159 bp fragment after digestion; the 1457 bp fragment after digestion of pUC19-I-PI④ was cloned into the 22159 bp fragment obtained after digestion of pUC-SKM1-subl.1③ to form the plasmid pUC-SKM1-subl.2⑤ (the "second intermediate plasmid" in the claims), see Figure 3 In Step 1.2, the plasmid pUC-SKM1-sub1.2⑤ is 23616 bp in length and includes at least the KanR gene sequence, the ori nucleotide sequence, and at least the SbfI restriction site, the I-CeuI restriction site, and the PI-SceI restriction site.

[0088] Step 3: See Figure 3 Step 1.3. First, construct the plasmid pUC57I-mP-E1AB-PI⑥, first use professional gene design software A nucleotide sequence, I-mP-E1AB-PI (not shown), was designed. This I-mP-E1AB-PI nucleotide sequence contained at least one I-CeuI restriction site and one PI-SceI restriction site; it also contained at least the wild-type e1a and e1b genes of chimpanzee adenovirus C6, with a modified and optimized human telomerase reverse transcriptase (hTERT) promoter (mP) nucleotide sequence inserted upstream of these genes. The mP nucleotide sequence selectively promoted transcription of the e1a and e1b genes in tumor cells. The I-mP-E1AB-PI gene sequence was split into four segments, each of which was synthesized and cloned into the EcoRV site of the commonly used pUC57 vector to generate four plasmids. Three of the four plasmids were used as templates for PCR amplification to obtain three double-stranded DNA fragments. The fourth plasmid was digested with SacI. The three double-stranded DNA fragments were ligated into the fourth plasmid after digestion by seamless cloning to form the vector pUC57_I-mP-E1AB-PI⑥.

[0089] Take the plasmid pUC57_I-mP-E1AB-PI⑥ (hereinafter referred to as SEQ12, the construction process is described above). The plasmid is 5940 bp in length and includes at least the KanR gene sequence, the ori nucleotide sequence, the mP nucleotide sequence, and the early gene e1a. The plasmid also includes an I-CeuI restriction site and a PI-SceI restriction site. In addition, the plasmid also includes at least 19 kDa and 55 kDa gene sequences.

[0090] Next, the plasmid pUC57_I-mP-E1AB-PI⑥ was digested with I-CeuI and PI-SceI to obtain a 3320 bp fragment; the plasmid pUC-SKM1-sub1.2⑤ was double-digested with the same I-CeuI and PI-SceI to obtain a 22873 bp fragment; then the 3320 bp fragment obtained by digestion of pUC57_I-mP-E1AB-PI⑥ was ligated to the 22873 bp fragment obtained by digestion of pUC-SKM1-subl.2 to form the plasmid pUC57-SKM1-subl.2-mP-E1AB⑦ (the "third intermediate plasmid" in the claims). The plasmid pUC57-SKM1-subl.2-mP-E1AB⑦ is 26193 bp in length and includes at least the KanR gene sequence, ori nucleotide sequence, mP nucleotide sequence, e1a gene, and e1b gene (19 kDa and 55 kDa in the figure), as well as at least two SbfI restriction sites, one I-CeuI restriction site, and one PI-SceI restriction site.

[0091] 2.2.2 pSKM1 vector 28575..29114 region modification

[0092] Figure 4 Schematic diagram of the transformation of region 28575..29114 of the pSKM1 vector. Figure 4 As shown, modification of the 28575..29114 region requires two steps. As mentioned above, the pSKM1 vector ① is 37174 bp in length and includes at least two annotated deletion regions: the 3381..4354 region and the 28575..29114 region. Additionally, the pSKM1 vector ① contains two restriction enzymes, SbfI.

[0093] First, the pSKM1 vector ① was digested with the restriction endonuclease SbfI, and the 16647 bp fragment obtained after digestion was constructed into the subcloning vector pSKM1-sub② by self-ligation. Figure 4 As shown, the subcloning vector pSKM1-sub② is 16647 bp in length, including at least one 3'-ITR sequence, an AmpR gene sequence and an ori nucleotide sequence, and also includes at least SbfI restriction site, SwaI restriction site and BspEI restriction site.

[0094] Take plasmid pUC57-E3(hCSF2)③. Plasmid pUC57-E3(hCSF2)③ is 4277 bp long and includes at least the KanR gene sequence, the hCSF2 gene sequence, and the ori nucleotide sequence, as well as at least the BspEI and Swal restriction sites. Digest plasmid pUC57-E3(hCSF2)③ with restriction endonucleases BspEI and Swal, obtaining a 1693 bp fragment. Digest pSKM1-sub② with BspEI and Swal, obtaining a 14863 bp fragment. Ligate the 1693 bp fragment obtained from digestion of pUC57-E3(hCSF2)③ into the 14863 bp fragment obtained from digestion of pSKM1-sub②, forming plasmid pSKM1-sub-E3(hCSF2)④ (the "fourth intermediate plasmid" in the claims). Plasmid pSKM1-sub-E3(hCSF2)④ is 16556 bp in length and includes at least the 3'-ITR gene sequence, the AmpR gene sequence, the ori nucleotide sequence, and the hCSF2 gene sequence. It also includes at least the SbfI restriction site, the Swal restriction site, and the BspEI restriction site.

[0095] The above-mentioned pUC57-E3 (hCSF2) ③ was obtained by gene synthesis of the E3-hCSF2 sequence (hereinafter referred to as SEQ13) and cloning it into the EcoRV site of the pUC57-Kan vector (its nucleotide sequence can be obtained at https: / / www.snapgene.com / plasmids / basic_cloning_vectors / pUC57-Kan) (the E3-hCSF2 sequence and the pUC57-Kan vector are not shown in the figure), wherein E3 is the original E3 region genomic sequence between the two restriction sites of BspEI and SwaI.

[0096] 2.2.3 Construction of pSKM_KK010(h) plasmid

[0097] Figure 5 Figure 3 is a schematic diagram of the construction process of the complete pSKM_KK010(h)③ plasmid. Figure 5 As shown in , plasmid pSKM_KK010(h)

[0098] ③ is formed by enzyme digestion and ligation of plasmids pSKM1-sub-E3(hCSF2)① and pUC-SKM1-sub1.2-mP-E1AB②. Plasmid pSKM1-sub-E3(hCSF2)① is 16,556 bp long and contains at least the hCSF2 gene sequence, 3'-ITR sequence, AmpR gene sequence, and ori nucleotide sequence, as well as SbfI, Swal, and BspEI restriction sites. pUC-SKM1-sub1.2-mP-E1AB② is 26,193 bp long and contains at least the KanR gene sequence, ori nucleotide sequence, 5'-ITR sequence, mP nucleotide sequence, and e1a gene sequence, as well as 19 kDa and 55 kDa sequences, including at least an SbfI restriction site.

