Primer combination for rapidly, simply and conveniently screening idiopathic male infertility population based on CATSPER2 high-frequency mutation region and application of primer combination

Abstract

The invention relates to the technical field of biological medicine, in particular to a primer combination for rapidly and simply screening idiopathic male infertility population based on a CATSPER2 gene high-frequency mutation region and application of the primer combination. By means of real-time fluorescent quantitative PCR or common PCR and agarose electrophoresis combined analysis, products with corresponding large and small bands are amplified by using DNA and mRNA specific primers of CATSPER2, and the CATSPER2 gene high-frequency mutation region-based primer combination is obtained. And detecting whether the CATSPER2 gene has mutation or not by comparing the contents of products so as to evaluate whether the function of the CatSperer channel is abnormal or not and carry out precise treatment of ICSI (Intrasperm Sperm Injection) on such patients. According to the primer and the screening scheme provided by the invention, sterile sperms and normal sperms of the CATSPER2 gene caused by chromosome variation, large fragment lack or mutation can be clearly and effectively distinguished; according to the method, the sterile population caused by the abnormality of the CatSper channel can be quickly, simply and conveniently screened out, so that precise treatment of single sperm injection in egg cells of the population can be achieved, the treatment cycle is shortened, and the economic and psychological burden of patients is relieved.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a primer combination for quickly and easily screening idiopathic male infertility based on a high-frequency mutation region of the CATSPER2 gene and an application thereof. Background Art

[0002] According to WHO statistics, the global prevalence of infertility has reached one in six, with male factors accounting for half of these cases. Male infertility is primarily caused by abnormal spermatogenesis and sperm dysfunction. While there is no treatment for severe spermatogenesis-related infertility, some patients with abnormal spermatogenesis (sperm production) and most patients with sperm dysfunction can achieve fertility through assisted reproductive technology. Sperm dysfunction refers to insufficient sperm fertilization capacity, primarily involving deficiencies in motility, hyperactivated motility, chemotaxis, chemotaxis, and the acrosome reaction, leading to infertility. This type of infertility accounts for approximately 70% of male infertility cases, and achieving precise diagnosis and treatment for it remains a pressing issue in reproductive medicine.

[0003] Assisted reproductive technology has made significant progress since its inception. Currently, techniques such as ovulation induction (OI), intrauterine injection (IUI), IVF (invitro fertilization), and intracytoplasmic sperm injection (ICSI) are clinically used to treat male infertility, fulfilling the dream of having a child for countless families. For patients with severe oligozoospermia, asthenozoospermia, or teratozoospermia, ICSI can be used directly to achieve fertilization and fertility. However, for infertile individuals whose sperm parameters on routine semen analysis are mild or even normal (WHO Manual of Laboratory Examination of Human Semen, Fifth Edition), dysfunction at various stages before fertilization may necessitate a series of treatments, including OI, IUI, IVF, and ICSI. This treatment process is lengthy, carries high costs, and inflicts significant physical and psychological harm on women. Therefore, finding a more targeted and comprehensive approach to treating these conditions is an urgent need.

[0004] The sperm-specific cation calcium channel, CatSper, is the primary channel mediating calcium influx. It participates in the regulation of sperm function, regulated by physiological substances in the female reproductive tract and pre-fertilization alkalinization, to achieve normal fertilization. CatSper is the most complex calcium channel discovered to date, consisting of four main subunits (CatSper1 / 2 / 3 / 4) and numerous auxiliary subunits (CatSper β, -γ, -δ, -ɛ, -ζ, -η, -τ, Trim69, Slco6c1, Efcab9, Tmem249, and Cdc42). It is crucial for sperm hyperactivation and motility. Mutations in most subunits leading to channel dysfunction lead to male infertility, attributed to impaired calcium influx and sperm hyperactivation. Clinically, infertility caused by CatSper dysfunction presents with normal semen analysis, and fertility can only be achieved through ICSI. However, the gold standard for detecting CatSper channel abnormalities is the single sperm patch clamp technique, which requires specific instruments and well-trained professionals and is extremely difficult. The function of the channel can also be indirectly evaluated by detecting CatSper-mediated calcium signals. Although the technical difficulty is less than that of patch clamp, it is plagued by defects in fluorescence staining and detection technology itself, such as fluorescence quenching, large detection fluctuations, dependence on specific stimuli to induce calcium signals, specific detection equipment, high cost, and the need for a large number of sperm. Therefore, there is a real need in clinical practice for a rapid and easy screening of people with functional disorders who have abnormal CatSper function, which will help to provide precise treatment for such patients.

