SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 15 and related to average daily feed intake character and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker located on a pig chromosome 15 and related to an average daily feed intake character and an application of the SNP molecular marker. The SNP site of the SNP molecular marker located on the No.15 chromosome of the pig and related to the average daily feed intake character corresponds to the 122335983th site Cgt on the No.15 chromosome of a reference sequence of an international pig reference genome version 11.1; t mutation. By optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the average daily feed intake of the boars is reduced to a certain extent, the feed efficiency of the boars is improved, the excellent boars with the characters are bred, and the progress of genetic improvement of the boars is accelerated, so that the economic benefit of breeding of the boars is effectively improved.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology and molecular marker technology, and particularly relates to a SNP molecular marker located on pig chromosome 15 and associated with the average daily feed intake trait and its application. Background Art

[0002] Feed utilization efficiency in pigs is one of the most important economic traits in pigs. It is not only the primary goal of genetic improvement for pigs, but also a key indicator for assessing pig growth rate and the economic benefits of a company. This trait is influenced by a complex mechanism regulated by multiple genes. Studies have shown that individuals with a high average daily feed intake (DFI) gain weight faster but have lower feed efficiency. When pigs have low feed efficiency, their breeding costs are higher, which means more resources are required to breed pigs, which puts farms under greater challenges and cost pressures. With the continuous innovation of sequencing technology, the growth and development patterns of pigs can be explored at the molecular level, laying the foundation for the selection or improvement of pig breeds, increasing the intensity and precision of selection, and accelerating genetic progress. The development of this trend makes more precise and scientific breeding strategies possible, which is expected to promote more sustainable development of the pig industry.

[0003] Early methods of measuring DFI involved subtracting the weight of the remaining feed in the trough from the weight of the feed delivered, or by placing less feed in the trough than normal. However, these methods were imprecise. Excessive feed wasted and increased costs, while too little was detrimental to pig growth.

[0004] With the development of computers and electronic technology, the level of automation in animal husbandry has significantly increased. Methods for measuring feed utilization efficiency have evolved from manual measurement, a combination of manual and equipment measurement, to electronic automatic equipment measurement. Current electronic automatic feeding systems are computer-controlled and integrate weight and feed sensors, time recording devices, and individual ear tag recognition devices. When a pig enters the measuring device, the system automatically identifies its ear tag and records the time of entry. It also measures its weight and real-time feed intake. When it leaves, it records the time it leaves. Based on this data, key indicators such as the pig's feed intake, feeding time, and feed conversion efficiency are calculated, greatly improving the accuracy of data collection.

[0005] Genome-wide association studies (GWAS) have become a mainstream method for identifying genetic markers for traits with low heritability. Compared to QTL mapping and candidate gene methods, GWAS can precisely locate genetic factors that influence phenotypic and economic traits across the genome, demonstrating unique advantages in genetic improvement of complex traits. Summary of the Invention

[0006] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP molecular marker located on porcine chromosome 15 and associated with the average daily feed intake trait.

[0007] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular marker.

[0008] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular marker, which comprises the above-mentioned primer pair.

[0009] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.

[0010] A fifth object of the present invention is to provide a method for genetic improvement of pigs.

[0011] The purpose of the present invention is achieved through the following technical solutions:

[0012] A single-nucleotide polymorphism (SNP) molecular marker associated with average daily feed intake (ADFI) on porcine chromosome 15. The SNP corresponds to the C>T mutation at position 122335983 on chromosome 15 of the International Porcine Reference Genome Version 11.1. The polymorphism at this site affects the average daily feed intake trait in pigs. The average daily feed intake of pigs with the TT and TC genotypes is lower than that of pigs with the CC genotype.