[0099] First, the plasmid pSKM1-sub-E3 (hCSF2) ① was digested with SbfI, and the digested plasmid pSKM1-sub-E3 (hCSF2) ① was linearized; then, the plasmid pUC-SKM1-sub1.2-mP-E1AB ② was similarly digested with SbfI, and the resulting 23588 bp fragment was taken. The linearized plasmid pSKM1-sub-E3 (hCSF2) ① was ligated to the 23588 bp fragment obtained after digestion with pUCSKM1-sub1.2-mP-E1AB ② to form the plasmid pSKM_KK010 (h) ③ (hereinafter referred to as SEQ 14). Preferably, the obtained pSKM_KK010 (h) ③ was screened for single clones, and after enzyme digestion identification, it was confirmed that the correctly constructed pSKM_KK010 (h) plasmid was obtained.

[0100] Plasmid pSKM_KK010(h)③ is 40144 bp in length. This plasmid includes at least the hCSF2 gene sequence, the e4orf6 gene sequence (abbreviated as E4O6), the 3'-ITR sequence, the 5'-ITR sequence, the AmpR gene sequence and the ori nucleotide sequence, as well as the mP nucleotide sequence and the e1a (13S) gene, the e1b gene (19 kDa coding sequence and 55 kDa coding sequence), etc., and also includes the PacI restriction site and the SbfI restriction site.

[0101] See also Figure 6 , Figure 6 The center right figure shows the results of an AseI and BglII digestion assay for the pSKM_KK010(h) plasmid; the left shows a simulated digestion pattern of the theoretical sequence. Columns 1 and 2 of the simulated pattern show the theoretical digestion product bands for AseI and BglII, respectively. The actual AseI and BglII digestion bands for pSKM_KK010(h) were compared with the corresponding theoretical digestion bands. Both were consistent with their theoretical digestion bands, confirming that the pSKM_KK010(h) plasmid was constructed correctly.

[0102] As mentioned above, the pSKM_KK010(h) plasmid is just one example of the pSKM_KK010 series of plasmids. Other plasmids belonging to the pSKM_KK010 series can be constructed using almost the same process. For example, Figure 2 The plasmids pSKM_KK010(m)③ and pSKM_KK010(v)④ in the above-mentioned sequences can be constructed using basically the same process and steps. The specific construction process is described below.

[0103] 2.3. Transformation of adenoviral vector pSKM1 and construction of plasmid pSKM_KK010(m)

[0104] Using the same process and build steps as above, see Figure 3 , the plasmid pUC57-SKM1-subl.2-mP-E1AB⑦ can be constructed; then, Figure 5 During the construction process, the plasmid pSKM1-sub-E3(hCSF2)① was replaced with the pSKM1-sub-E3(mCSF) plasmid (not shown in the figure). Figure 4 Mark ④, Figure 5Marked ①) was digested with SwaI and BspEI to produce a 14863 bp fragment. Plasmid pUC-GW-Kan-mCSF was digested with SwaI and BspEI to produce a 1684 bp fragment. The 14863 bp fragment from plasmid pSKM1-sub-E3(hCSF2)④ was ligated with the 1684 bp fragment from pUC-GW-Kan-mCSF to construct the pSKM1-sub-E3(mCSF) plasmid (not shown). The pUC-GW-Kan-mCSF plasmid was also obtained by gene synthesis. Specifically, the E3-mCSF sequence (1689 bp, hereinafter referred to as SEQ15) was first synthesized and then cloned into the EcoRV site of the pUC-GW-Kan vector (the nucleotide sequence of which can be found at https: / / www.cosmogenetech.com / cosmo / upload / files / etc / pUC-GW-Kan.pdf), resulting in the pUC-GW-Kan-mCSF plasmid. E3 is the original genomic sequence of the E3 region between the BspEI and SwaI restriction sites.

[0105] Next, the pSKM1-sub-E3 (mCSF) plasmid obtained above was used to replace Figure 5 pSKM1-sub-E3(hCSF2) plasmid ①, according to the above Figure 5 In the third step, the pSKM1-sub-E3 (mCSF) plasmid and the pUC_SKM1-sub1.2-mP-E1AB plasmid were digested with enzymes, and the corresponding fragments were taken and ligated to obtain the plasmid pSKM_KK010 (m) (not shown in the figure).

[0106] In actual operation, the obtained pSKM_KK010(m) plasmid was screened for single clones, and the correctly constructed pSKM_KK010(m) was confirmed after enzyme digestion identification.

[0107] See also Figure 7 , Figure 7 The middle right figure shows the results of BglII and AseI enzyme digestion identification of the pSKM_KK010(m) plasmid. The left side shows the simulated enzyme digestion pattern of the theoretical sequence. Columns 1 and 2 of the simulated pattern represent the theoretical enzyme digestion product bands of AseI and BglII, respectively. The obtained BglII and AseI enzyme digestion bands of pSKM_KK010(m) were compared with the theoretical enzyme digestion product bands, and the two were consistent, confirming that the pSKM_KK010(m) plasmid was constructed correctly.

[0108] 2.4. Transformation of adenoviral vector pSKM1 and construction of pSKM_KK010(v) plasmid

[0109] Similarly, pSKM_KK010(v) (not shown) can be constructed using the same process and construction steps as above. Figure 3 , the plasmid pUC57-SKM1-subl.2-mP-E1AB⑦ can be constructed; then, Figure 5 During the construction process, the plasmid pSKM1-sub-E3(hCSF2)① was replaced with the plasmid pSKM1-sub-E3(hCSF2v) (not shown in the figure). Figure 4 Mark ④, Figure 5 Marked ①) was digested with SwaI and BspEI to produce a 14863 bp fragment. Plasmid pUC-GW-Kan-hCSF2v was digested with SwaI and BspEI to produce a 1693 bp fragment. The 14863 bp fragment from plasmid pSKM1-sub-E3(hCSF2)④ was ligated with the 1693 bp fragment from pUC-GW-Kan-hCSF2v to construct the pSKM1-sub-E3(hCSF2v) plasmid (not shown). The pUC-GW-Kan-hCSF2v plasmid was also obtained by gene synthesis. Specifically, the E3-hCSF2v sequence (1698 bp, hereinafter referred to as SEQ 16) was first synthesized and cloned into the EcoRV site of the pUC-GW-Kan vector (the nucleotide sequence of which can be found at https: / / www.cosmogenetech.com / cosmo / upload / files / etc / pUC-GW-Kan.pdf). The E3 region is the original genomic sequence between the BspEI and SwaI restriction sites.