[0005] Clinical evidence indicates that mutations in CATSPER1, CATSPER2, CATSPER3, and CATSPERE can cause infertility, with nearly 20 cases reported. The frequency of homozygous CATSPER2 mutations in the general population is 0.01%, meaning that one in 10,000 individuals may experience functional impairment. CatSper channel abnormalities may account for as high as 2.3% of cases of unexplained idiopathic male infertility, with CATSPER2 mutations accounting for over 80% of these cases, making it the most susceptible subunit to mutation (2.3% * 80% = 1.84% of idiopathic infertility cases). CATSPER2 mutations are primarily concentrated in large deletions and transmembrane domains in the 15q15.3 region. This susceptibility to mutations stems from the genomic structural instability and low conservation caused by the low-copy repeat sequence and tandem gene arrangement in this region. Therefore, designing specific primers targeting this mutation hotspot and using PCR to detect both DNA deletions and mRNA transcript levels to achieve large-scale functional screening of CatSper is an efficient, cost-effective, easily manageable, and clinically feasible strategy. Through the detection of the present invention, infertile people with abnormal CatSper function can be recommended to directly undergo ICSI treatment, which helps to accurately diagnose and treat sperm dysfunction. Summary of the Invention

[0006] The purpose of the present invention is to address the shortcomings of the existing technology and propose a primer combination and its application for quickly and easily screening idiopathic male infertility based on the high-frequency mutation region of the CatSpert channel main subunit encoding gene CATSPER2. It is used to simultaneously analyze whether there are abnormalities in the mutation and expression of CATSPER2 at the DNA and mRNA levels. It can efficiently and easily screen male infertility patients caused by CATSPER2 mutations (1.84%, of which chromosomal structural variations account for more than 90%), and provide them with precise treatment to achieve the purpose of fertility.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A primer capable of specifically detecting large deletions and copy number variations in human CATSPER2 using sperm DNA, wherein the primer is located upstream of the CATSPER2 gene [43631959, 43632088], the specific primer sequences are: CgF: GATTTGGGTGTCCCCTGCTA; CgR: GCCTACAACTAAAATAGGCAGAAA, and the amplified product is 130 bp in length.

[0009] A primer capable of specifically detecting whether the transcriptional expression level of the human CATSPER2 gene is normal using sperm RNA, characterized in that the primer is located in the third exon of mRNA (NM_001282309.3), corresponding to gene loci [43647964, 43648061]; the specific primer sequence is: CmF: ATGGCCGCTTACCAACAAGAA; CmR: TGCAAATGCTCAATGAGAGAGAA, and the amplified product is 98 bp in length.

[0010] An application of the above primers in monitoring the extraction of sperm genomic DNA, wherein the internal reference gene for monitoring whether the sperm genomic DNA is successfully extracted is ACTINB or PRM2;

[0011] The specific primer sequences are:

[0012] AF: TCGATGGGGTACTTCAGGGT, AR: CGTGCTCAGGGCTTCTTGT, product length is 125 bp; PF: GGATCCACAGGCGGCAGCATCGCT, PR: GCATGTTCTCTTCCTGGTTCTGCA, product length is 266 bp.

[0013] An application of the above primers in calibrating mRNA expression, wherein the internal reference gene for calibrating mRNA expression is RPLP1, the specific primer sequences are: RF: CACGACGATGAGGTGACAGT, RR: CAGATGAGGCTCCCAATGTT; the amplified product length is 134 bp.