[0013] The pigs are Duroc and its synthetic strains;

[0014] The pigs are preferably American Duroc and its synthetic strains;

[0015] The nucleotide sequence of the SNP molecular marker is preferably as shown in SEQ ID NO: 1, wherein M in the sequence is C or T, resulting in differences in the average daily feed intake of pigs;

[0016] The SNP site of the SNP molecular marker is the nucleotide mutation C145-T145 at position 145 of the sequence annotation of SEQ ID NO: 1, named: g.145C>T (corresponding to the C>T mutation at position 122335983 on chromosome 15 of the reference sequence of the International Porcine Reference Genome Version 11.1);

[0017] A primer pair for detecting the above-mentioned SNP molecular marker comprises primer P001-F and primer P002-R, the nucleotide sequences of which are shown below:

[0018] P001-F: 5'-GTCCTTAACTCTGTTGAATCTG-3';

[0019] P002-R: 5'-CCTGGTATGATCCTAATCTAAC-3';

[0020] A kit for detecting the above-mentioned SNP molecular marker, comprising the above-mentioned primer pair;

[0021] Application of the SNP molecular marker, primer pair or kit in identifying traits related to average daily feed intake of pigs, screening pig breeds with low average daily feed intake or high feed efficiency, or genetic breeding of traits related to average daily feed intake of pigs;

[0022] The genetic breeding is preferably molecular marker-assisted breeding;

[0023] The pigs are Duroc and its synthetic strains;

[0024] The pigs are preferably American Duroc and its synthetic strains;

[0025] A method for detecting traits related to average daily feed intake of pigs, comprising the following steps:

[0026] Detecting the above-mentioned SNP molecular marker on pig chromosome 15, and judging the pig's average daily feed intake-related traits based on whether the single nucleotide at the SNP site of the molecular marker is C or T; wherein the average daily feed intake of pigs with TT genotype and TC genotype is lower than the average daily feed intake of pigs with CC genotype;

[0027] A method for screening pig breeds with low average daily feed intake or high feed efficiency using the above-mentioned SNP molecular markers comprises the following steps:

[0028] The above molecular markers on pig chromosome 15 were detected, and based on the SNP sites of the SNP molecular markers, individuals with the CC genotype were eliminated, and individuals with the TC or TT genotypes were retained; wherein, the average daily feed intake of pigs with the TT and TC genotypes was lower than that of pigs with the CC genotype;

[0029] The detection method comprises the following steps:

[0030] (1) Extracting genomic DNA from the pig to be tested;

[0031] (2) using the above primer pair or the primer pair in the above kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, performing PCR amplification to obtain a PCR amplification product;

[0032] (3) Sequencing the PCR amplification product to obtain sequencing results;

[0033] (4) determining the genotype of the SNP molecular marker based on the sequencing results;

[0034] The pigs are Duroc and its synthetic strains;

[0035] The pigs are preferably American Duroc and its synthetic strains;

[0036] A method for genetic improvement of pigs, comprising the following steps:

[0037] Determine the sites of the above-mentioned SNP molecular markers of the sows in the sow core group, and make corresponding selections based on the molecular markers: select sow individuals with the TT or TC genotype at site 122335983 on chromosome 15 of the International Porcine Reference Genome 11.1 version from the sow core group, and eliminate sow individuals with the CC genotype at the site, so as to increase the frequency of the allele T at the site generation by generation, thereby reducing the average daily feed intake of offspring pigs and improving feed efficiency;

[0038] The pigs are Duroc and its synthetic strains;

[0039] The pigs are preferably American Duroc and its synthetic strains;

[0040] Application of the SNP molecular marker, primer pair or kit in the field of gene editing or transgenic;

[0041] A method for establishing a new pig strain and / or a new pig breed with low average daily feed intake or high feed efficiency comprises the following steps:

[0042] For pigs whose genotype of the above SNP molecular marker is CC, the CC genotype is mutated to TT genotype or TC genotype by site-directed mutagenesis;

[0043] The mutation is carried out by using a transgenic method or a gene editing method;

[0044] The mutation is preferably performed using the CRISPR / Cas9 gene editing method;

[0045] The present invention has the following advantages and effects compared to the prior art:

[0046] (1) The present invention selects DFI as an indicator of feed efficiency for improved pigs, studies and determines that the molecular marker that affects the average daily feed intake-related traits of pigs is located on the nucleotide sequence on chromosome 15 of the pig, verifies its effect on the average daily feed intake trait, and finally establishes an efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of reducing the average daily feed intake of breeding pigs to a certain extent, thereby improving the feed efficiency of offspring pigs, improving the production performance of breeding pigs, increasing the economic profit of the enterprise, and increasing core competitiveness.

[0047] (2) The present invention provides a primer pair and a kit for detecting the above-mentioned SNP molecular marker. Through the primer pair and the kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select the average daily feed intake trait and accelerate the breeding process.