[0110] Next, the pSKM1-sub-E3 (hCSF2v) plasmid obtained above was used to replace Figure 5 pSKM1-sub-E3(hCSF2) plasmid ①, according to the above Figure 5In the third step, the pSKM1-sub-E3 (hCSF2v) plasmid and the pUC_SKM1-sub1.2-mP-E1AB plasmid were digested, and the corresponding fragments were taken and ligated to obtain pSKM_KK010 (v) (not shown in the figure).

[0111] In actual operation, the obtained pSKM_KK010(v) plasmid was screened for single clones, and the correctly constructed pSKM_KK010(v) was confirmed after enzyme digestion identification.

[0112] See also Figure 8 , Figure 8 The middle right figure shows the results of BglII and AseI enzyme digestion of the pSKM_KK010(v) plasmid. The left side shows the simulated enzyme digestion pattern of the theoretical sequence. Columns 1 and 2 of the simulated pattern represent the theoretical enzyme digestion product bands of AseI and BglII, respectively. The obtained BglII and AseI enzyme digestion bands of pSKM_KK010(v) were compared with the theoretical enzyme digestion product bands, and the two were consistent, confirming that the pSKM_KK010(v) plasmid was constructed correctly.

[0113] 3. Packaging of SKM_KK010 series viruses

[0114] In actual operation (not shown in the figure), the chimpanzee adenovirus recombinant plasmids pSKM_KK010(h), pSKM_KK010(m) or pSKM_KK010(v) are linearized with PacI enzyme to release the complete recombinant adenovirus genome, and then HEK293 cells are transfected respectively. The virus modification is rescued in HEK293 cells and packaged into active conditional replication oncolytic viruses. After further expansion and culture in HEK293 cells, the virus seed is purified by cesium chloride density gradient centrifugation and desalted to prepare a virus seed library with higher purity. See Figure 9 The results of a cesium chloride density gradient centrifugation experiment are shown, where the lower band contains fully packaged virus particles. The prepared virus seed library was tested for physical titer and infectivity titer.

[0115] 4. Structural Verification of the Viral Genome

[0116] The viral genomes of the obtained viruses were extracted and restriction enzyme analysis was performed. The enzyme digestion results were compared with the designed theoretical enzyme digestion results, indicating that the viral gene sequence was consistent with the designed sequence, confirming that the obtained chimpanzee adenovirus modified clone was correct.

[0117] Figure 10The left panels of -A to 10-C are the AseI and BglII restriction enzyme maps of the viral genomes of P4 generation SKM_KK010(h), P3 generation SKM_KK010(m), and P3 generation SKM_KK010(v), respectively. Figure 10 The right panels of Figures 10-A to 10-C show the theoretical AseI and BglII digestion patterns of the genomes of SKM_KK010(h), SKM_KK010(m), and SKM_KK010(v), respectively. Comparison of the digestion results with the theoretical digestion patterns showed consistency, confirming the correct genome structures of the constructed recombinant virions SKM_KK010(h), SKM_KK010(m), and SKM_KK010(v).

[0118] 5. Virus passage stability study

[0119] A P4 SKM_KK010(h) virus seed was subcultured in HEK293 cells to passage 12. During this process, the 6th, 9th, and 12th passage viruses were collected, their genomes extracted, and enzyme digestion analysis was performed. Comparison of the digestion results with the theoretical digestion patterns showed that the digestion results of the viral genomes at passages 6, 9, and 12 were consistent with the theoretical digestion patterns and with the initial P4 digestion pattern, demonstrating that the viral genome remained stable after serial passages.

[0120] Figure 11 -A to 11-D show the enzyme digestion identification of SKM_KK010(h) virus genome and the stability of virus genome passage. Figure 11 -A shows the initial state. The left side of the figure shows the results of the enzyme digestion of the SKM_KK010(h) viral genome by AseI and BgllI, and the right side shows the theoretical enzyme digestion pattern. Comparison of the enzyme digestion results with the theoretical enzyme digestion pattern shows that the initial structure of the SKM_KK010(h) viral genome is correct.

[0121] Figure 11 -B shows the enzyme digestion patterns of SKM_KK010(h) virus genome P6 and P9 generations with AseI and BglII; the enzyme digestion results were compared with the theoretical enzyme digestion patterns. Figure 11 -D comparison showed that the genome structure of SKM_KK010(h) virus was correct when it was transmitted to P6 and P9 generations.

[0122] Figure 11 -C shows the enzyme digestion pattern of SKM_KK010(h) virus genome P12 generation virus AseI and BglII; the enzyme digestion results were compared with the theoretical enzyme digestion pattern. Figure 11 -D comparison showed that the genome structure of SKM_KK010(h) virus was correct when it was transmitted to P12.

[0123] In summary, comparison of the genome structures of the SKM_KK010(h) virus at the P6, P9, and P12 generations with the theoretical genome structure showed that the genome structure of the SKM_KK010(h) virus remained correct after passage 12, proving that the SKM_KK010(h) virus genome remained stable after continuous passage.

[0124] The platform plasmid is widely used in combination with the corresponding exogenous gene clone and expression plasmid. For example, it can be used to quickly construct a non-replicating viral vector vaccine, and can also be used to construct a conditional replicating oncolytic virus. The description of this disclosure is only to illustrate the principle of the invention and does not strictly limit the scope of the invention. For example, the order of transformation of the E4, E3 and E1 regions is not strictly limited by the order of this description. In fact, the order of transformation of these three regions using the method of the present invention can be arbitrary and will not affect the construction of the viral recombinant.

[0125] The embodiments described above are intended to illustrate the present invention and are not intended to limit the present invention. The present invention is intended to include various variations and alternatives of the embodiments described, and the drawings and description herein are provided to illustrate details of the present invention by way of example. However, the embodiments described herein are not intended to be limited to the specific forms or methods disclosed; on the contrary, the present invention is intended to include all variations, equivalents, and alternatives.