[0014] By adopting the above technical solution: the present invention uses real-time fluorescence quantitative PCR or conventional PCR combined with agarose electrophoresis for analysis, uses DNA and mRNA specific primers of CATSPER2 to amplify products of corresponding size bands, and then compares the content of the products to detect whether the CATSPER2 gene has a mutation, thereby evaluating whether the CatSper channel function is abnormal and providing precise ICSI treatment for such patients.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] This study designed a primer combination that uses the conventional molecular biology technique of polymerase chain reaction (PCR) to quickly and easily screen for infertility caused by abnormalities in the CatSper pathway. This approach allows for targeted treatment with intracytoplasmic sperm injection (ICSI), shortening treatment cycles and alleviating the financial and psychological burden on patients. The primers and screening protocol provided by this study can clearly and effectively distinguish infertile sperm caused by chromosomal variations, large fragment deletions, or mutations in the CatSper2 gene from normal sperm. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the primer design sites for the large deletion, chromosomal variation and transcript abnormality of the CATSPER2 gene in Examples 1 and 2 of the present invention;

[0018] Figure 2 This is a graph showing the results of qPCR detection of DNA content in the high-frequency mutation region of the CATSPER2 gene in patients with CatSper calcium channel deficiency and normal subjects in Example 1 of the present invention;

[0019] Figure 3 This is a graph showing the expression level of CATSPER2 gene mRNA in spermatozoa from patients with CatSpert channel deficiency and normal subjects detected by qPCR in Example 2 of the present invention;

[0020] Figure 4This is an agarose electrophoresis diagram of the detection of CATSPER2 gene transcription levels in sperm of CatSper deficiency patients and normal people by PCR combined with agarose gel electrophoresis in Example 2 of the present invention. The negative control is the amplification result using H2O as the template. DETAILED DESCRIPTION

[0021] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings, so that those skilled in the art can better understand the advantages and features of the present invention and thus more clearly define the scope of protection of the present invention. The embodiments described in the present invention are only some of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making any creative work are within the scope of protection of the present invention.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0023] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0024] The HTF solution (Human tubal fluid) used in the present invention has a formulation of: 93.8 mM NaCl, 4.69 mM KCl, 0.2 mM MgSO₄, 0.37 mM KH₂PO₄, 2.04 mM CaCl₂, 21.4 mM lactic acid, 2.78 mM glucose, 4 mM NaHCO₃, 331.8 μM Sodium pyruvate, 200 mg / 50 mL BSA, with a pH adjusted to 7.4.

[0025] The HS solution (HS high-saline solution) used in the present invention has the following formula: 135 mM NaCl,

[0026] 5mM KCl, 1mMMgSO4, 2mM CaCl2, 20mM HEPES, 5mM glucose, 10mMlactic acid and 1mM Na-pyruvate at pH 7.4 with NaOH.

[0027] Example 1

[0028] qPCR was used to detect whether CATSPER2 was deleted in the genomes of normal fertile males and CATSPER2-deficient patients.

[0029] DNA from blood samples of CatSper-deficient patients and normal subjects was extracted using the TaKaRa MiniBEST Whole Blood Genomic DNA Extraction Kit, and the high-frequency mutation region of the CATSPER2 gene was amplified on a qPCR instrument using the ChamQ Universal SYBR qPCR Master Mix.

[0030] like Figure 2 As shown, the genomic chromosome copy number of CATSPER2 is lost in patients with CatSper channel deficiency.

[0031] Example 2

[0032] qPCR was used to detect the expression of CATSPER2 at the transcriptional level in normal fertile males and spermatozoa with CatSper deficiency.