[0048] (3) The present invention can increase the frequency of the dominant allele from generation to generation by optimizing the dominant allele of the above-mentioned SNP molecular marker, thereby reducing the average daily feed intake of breeding pigs to a certain extent, breeding excellent breeding pigs with lower average daily feed intake and higher feed efficiency, accelerating the progress of pig genetic improvement and effectively improving the economic benefits of breeding pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is the Manhattan plot of the genome-wide association study (GWAS) of Duroc pigs on chromosome 15 using GCTA software. The x-axis represents the chromosome number of the pig; the y-axis represents the -log 10 P value.

[0050] Figure 2 Figure 2 is a box plot of the average daily feed intake of pigs with different genotypes; ***: P < 0.001, extremely significant difference; ns: no significant difference. DETAILED DESCRIPTION

[0051] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0052] Example 1 Test subjects, phenotypic determination and tissue sample collection

[0053] (1) Experimental animals

[0054] The experimental pig population used in this study was a core herd of American Duroc pigs from a Guangdong company. A total of 2,387 Duroc pigs were selected from this core herd, and their pedigrees were carefully documented. The pigs were given free access to feed and water, and the feeding regimen and housing conditions remained consistent throughout the experiment, using conventional methods.

[0055] (2) Phenotypic determination

[0056] The average daily feed intake of 2387 Duroc pigs was measured using a measuring station according to conventional methods.

[0057] (3) Pig tissue sample collection

[0058] To extract DNA, ear samples from the above 2,387 American Duroc pigs were collected, stored in a -80°C refrigerator, and subsequently transferred to the company for SNP chip genotyping.

[0059] Example 2 SNP chip genotyping and genome-wide association analysis

[0060] (1) 50K SNP chip genotyping

[0061] ① The pig ear samples obtained in Example 1 were sent to Newgene Biotech (Shanghai) Co., Ltd. for genotyping using the porcine Geneseek Porcine 50K SNP chip (Illumina, USA) on the Illumina Beadstration platform according to the company's standard procedures. The specific steps included: DNA extraction, filtering based on DNA quality, etc., and finally obtaining the original PLINK format (.map, .ped) files.

[0062] ② Use PLINK (v2.0) to convert the original PLINK format (.map, .ped) files into binary PLINK format files.

[0063] ③ Due to the poor accuracy of chip data, Swine Imputation Server (SWIM1.0)

[0064] The imputation panel (https: / / quantgenet.msu.edu / swim / index.html) is a genomic reference panel designed specifically for pigs, containing 30,489,782 single nucleotide polymorphisms (SNPs) and 4,125,579 insertion / deletion mutations (InDels). The SWIM panel is a reference haplotype panel constructed from 2,259 whole-genome sequenced animals, covering 44 pig breeds. Therefore, the present invention utilizes impute5 software, combined with the Swine Imputation Server imputation panel, to perform genotype imputation on the chip data obtained in step 2.

[0065] ④ Subsequently, quality control was performed on the data after filling in step ③ using the PLINK software (v2.0) with the following parameters: --geno 0.05 --maf 0.05 --hwe 1e-6. Finally, a PLINK-formatted (.fam, .bim, .bed) file containing 34,619,255 variant sites was obtained.

[0066] (2) Single-site genome-wide association (GWAS) analysis

[0067] We used the GCTA software developed by Professor Jian Yang and others from the School of Life Sciences at Westlake University to perform single-site GWAS analysis. Specifically, we used a univariate mixed linear model to perform GWAS between variant sites and traits. The univariate mixed linear model is as follows:

[0068] y=a+bx+g+e

[0069] Where y is the phenotype, a is the mean term, b is the additive effect of the candidate SNP to be tested for association (fixed effect), x is the SNP genotype indicator variable coded as 0, 1, or 2, g is the polygenic effect (random effect), that is, the cumulative effect of all SNPs (captured by the GRM calculated using all SNPs), and e is the residual. For ease of calculation, the genetic variance var(g) is estimated based on the null model, that is, y = a + g + e, and then fixed when testing the association between each SNP and the trait.

[0070] The specific single-site genome-wide association (GWAS) analysis method is as follows:

[0071] ① Use GCTA software to convert the PLINK format file obtained in step (2) into GRM format as the genotype file, and extract the average daily feed intake in the original phenotype file as the phenotype file; use GCTA software, select the --pca parameter, input the GRM format genotype file to calculate PCA and take the first two principal components, extract the sex and batch corresponding to the individual in the original record and the calculated first two principal components of PCA as the covariance file.