[0126] 6. Experimental results

[0127] Following the aforementioned inventive steps, conditionally replicating adenovirus recombinants pSKM_KK010(h), pSKM_KK010(m), and pSKM_KK010(v) were constructed, each based on a chimpanzee adenovirus gene sequence. These recombinants were validated and tested for therapeutic efficacy against various cell types. The results confirmed that these recombinants achieved the desired oncolytic effect.

[0128] 6.1. Experiments on virus rescue, production, and viral titer using modifications to chimpanzee adenovirus regions 33841..34746

[0129] Figure 12 The figure shows the comparison of HEK293 cells transfected with fluorescently labeled recombinant chimpanzee adenovirus (AdC6-eGFP in the figure) before and after the modification of the 33841..34746 region (i.e. E4ORF6) of the chimpanzee adenovirus SAdV23 genome by the present invention. Figure 12Judging from the transfection effects of AdC6-eGFP on HEK293 cells before and after modification shown in the figure, the recombinant chimpanzee adenovirus modified with E4ORF6 has shown varying degrees of improvement in rescue, production and viral infectivity titer when transfected into HEK293 cells.

[0130] Experimental process: The E4ORF6 of the laboratory's own AdC6-eGFP plasmid was modified in the same way as the 33841..34746 region (E4ORF6) of SAdV23 in the present invention to obtain the modified AdC6-VPD_eGFP plasmid. The unmodified and modified plasmids were used for HEK293 cell transfection and virus rescue, respectively. The dosage and transfection conditions of the two plasmids were the same. One day after transfection, the cells were photographed under a fluorescence microscope, and the cells containing green fluorescence were observed and compared ( Figure 12 The white dots in the two photos on the right are cells with green fluorescence).

[0131] Result analysis: Figure 12 The two photos on the left are the status of two HEK293 cells before transfection. As shown in the figure, the cell density and growth status of the two HEK293 cells before transfection are very similar. Figure 12 The two photos on the right are the status of two cells taken one day after being transfected with AdC6-eGFP plasmid (before transformation) and AdC6-VPD_eGFP plasmid (after transformation). As shown in the figure, under the same magnification and the same fluorescence intensity, the number and brightness of green fluorescent spots produced by AdC6-eGFP (upper right photo) plasmid transfection are not as good as the transfection effect of AdC6-VPD_eGFP (lower right photo) plasmid at the same time. From the perspective of virus rescue time, the rescue time of AdC6-eGFP plasmid is longer than that of AdC6-VPD_eGFP plasmid (specific data not shown in the figure). In addition, the yield and quality of P1 generation virus packaged by the modified plasmid AdC6_VPD_eGFP are better than those of the plasmid before the transformation. This can be seen from the pathological conditions during each subsequent generation of virus expansion and the final purified virus yield (see Figure 13 and Table 1).

[0132] Conclusion: The above modification of the SAdV23 genome region 33841..34746 (E4ORF6) can improve the rescue and packaging ability of the virus in HEK293 cells, as well as the virus yield. Compared with the currently disclosed chimpanzee adenovirus-based oncolytic viruses, the modification results of the present invention are significantly improved.

[0133] Figure 13The figure shows a comparison of the yield of well-packaged viral particles (lower band) obtained by cesium chloride density gradient centrifugation of AdC6_eGFP (before transformation) and AdC6VPD_eGFP (after transformation), which was used to test the changes in virus yield before and after transformation of the 33841..34746 region.

[0134] Experimental Procedure: Rescued P1-generation AdC6_eGFP (before transformation) and AdC6_VPD_eGFP (after transformation) viruses were taken and each aliquot was cultured in HEK293 cells using the same method, stepwise amplification, until 40 150mm cell culture dishes were filled. When the cytopathic effect reached 95% or higher, the cells were harvested. After three freeze-thaw cycles, the packaged virus was isolated using cesium chloride density gradient centrifugation (lower band). The cells harvested from the 40 150mm cell culture dishes were evenly divided into two ultracentrifuge tubes.

[0135] Result analysis: Figure 13 Shown are the bands produced by cesium chloride density gradient centrifugation in the two centrifuge tubes described above. As shown, each ultracentrifuge tube contains two distinct bands, the lower band representing fully packaged viral particles. The two tubes on the left contain viruses packaged from plasmids before E4ORF6 modification; the two tubes on the right contain viruses packaged from plasmids after E4ORF6 modification. Significant differences in virus yield (arrows indicate lower bands) can be seen before and after modification. The figure shows that, after amplification of the viruses using the same experimental procedure, the lower band in the tube containing E4ORF6-modified virus is thicker than in the tube containing unmodified virus, indicating significantly higher virus yield after E4ORF6 modification.

[0136] Conclusion: The modification of the 33841..34746 region (E4ORF6) on the chimpanzee adenovirus SAdV23 genome can increase the yield of the virus in HEK293 cells. This conclusion was further confirmed in the subsequent physical titer and infectious titer tests of the purified virus. 260 is the physical titer of the purified virus, and IU is the infectivity titer. As you can see, the modified virus is superior to the unmodified virus in both aspects.

[0137]

[0138] Table 1

[0139] 6.2. Cytotoxicity of SKM_KK010(h) to Normal and Cancer Cells

[0140] Figure 14 This is a comparison of the killing effects of the modified chimpanzee adenovirus on normal cells and cancer cells.

[0141] The 3381..4354 region of the chimpanzee adenovirus SAdV23 was modified according to the methods of the present invention, replacing the native promoter of the chimpanzee adenovirus E1A gene with an optimized promoter of human telomerase reverse transcriptase. This promoter is characterized by high activity in tumor cells and very low activity in normal cells. As a result, the recombinant chimpanzee adenovirus can selectively replicate in tumor cells, express exogenous genes, and kill them; conversely, it has little or no effect on normal cells.