[0033] A 1 mL sperm sample was centrifuged at 300 rcf for 5 min. The pellet was then pipetted and resuspended evenly with 1 mL of total RNA extraction reagent (Trizol). After standing for 5 min, 200 μL of chloroform was added and the mixture was thoroughly mixed by vigorous vortexing for 30 s. The mixture was then allowed to stand at room temperature for 5 min and centrifuged at 12,000 g for 1 min. The supernatant was gently removed and an equal amount of isopropanol was added. The mixture was mixed by inversion and allowed to stand at room temperature for 10 min to allow RNA to fully precipitate. The mixture was centrifuged at 14,000 g for 15 min, the supernatant discarded, and 1 mL of 75% ethanol was added. The mixture was mixed and centrifuged at 7,500 g for 10 min. The ethanol was dried and the extracted RNA was dissolved in 20 μL of DEPC water. The extracted RNA was reverse transcribed into cDNA using HiScript III RT SuperMix for qPCR (+gDNA wiper) qPCR dedicated reverse transcription premix. The CatSper gene was amplified on a qPCR instrument using ChamQ Universal SYBR qPCR Master Mix.

[0034] like Figure 3 As shown, the expression level of CATSPER2 transcript mRNA in patients with CatSper channel deficiency is basically undetectable.

[0035] Example 3

[0036] PCR combined with agarose gel electrophoresis was used to detect the expression levels of CATSPER2 transcripts in normal and defective samples. The DNA products amplified in Examples 1 and 2 were subjected to agarose gel electrophoresis to check whether the amplified products were the expected specific bands, verify the amplification efficiency, and estimate the cDNA product content.

[0037] like Figure 4 As shown, PCR combined with agarose gel electrophoresis confirmed the loss of CATSPER2 genomic chromosomal copy number and abnormal expression at the transcriptional level in CatSper-deficient patients.

[0038] In summary, the present invention has designed a set of primers and screening schemes for quickly and easily screening out infertile people caused by abnormal CatSper channels using conventional molecular biology techniques, polymerase chain reaction. The feasibility of the present invention was confirmed by dual detection of DNA levels and mRNA transcription levels using qPCR technology on clinical samples. It is hoped that the present invention can quickly screen infertile people with abnormal CatSper channels, recommend infertile people with abnormal CatSper function to directly undergo ICSI treatment, assist in the precise diagnosis and treatment of sperm dysfunction, shorten the treatment cycle, and reduce the economic and psychological burden on patients.

[0039] The descriptions and practices disclosed in this invention are easy to understand and comprehend for those skilled in the art, and modifications and refinements may be made without departing from the principles of the invention. Therefore, modifications and improvements made without departing from the spirit of the invention should also be considered within the scope of protection of this invention.

Claims

1. A primer capable of specifically detecting the presence of large deletions and copy number variations in the human CATSPER2 gene using sperm DNA, characterized in that: The primers are located upstream of the CATSPER2 gene [43631959, 43632088], the specific primer sequences are: CgF: GATTTGGGTGTCCCCTGCTA; CgR: GCCTACAACTAAAATAGGCAGAAA, and the amplified product length is 130 bp.

2. A primer capable of specifically detecting whether the mRNA expression of the human CATSPER2 gene transcription level is normal through sperm RNA, characterized in that: The primers are located on the third exon of mRNA, corresponding to gene sites [43647964, 43648061]; the specific primer sequences are: CmF: ATGGCCGCTTACCAACAAGAA; CmR: TGCAAATGCTCAATGAGAGAGAA, and the amplified product length is 98 bp.

3. The use of the primer according to any one of claims 1-2 in monitoring sperm genomic DNA extraction, characterized in that: The internal reference gene used to monitor whether sperm genomic DNA extraction was successful was ACTINB or PRM2; The specific primer sequences are: AF: TCGATGGGGTACTTCAGGGT, AR: CGTGCTCAGGGCTTCTTGT, product length is 125 bp; PF: GGATCCACAGGCGGCAGCATCGCT, PR: GCATGTTCTCTTCCTGGTTCTGCA, product length is 266 bp.

4. Use of the primer according to any one of claims 1-2 in calibrating mRNA expression, characterized in that The internal reference gene used to calibrate mRNA expression was RPLP1, and the specific primer sequences were: RF: CACGACGATGAGGTGACAGT, RR: CAGATGAGGCTCCCAATGTT; the amplified product was 134 bp in length.

Images