[0072] ② Prepare the genotype, phenotype, and covariance files in the format required by the GCTA software and input them into the software to obtain the significant loci. Based on previous research, the present invention sets the significance threshold at the genome level to 5.00E-08 and the significance threshold at the chromosome level to 5.00E-06.

[0073] The results of single-site GWAS analysis are as follows Figure 1 As shown in the figure, it can be seen that there is a SNP site on chromosome 15 of Duroc pigs that significantly affects the average daily feed intake, corresponding to the C>T mutation at position 122335983 on chromosome 15 of the reference sequence of the international pig reference genome version 11.1 (nucleotide 145 g.145C>T in SEQ ID NO: 1, named: g.145C>T) (p value is 3.80E-07).

[0074] (3) Correlation analysis between different genotypes and average daily feed intake phenotypes

[0075] Single-site GWAS results revealed a single-nucleotide polymorphism (SNP) site g.145C>T on chromosome 15 that significantly influences the average daily feed intake trait, and this mutation site has received particular attention. Table 1 shows that the SNP site g.145C>T is highly significantly correlated with the average daily feed intake trait (P<0.001), indicating that the molecular marker corresponding to this SNP site significantly influences the average daily feed intake trait in pigs. Through assisted selection of this SNP site in pigs, the average daily feed intake of the population can be reduced to a certain extent, improving feed efficiency, thereby reducing breeding costs and improving economic benefits.

[0076] In addition, according to Table 1, the average daily feed intake of TT and TC types is lower than that of CC type, and the feed efficiency is higher, indicating that homozygous CC is the most disadvantageous to the average daily feed intake and feed efficiency. Figure 2 Further investigation revealed that homozygous CC pigs differed significantly from TC and TT pigs, further demonstrating that homozygous CC pigs have the most detrimental effects on average daily feed intake and feed efficiency. Average daily feed intake is an important trait for measuring pig production performance. To a certain extent, high average daily feed intake indicates low feed efficiency and poor production performance, and therefore, CC pigs have the worst production performance. During breeding, CC pigs should be eliminated, while TT and TC pigs should be retained to increase the frequency of the T allele at this locus with each generation. Currently, the frequency of the dominant allele in this population is only 30.71%, indicating significant room for genetic improvement.

[0077] Table 1 Correlation analysis between molecular marker SNP site g.145C>T and average daily feed intake

[0078]

[0079] Note: Average daily feed intake is expressed as mean ± standard deviation (SD). The total number of individuals was 2,387, of which phenotypic data were missing for 363 pigs.

[0080] Example 3 Target DNA sequence amplification and sequencing

[0081] (1) Primer design

[0082] The DNA sequence of porcine chromosome 15, SEQ ID NO: 1, was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using Primer Premier 6.0, and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The DNA sequences of the designed primers are shown below:

[0083] P001-F: 5'-GTCCTTAACTCTGTTGAATCTG-3' (SEQ ID NO: 2);

[0084] P002-R: 5'-CCTGGTATGATCCTAATCTAAC-3' (SEQ ID NO: 3).

[0085] (2) PCR amplification

[0086] To a 10 μL reaction system, add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2× Taq PCR StarMix with Loading Dye, and 0.3 μL each of primers P001-F and P002-R. PCR reaction conditions were: 94°C denaturation for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 64.5°C for 30 seconds, and extension at 72°C for 45 seconds, with a final extension at 72°C for 5 minutes.

[0087] (3) DNA sequence determination

[0088] DNA sequencing was performed at Shenzhen BGI Genomics Co., Ltd., using both forward and reverse reactions. The sequence was compared with the NCBI genome sequence to identify the mutation at the corresponding SNP site. The sequencing results are as follows: GTCCTTAACTCTGTTGAATCTGAATCTATTCCCTCTTCTAATTTAAGACATGCAGTAC CTGGGGCTCAAAGAAATTAACTTATTCGTTTAAGTTTCCAGAGTTAATAGTGGCAGAG ATGAGATTCAAATCTACATTCCTCCTTT M(C or T) TCCTGTCTAGTGGGCTTTCTACT GCATCATGTTTAAAGTGGCATGATTATTTCAGTAATAGCCTTAGAGATAGCTAGTTAG ATTAGGATCATACCAGG (SEQ ID NO: 1)

[0089] Note: The M marked in the sequence table is the mutation site, which is underlined (the mutated base in brackets is the allele mutation), and the positions of the designed primer sequences are bolded at the beginning and end of the sequence.