[0142] Experimental process: 1. Select HEK293 embryonic kidney cells, SW480 colon cancer cells, Hep3B liver cancer cells, LoVo colon cancer cells, SW780 bladder cancer cells, LNCaP prostate cancer cells, 22Rv1 prostate cancer cells, NCI-H1048 small cell lung cancer cells, MCF-7 breast cancer cells, as well as IOSE80 normal cells, ARPE-19 normal cells, BJ normal cells, and MCF-10A normal cells, and culture the above cells according to their respective standard culture procedures. Then, the cultured cells were inoculated into 96-well culture plates. 2. For each of the above cells, each cell was inoculated with virus according to the set multiplicity of infection (MOI). The MOI (MOI = number of infectious viruses / total number of cells) ranged from 0.0001 to 100. Leave one well for each cell line, and the cells therein are not inoculated with virus (MOI is 0), which serves as a non-infected normal control. 3. After inoculating the virus, the cells were cultured at 37°C, 5% CO2 for 7 or 10 days. 4. The culture plates were removed, the cells in each well of the plates were fixed, and crystal violet staining was performed. The plates were then observed and photographed. 5. Figure 14 The results show the killing effect of SKM_KK010(h) on normal cells and cancer cells. The wells that appear blue after staining in the figure indicate that the cells in the well are still alive; the wells that cannot be stained indicate that the cells in the well have died and fallen off.

[0143] Result analysis: Figure 14As shown, human embryonic kidney (HEK293) cells were used for virus production and served as a positive control in this experiment to observe whether the virus could lyse HEK293 cells. As shown in the figure, the chimpanzee adenovirus variant SKM_KK010(h) exhibited varying degrees of cytotoxicity against selected SW480 colon cancer cells, Hep3B liver cancer cells, LoVo colon cancer cells, SW780 bladder cancer cells, 22Rv1 prostate cancer cells, NCI-H1048 small cell lung cancer cells, MCF-7 breast cancer cells, and LNCaP prostate cancer cells (wells with no or incomplete staining in the figure indicate complete or partial cytotoxicity). Cytotoxicity was most pronounced against Hep3B liver cancer cells and LoVo colon cancer cells. However, the virus variant SKM_KK010(h) had little cytotoxicity against four normal cell lines (IOSE80, ARPE-19, BJ, and MCF-10A).

[0144] Conclusion: The modified chimpanzee adenovirus SKM_KK010(h) has a broad-spectrum cytotoxic effect on cancer cells, but has little cytotoxic effect on normal cells. Therefore, it selectively kills cancer cells while leaving normal cells largely unaffected. Therefore, the modified chimpanzee adenovirus SKM_KK010(h) can be used as an oncolytic virus to treat cancer.

[0145] Figure 15 This is a diagram showing the replication of the virus (MOI 5) in different cells 72 hours after infection.

[0146] Experimental procedure: Tumor cells Hep3B, SW780, LoVo, and normal cells IOSE-80 and ARPE-19 were seeded into 24-well cell culture plates using complete cell culture medium containing 5% fetal bovine serum (FBS). The cell culture plates were cultured overnight to allow the cell confluency to reach approximately 80%. The next day, these cells were infected with SKM_KK010(h) virus at a multiplicity of infection (MOI) of 5 and 0. After further culture for 72 hours, the cell culture plates were frozen and thawed, and the cells were harvested. MagMAX TM Total DNA was extracted using a viral / pathogen nucleic acid extraction kit, and then real-time fluorescence quantitative PCR was performed using the Taqman probe method. The PCR primers and probes were:

[0147] Primer-F(5'-3'):TCAACCACCACCGCAACGC

[0148] Primer-R(5'-3'):TGGATGTGGAAGGGCACGTA

[0149] Probe(5'-3'):FAM-TACCGCTCCATGCTCCTGGGCA-BHQ1

[0150] Analysis: After 72 hours of infection, the SKM_KK010(h) virus reached approximately 10,000 copies / cell in LoVo, SW780, and Hep3B cancer cells. Under the same experimental conditions, the virus replicated at approximately 100 copies / cell in normal cells. This demonstrates that the SKM_KK010(h) virus replicates much more efficiently in cancer cells than in normal cells.

[0151] Conclusion: The modified virus SKM_KK010(h) selectively replicates and proliferates in tumor cells, with comparable viral replication across different tumor cell types, indicating that the virus can broadly infect and replicate in cancer cells. In contrast, its replication capacity is significantly diminished in normal cells. This suggests that the specific killing effect of the SKM_KK010(h) virus on tumor cells is associated with its specific replication in tumor cells.

[0152] Figure 16 Shown is a diagram showing the dynamic killing analysis of cells by the virus modification SKM_KK010 (h).

[0153] Experimental process: Hep3B, SW780, LoVo, IOSE-80 and ARPE-19 cells were selected and inoculated into 96-well cell culture plates with complete cell culture medium containing 5% fetal bovine serum (FBS), and the cell culture plates were cultured overnight. The next day, the cells were infected with the virus modified SKM_KK010(h), and the multiplicity of infection was 0, 20, 100, and 3 to 4 replicates for each condition for statistical analysis. On days 0, 2, 4, 7, 10 and 14 after infection, the culture plates were removed, the cell culture medium was replaced with D-PBS, and then Cellcounting-lite 2.0 detection reagent was added to detect the bioluminescence intensity and calculate the cell viability. The formula for calculating cell viability is:

[0154]

[0155] Analysis of results: No killing of the two normal cell lines by the virus modification SKM_KK010(h) was observed during 14 days of culture even when the multiplicity of infection was increased to 100. The virus modification had different killing dynamic curves for different tumor cells. In general, a dose-effect response was observed, that is, the high multiplicity of infection (100) had better killing performance than the low multiplicity of infection. When the multiplicity of infection was MOI100, the virus modification was able to completely kill Hep3B and SW480 on the 10th day, and completely kill LoVo cells on the 14th day; when the multiplicity of infection was MOI 20, it was able to completely kill Hep3B and SW480 on the 14th day, and kill LoVo cells to 70%.

[0156] Conclusion: Compared to the cytopathic effect assay, this study quantitatively investigated the dynamic killing of tumor cells by the viral construct SKM_KK010(h). Based on the experimental results, it is concluded that SKM_KK010(h) has a specific killing ability against tumor cells, while having no effect, or a relatively low effect, on normal cells. The viral killing dynamics differed for different tumor cells, indicating that the viral construct had different killing abilities against different tumor cells. A higher multiplicity of infection (MOI) resulted in faster and more complete cell killing; a lower MOI required a longer time to achieve a comparable killing effect. The in vitro dynamic killing curve of the viral construct reflects the tumor cell killing process of the viral construct under different MOI conditions, providing an important basis for the design of subsequent animal experiments.

[0157] 6.3. Study on human GM-CSF cytokine carried by recombinant chimpanzee adenovirus

[0158] Experimental Procedure: This study consisted of two parts: a GM-CSF production assay and a GM-CSF in vitro activity assay. For the GM-CSF production assay, LoVo and SW480 cancer cells and normal ARPE-19 cells were seeded into 24-well cell culture plates and cultured overnight. The next day, the cells were infected with the SKM_KK010(h) virus. LoVo and ARPE-19 cells were infected at an MOI of 2 and 0, respectively. After 24 hours of culture, the cell supernatants were collected and assayed for GM-CSF content using a human GM-CSF ELISA kit. SW480 cells were infected at an MOI of 5 and 0, respectively. After 48 hours of culture, the cell supernatants were collected and assayed for GM-CSF content using an ELISA kit.

[0159] When conducting the GM-CSF in vitro activity assay, TF-1 cells were first harvested, washed three times with 1640 assay medium containing 0.5% FBS and 1% P / S, and then seeded into 96-well plates and cultured overnight. The supernatant samples of virus infection at MOI 2 or 5 were directly used as the first sample well. The GM-CSF standard was diluted to 40 ng / mL using the sample infected with the virus at MOI 0 as the first standard well. All samples and standards were diluted 4-fold in the assay medium to 8 concentrations. Pure assay medium was used as the blank well, for a total of 10 concentration points. Samples and standards were added to the cell culture plate. After 48 hours, the bioluminescence intensity was detected by adding Cellcounting-lite 2.0 detection reagent. Prism8 was used to analyze the data and fit the EC50 value of each sample and standard. The relative activity of the sample was calculated according to the following formula:

[0160]

[0161] Results analysis: Table 2 shows the results of GM-CSF production in tumor cells and normal cells after virus infection and its promotion of TF-1 proliferation. Each experiment was repeated three times independently, and the table shows the average of the three tests. Among them, ARPE-19 had two test results below the detection limit, and one was detected at 526.5 pg / (10 6 Compared to normal ARPE-19 cells, tumor cells LoVo and SW480 all produced significantly higher GM-CSF levels, exceeding 100 times that of normal cells. TF-1 proliferation-promoting assays of the produced GM-CSF and comparisons with GM-CSF standards revealed that the virus-produced GM-CSF exhibited normal proliferation-promoting activity.

[0162]

[0163] Table 2

[0164] Conclusion: SKM_KK010(h) can selectively replicate and produce GM-CSF in tumor cells, and the GM-CSF expressed in tumor cells has biological activity.

[0165] 6.4. Tumor Inhibitory Effect of SKM KK010(h) in Animals

[0166] Figure 17 Schematic diagram of the tumor inhibitory effect of SKM_KK010(h) in nude mice bearing LoVo tumor.

[0167] Experimental process description: The first step is to establish the model. LoVo cells are cultured in MEM medium containing 10% FBS and maintained in a 37°C saturated humidity incubator with 5% CO2. LoVo cells in the logarithmic growth phase are collected and resuspended in MEM basal medium. The cell concentration is adjusted to 1×10 7 Under sterile conditions, 0.1 mL of cell suspension was inoculated subcutaneously on the right side of the mouse back at a concentration of 1×10 6 / 0.1mL / mouse. The second step is grouping and drug administration. When the average tumor volume reaches 100mm 3 Around 14:00 am, the animals were randomly divided into groups according to tumor volume, so that the difference in tumor volume between groups was less than 10% of the mean. The day of grouping was designated as Day 0, and drug administration began. During the drug administration period, if the body weight of individual animals decreased by more than 15% compared with Day 0 (BWL ≥ 15%), the drug would be discontinued until the animal weight (BWL < 15%) recovered, and then drug administration would be resumed. The third step was weighing and observation. The animal weight and tumor volume were measured twice a week during the experiment. The length and width of the tumor were measured with a digital caliper, and the tumor volume was estimated by the length and width measurements. During the experiment, the clinical symptoms of the animals were observed and recorded once a day, and the time of death of the animals was recorded. Clinical observations included the overall health of the animals, abnormal weight, abnormal behavior, and other adverse reactions related to drug administration.

[0168] Endpoints: According to animal welfare regulations, if any of the following conditions are met during the experiment, the animal will be removed from the experimental group and euthanized: 1. The animal's body weight decreases by more than 20% compared to Day 0 (BWL ≥ 20%); 2. The animal experiences severe adverse reactions such as blindness or paralysis; 3. The tumor volume is greater than 2000 mm 3 4. Open ulcers form on the tumor surface. When individual animals reach the animal welfare endpoint, they are weighed for the final time and euthanized with CO2. The remaining animals in the same group continue to receive medication and observation until they reach the animal welfare endpoint or the experimental endpoint. The experimental endpoint is 31 days, at which point the tumors are removed and weighed. The following is the calculation method for the evaluation indicators:

[0169] Tumor volume (TV) is calculated as follows: 1 / 2×a×b 2 , where a and b are the length and width of the tumor, respectively;

[0170] Tumor growth inhibition rate (%TGI TV )The calculation formula is: (1-TV T / TV C )×100%, TV C is the average tumor volume of the negative control group, TV T is the average tumor volume of the drug-treated group;

[0171] The relative tumor volume (RTV) is calculated as follows: t / V0, where V0 is the tumor volume at the time of grouping and Vt is the tumor volume at each measurement;

[0172] Relative tumor growth rate (%T / C RTV ) is calculated as follows: RTV / C RTV × 100%, where T RTV RTV for the treatment group, C RTV was the negative control group;

[0173] Tumor inhibition rate (% TGI TW ) is calculated as: %TGI TW =(1-TW T / TW C )×100%, TW C is the average tumor weight of the negative control group, TW T is the average tumor weight of the treatment group;

[0174] The calculation formula of animal body weight change rate (%BWC) is: (BW t -BW0) / BW0×100%, where BW t is the weight of the animals at each measurement, and BW0 is the weight of the animals when they were grouped.

[0175] According to the China National Medical Products Administration's "Technical Guidelines for Nonclinical Studies of Cytotoxic Antitumor Drugs" (November 2006), efficacy is considered when %T / CRTV ≤ 40% and P < 0.05 is statistically analyzed. If drug-related animal mortality exceeds 20%, the drug dose is considered severely toxic.

[0176] In this study, the experimental data were expressed as Mean ± SEM. The time point was used as the X-axis and the tumor volume (mm 3 Tumor growth curves were plotted with time points on the X-axis and animal weight (g) on ​​the Y-axis. Intergroup comparisons were performed using a two-tailed t-test. P < 0.05 was considered significant, and P < 0.01 was considered extremely significant.