[0090] Example 4 Analysis of the Effect of Molecular Marker SNP Site g.145C>T

[0091] According to Table 1 and Figure 2As shown, the effect of the dominant allele (TT) of the g.145C>T SNP locus on average daily feed intake (ADFI) significantly decreased by 0.07 kg / head compared to the CC phenotype. To a certain extent, lower ADI leads to higher feed efficiency in breeding pigs, significantly reducing feed costs and creating value for the company. By optimizing the dominant allele (T) of this SNP in Duroc pigs, the economic benefits of commercial pigs can be improved, thereby increasing corporate profits.

[0092] The present invention detects the 145th base mutation site in the SEQ ID NO: 1 sequence and preliminarily conducts an association analysis between its genotype and the average daily feed intake trait of pigs, thereby providing a new molecular marker for molecular marker-assisted selection of pigs.

[0093] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A SNP molecular marker located on chromosome 15 of pigs and associated with the average daily feed intake trait, characterized in that Its SNP site corresponds to the C>T mutation at position 122335983 on chromosome 15 of the reference sequence of the international pig reference genome version 11.

1. The polymorphism of the base at this site affects the average daily feed intake trait of pigs. Among them, the average daily feed intake of pigs with TT genotype and TC genotype is lower than that of pigs with CC genotype.

2. The SNP molecular marker located on porcine chromosome 15 and associated with the average daily feed intake trait according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, wherein M in the sequence is C or T.

3. A primer pair for detecting a SNP molecular marker located on chromosome 15 of pigs and associated with the average daily feed intake trait, characterized in that The primer pair comprises primer P001-F and primer P002-R, and the nucleotide sequences thereof are as follows: P001-F: 5'-GTCCTTAACTCTGTTGAATCTG-3'; P002-R: 5'-CCTGGTATGATCCTAATCTAAC-3'.

4. A kit for detecting SNP molecular markers on chromosome 15 of pigs related to average daily feed intake, characterized in that The kit comprises the primer pair described in claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 4 in identifying traits related to average daily feed intake of pigs, screening pig breeds with low average daily feed intake or high feed efficiency, or genetic breeding of traits related to average daily feed intake of pigs.

6. A method for detecting traits related to average daily feed intake of pigs, characterized in that The following steps are included: Detect the SNP molecular marker described in claim 1 or 2 on pig chromosome 15, and judge the pig's average daily feed intake-related traits based on whether the single nucleotide at the SNP site of the molecular marker is C or T; wherein the average daily feed intake of pigs with TT genotype and TC genotype is lower than that of pigs with CC genotype.

7. A method for screening pig breeds with low average daily feed intake or high feed efficiency using a SNP molecular marker located on pig chromosome 15 and associated with the average daily feed intake trait, characterized in that The following steps are included: Detect the molecular markers described in claim 1 or 2 on pig chromosome 15, and eliminate individuals with a CC genotype based on the SNP site of the SNP molecular marker, while retaining individuals with a TC or TT genotype; wherein the average daily feed intake of pigs with TT and TC genotypes is lower than that of pigs with CC genotype.

8. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the sites of the SNP molecular markers described in claim 1 or 2 of the breeding pigs in the breeding pig core group, and make corresponding selections based on the molecular markers: select breeding pig individuals with TT or TC genotypes at site 122335983 on chromosome 15 of the International Porcine Reference Genome 11.1 version in the breeding pig core group, and eliminate breeding pig individuals with CC genotypes at this site, so as to increase the frequency of the allele T at this site from generation to generation, thereby reducing the average daily feed intake of offspring pigs and improving feed efficiency.

9. Use of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 4 in the field of gene editing or genetic modification.

10. A method for establishing a new pig strain and / or new pig breed with low average daily feed intake or high feed efficiency, characterized in that The following steps are included: For a pig whose genotype of the SNP molecular marker according to claim 1 or 2 is CC, the CC genotype is mutated to a TT genotype or a TC genotype by site-directed mutagenesis.

Images