[0177] Observation results:

[0178] Nude mice were subcutaneously inoculated with LoVo cells at a concentration of 1×10 6 / 0.1mL / mouse. The animals were immediately dosed after grouping. Group 1 was the vehicle control group; Group 2 was SKM_KK010(h) (i.e., 1hA) HD8×10 9IFU / mouse administration group, intratumoral injection, twice a week for 3 weeks (IT, BIW×3w); Group 3 SKM_KK010(h) LD 1.6×10 9 IFU / mouse administration was intratumorally injected twice a week for 3 weeks (IT, BIW x 3 weeks). All animals were sacrificed on day 31, samples were collected, and tumor weights were measured, concluding the experiment. The average tumor weight in the vehicle control group on day 31 was 1.084 ± 0.098 g.

[0179] Group 2 SKM_KK010(h)HD 8×10 9 The average tumor weight of the IFU / mouse administration group was 0.335±0.125g, %TGI TW was 69.10%, which was significantly different from the vehicle control (P<0.001); %T / C RTV The LD50 level in group 3 was 1.6×10 9 The average tumor weight of the IFU / mouse administration group was 0.508±0.119g, %TGI TW was 53.14%, which was significantly different from the vehicle control (P<0.01); %T / C RTV It was 47.99%, which was significantly different from the vehicle control (P<0.01).

[0180] Experimental conclusion: The experimental results show that SKM_KK010(h)LD 1.6×10 9 IFU / mouse alone could significantly inhibit the growth and proliferation of colon cancer cells LoVo in Nude mice (P<0.01); SKM_KK010(h)HD 8×10 9 IFU / mouse alone can effectively inhibit the growth and proliferation of colon cancer cells LoVo in Nude mice (% T / C RTV : 33.01%, P<0.01).

[0181] 6.5. Quantitative Cell Killing Experiment of SKM KK010(h)

[0182] Experimental process description: Selected cells were seeded into 96-well plates at a certain cell number, and the 96-well plates were cultured in a cell culture incubator at 37°C and 5% CO2. After 24 hours, the recombinant adenovirus SKM_KK010(h) was used to infect the cells on the 96-well plates at different multiplicities of infection. The wells without virus on the 96-well plates served as blank wells. The cells were cultured for 10 days, during which time the cells were subjected to medium replacement and rehydration. After 10 days, the cells were infected with recombinant adenovirus SKM_KK010(h) at different multiplicities of infection. Cell viability was measured in each well of a 96-well plate using a luminescent cell viability assay kit (Vazyme, DD1101) 2.0. Cell viability was calculated and plotted. Each experiment was repeated three times. Cell viability = (value of experimental wells / average value of blank wells).

[0183] Experimental results analysis: Figure 18 The figure shows the cell survival after 10 days of infection with different doses of virus. This scatter plot quantitatively shows that the chimpanzee adenovirus modified SKM_KK010(h) has different degrees of killing effects on selected SW480 colon cancer cells, Hep3B liver cancer cells, LoVo colon cancer cells, SW780 bladder cancer cells, and LNCaP prostate cancer cells. Figure 18 As shown, this killing effect increased with increasing viral dose. At an MOI of 500, SKM_KK010(h) significantly killed almost all tumor cells, with the strongest effect being on Hep3B liver cancer cells and SW780 bladder cancer cells, both of which were nearly completely killed. Killing LoVo colon cancer cells, SW480 colon cancer cells, and LNCaP prostate cancer cells also exceeded 80%. In contrast, the modified virus SKM_KK010(h) had essentially no killing effect on four normal cell lines (IOSE80, ARPE-19, BJ, and MCF-10A cells).

[0184] Experimental Conclusion: The modified virus SKM_KK010(h) exhibits a broad spectrum of cytotoxicity against cancer cells, with significant cytotoxicity against some cancer cells while having little to no cytotoxicity against normal cells. Therefore, the modified virus SKM_KK010(h) selectively kills cancer cells while leaving normal cells largely unaffected. Therefore, the modified chimpanzee adenovirus SKM_KK010(h) can be used as an oncolytic virus to treat cancer.

[0185] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A recombinant adenovirus vector, characterized in that: The nucleotide sequence is based on the chimpanzee adenovirus genome sequence or its modified form; The 458..3413 region of the early gene sequence E1 of the basic nucleotide sequence is deleted, and the first exogenous nucleotide sequence is inserted into the deleted 458..3413 region; The 28008..31024 region of the early gene sequence E3 of the basic nucleotide sequence is deleted, and a second exogenous nucleotide sequence is inserted into the deleted 28008..31024 region; The region 33841..34746 of the early gene sequence E4 of the basic nucleotide sequence is deleted, and a third exogenous nucleotide sequence is inserted into the deleted region 33841..34746; Wherein, the first exogenous nucleotide sequence, the second exogenous nucleotide sequence, and the third exogenous nucleotide sequence respectively contain nucleotide sequences or placeholder nucleotide sequences that are conducive to the insertion of other exogenous nucleotides.

2. The viral vector according to claim 1, further comprising adding a fourth exogenous nucleotide sequence comprising multiple enzyme cleavage sites at one end of the basic nucleotide sequence.

3. The viral vector according to claim 2, further comprising a PacI restriction site added to the other end of the basic nucleotide sequence.

4. The viral vector according to claim 3, wherein The first exogenous nucleotide sequence contains two non-palindromic I-CeuI restriction enzyme sites, and the use of the two I-CeuI restriction enzyme sites is highly specific.

5. The viral vector according to claim 4, wherein A placeholder nucleotide sequence is inserted between the two I-CeuI restriction sites.

6. The viral vector according to claim 5, wherein The placeholder nucleotide sequence is the full-length eGFP encoding gene.

7. The viral vector according to claim 3, wherein The second exogenous nucleotide sequence contains two non-palindromic I-SceI restriction enzyme cleavage sites, and the use of the two I-SceI restriction enzyme cleavage sites is highly specific.

8. The viral vector according to claim 7, wherein A placeholder nucleotide sequence may be inserted between the two I-SceI restriction enzyme cleavage sites.

9. The viral vector according to claim 8, wherein the placeholder nucleotide sequence is 1-300 bp of the eGFP encoding nucleotide sequence.

10. The viral vector according to claim 3, wherein The third exogenous nucleotide sequence is the e4orf6 gene of human adenovirus type 5, which is used to replace the wild-type chimpanzee adenovirus e4orf6 gene.

11. A replicative adenovirus recombinant, characterized in that: Based on the nucleotide sequence of the recombinant chimpanzee adenovirus vector, the recombinant is also characterized in that: The early gene sequence E1 region of the basic nucleotide sequence is modified, wherein the region 3381..4354 of the early gene sequence E1 region of the basic nucleotide sequence is deleted, and a seventh exogenous nucleotide sequence is inserted into the deleted region 3381..4354. The early gene sequence E3 region of the basic nucleotide sequence is modified, wherein the region 28575..29114 of the early gene sequence E3 region of the basic nucleotide sequence is deleted, and one of the eighth exogenous nucleotide sequence, the ninth exogenous nucleotide sequence and the tenth exogenous nucleotide sequence is inserted into the deleted region 28575..29114. Among them, the seventh exogenous nucleotide sequence, the eighth exogenous nucleotide sequence, the ninth exogenous nucleotide sequence and the tenth exogenous nucleotide sequence respectively include at least one of the chimpanzee adenovirus E1 gene, the promoter sequence regulating the E1 gene or the immune regulatory factor gene sequence.

12. The viral recombinant according to claim 11, wherein The seventh exogenous nucleotide sequence is a nucleotide sequence comprising the mP-E1AB element.

13. The viral recombinant according to claim 12, wherein The mP-E1AB element comprises wild-type chimpanzee adenovirus e1a and e1b genes and a tumor-specific promoter (mP) that controls the expression of the wild-type e1a and e1b genes.

14. The viral recombinant according to claim 13, wherein The tumor-specific promoter (mP) is one of a modified human telomerase reverse transcriptase (hTERT) promoter, E2F-1 promoter, survivin promoter, AFP promoter, a2bm promoter, CEA promoter and PSA promoter.

15. The viral recombinant according to claim 11, wherein The eighth exogenous nucleotide sequence, the ninth exogenous nucleotide sequence and the tenth exogenous nucleotide sequence respectively encode granulocyte monocyte colony stimulating factor protein (GM-CSF) or one of other sequences containing GM-CSF protein.

16. The recombinant virus according to claim 15, wherein The GM-CSF protein is a wild-type human-encoded GM-CSF protein, a mutant of the wild-type human-encoded GM-CSF protein, or a mouse-encoded GM-CSF protein.

17. The viral recombinant according to claim 15, wherein The encoded GM-CSF protein is an immunomodulatory protein with a wide range of functions, including stimulating the differentiation of various immune cells, stimulating antigen cell presentation, and promoting T cell activation, infiltration, and B cell differentiation.

18. A method for constructing a replicative adenovirus recombinant, characterized in that: The chimpanzee adenovirus nucleotide sequence or its modified form is used as the basic nucleotide sequence, and the recombinant construction method is also characterized in that: Modifying the early gene sequence E1 region of the basic nucleotide sequence, comprising deleting the 3381..4354 region of the early gene sequence E1 region of the basic nucleotide sequence, and inserting a first exogenous nucleotide sequence into the deleted region of E1, Modifying the early gene sequence E3 region of the basic nucleotide sequence, comprising deleting regions 28575..29114 of the early gene sequence E3 region of the basic nucleotide sequence, and inserting one of a second exogenous nucleotide sequence, a third exogenous nucleotide sequence, and a fourth exogenous nucleotide sequence into the deleted region of E3, The first exogenous nucleotide sequence, the second exogenous nucleotide sequence, the third exogenous nucleotide sequence and the fourth exogenous nucleotide sequence respectively include the chimpanzee adenovirus E1 gene and promoter sequence and the immune regulatory factor nucleotide sequence.

19. The method for constructing a replicative adenovirus recombinant according to claim 18, wherein the modification of the early gene sequence E1 region comprises cloning the basic nucleotide sequence into a vector comprising two oligonucleotide chains to obtain a first intermediate plasmid; wherein, The two oligonucleotide chains contain SbfI and other enzyme cutting sites.

20. The method for constructing a replicative adenovirus recombinant according to claim 19, comprising annealing the two oligonucleotide chains to form a double-stranded DNA fragment with sticky ends.

21. The method for constructing a replicative adenovirus recombinant according to claim 20, comprising cloning the double-stranded DNA fragment with sticky ends into the pUC57-Kan vector that has been digested with enzymes.

22. The method for constructing a replicative adenovirus recombinant according to claim 19, further comprising cloning a fragment comprising the I-PI nucleotide sequence into the first intermediate plasmid to obtain a second intermediate plasmid.

23. The method for constructing a replicative adenovirus recombinant according to claim 22, further comprising ligating a fragment comprising the wild-type chimpanzee adenovirus C6 gene to a fragment of the second intermediate plasmid to obtain a third intermediate plasmid.

24. The method for constructing a replicative adenovirus recombinant according to claim 23, comprising constructing a gene segment comprising wild-type ela and elb genes of chimpanzee adenovirus C6.

25. The method for constructing a replicative adenovirus recombinant according to claim 24, wherein the construction of the gene fragment containing ela and elb further comprises inserting an optimized human telomerase reverse transcriptase promoter (mP) upstream of the ela and elb genes.

26. The method for constructing a replicative adenovirus recombinant according to claim 25, wherein the modification of the early gene sequence E3 region comprises restriction endonuclease of the basic nucleotide sequence and then constructing a subcloning vector by self-ligation.

27. The method for constructing a replicative adenovirus recombinant according to claim 26, further comprising ligating a plasmid fragment containing a GM-CSF protein encoding gene into a fragment of the subcloning vector to obtain a fourth intermediate plasmid; The GM-CSF protein encoding gene sequence is one of a wild-type human GM-CSF protein encoding gene, a wild-type human GM-CSF protein mutant encoding gene, and a mouse GM-CSF protein encoding gene.

28. The method for constructing a replicative recombinant adenovirus according to claim 27, further comprising synthesizing a sequence comprising a GM-CSF protein-encoding gene, and cloning the sequence comprising the GM-CSF protein-encoding gene into a pUC57-Kan vector to obtain a plasmid comprising the GM-CSF protein-encoding gene.

29. The method for constructing a replicative adenovirus recombinant according to claim 28, further comprising ligating the fourth intermediate plasmid into the third intermediate plasmid.

Images