Application of rice OsSRR1 gene in resisting rice stripe disease
By screening and editing the OsSRR1 gene and using CRISPR/Cas9 technology to construct OsSRR1 mutant rice, the problem of insufficient target genes in the prevention and control of rice stripe leaf blight was solved, the disease resistance of rice was significantly enhanced, and the virus content and lesion formation were reduced.
Patent Information
- Application Number
- CN202511292882.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-11
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2045-09-11
AI Technical Summary
There are few target genes for preventing and controlling rice stripe disease in existing technologies, which makes disease prevention and control difficult. In addition, rice stripe virus is transmitted by small brown planthoppers, making it difficult to effectively control the spread of the disease.
By sequencing the transcriptome of rice infected with rice stripe virus, the OsSRR1 gene was screened out, and the CRISPR/Cas9 gene editing technology was used to construct an OsSRR1 gene knockout strain to enhance the disease resistance of rice. The OsSRR1 mutant was prepared to reduce the virus content and inhibit lesion formation.
OsSRR1 mutant transgenic rice significantly enhanced resistance to rice stripe virus, reduced virus content and lesion formation, and provided new targets and breeding methods for the prevention and control of rice stripe disease.
Smart Images

Figure CN120758526A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of plant disease control, and particularly relates to application of a rice OsSRR1 gene in resistance to rice stripe disease. BACKGROUND
[0002] Rice stripe disease is a disease caused by rice stripe virus (RSV), and its outbreak has become a major biological stress factor threatening global rice stable yield. Field investigation shows that the harmfulness of the disease is not only reflected in direct yield loss, but also in grain filling disorder caused by damage to the photosynthetic system of the plant, forming "pseudo-full grains" and other hidden damage characteristics. After years of research, it has been confirmed that rice stripe virus is the pathogenic agent. The virus completes the transmission cycle through the persistent multiplication of the gray rice leafhopper, and the population of the intermediate insect has a significant positive correlation with the prevalence of the disease. In recent years, based on the breeding of resistant varieties and the promotion and application of the comprehensive control technology system, the overall occurrence of the disease has shown a downward trend, but there is still a risk of persistent prevalence in local areas. Therefore, it is necessary to continue to implement the plant protection principle of "prevention first and comprehensive control", focus on the key nodes of the year-round infection cycle of the virus, and systematically implement the "four-in-one" comprehensive management strategy of "resistance (application of resistant varieties), avoidance (virus transmission period), interruption (transmission route), and treatment (intermediate control)", so as to build a long-term mechanism for sustainable control of the disease. However, there are still relatively few known target genes for preventing and treating rice stripe disease.
[0003] Serine / arginine-rich (SR) proteins are a class of RNA-binding proteins, which contain an RNA recognition domain (RRM) at the N-terminus and are rich in arginine-serine (RS) dipeptide repeats of different lengths at the C-terminus. SR proteins act as splicing factors in animals and plants, and have been studied in depth. For example, the MoSrp1 protein of Magnaporthe oryzae regulates the molecular mechanism of pathogenicity of the fungus by affecting the alternative splicing of introns in precursor mRNA; the deletion of the MoSRP1 gene leads to significant reduction in mycelial growth, spore development, sporulation capacity, and pathogenicity of the fungus, and also leads to thousands of abnormal intron alternative splicing events. However, the relationship between the OsSRR1 gene encoding serine / arginine-rich protein in rice and rice virus is not clear, and no research report has been found.
[0004] In summary, there is an urgent need to discover new targets for effectively preventing and treating rice stripe disease and to develop new disease-resistant methods. SUMMARY
[0005] In response to the current technical problem of limited targets for preventing and controlling rice stripe disease, the present invention provides an application of the rice OsSRR1 gene in resistance to rice stripe disease, belonging to the field of plant disease prevention and control. The present invention preliminarily obtained 22 genes related to plant stripe virus infection and involved in RNA splicing and RNA binding by performing transcriptome sequencing analysis on rice infected with rice stripe virus. The expression levels of the genes were then verified using qRT-PCR technology. Among them, the mRNA expression of four genes (LOC_Os12g38430 (OsSRR1), LOC_Os01g06290, LOC_Os03g17710, and LOC_Os04g02870) was significantly induced by rice stripe virus. Therefore, rice knockout lines of the four genes were constructed respectively, and the disease resistance phenotypes of the transgenic rice lines were observed. It was found that only the OsSRR1 gene knockout line showed a significant disease resistance phenotype, namely, it could significantly reduce the content of rice stripe virus in rice and inhibit the formation of lesions. Therefore, a new target gene OsSRR1 for preventing and controlling rice stripe disease was finally screened out. In summary, the present invention provides the use of the OsSRR1 gene and its mutants in genetic improvement and breeding of rice disease resistance, which has great application prospects.
[0006] More specifically, the present invention uses the CRISPR / Cas9 gene editing system to target and edit the OsSRR1 gene. First, a YL-Hu-OsSRR1 knockout vector was constructed, and callus tissue induced from mature embryos of rice Zhonghua 11 was transformed using rice callus transfection. After obtaining T0-generation transgenic rice seeds, further propagation was performed to obtain T1-generation seeds. DNA from young leaves of individual T1 plants was extracted, and the sgRNA targeting site was amplified using target-specific primers and sequenced to obtain stably inherited homozygous mutant transgenic plants.
[0007] Experimental results showed that RSV-inoculated OsSRR1 mutant transgenic plants exhibited significantly lower symptoms and viral expression at both the RNA and protein levels than wild-type ZH11 plants. This suggests that OsSRR1 mutant transgenic rice significantly enhances resistance to RSV infection and has promising applications in the field of transgenic rice. In summary, this invention provides practical guidance for the cultivation of transgenic plants resistant to rice stripe disease and holds significant promise for plant disease control.
[0008] To achieve the above object, the technical solutions adopted by the present invention are as follows:
[0009] On the one hand, the present invention provides the use of SRR1 gene / protein as a target for preventing and controlling plant diseases caused by tenuivirus, wherein the SRR1 gene has the nucleotide sequence shown in SEQ ID NO: 1; the SRR1 protein has the amino acid residue sequence shown in SEQ ID NO: 2.
[0010] In some specific embodiments, the SRR1 gene / protein is the OsSRR1 gene / protein from rice, the sequence of the OsSRR1 gene is shown in SEQ ID NO: 1; the sequence of the OsSRR1 protein is shown in SEQ ID NO: 2.
[0011] The Tenuiviruses include Echinochloa hojablanca virus (EHBV), Maize stripe virus (MSpV), Rice grassy stunt virus (RGSV), Rice hoja blanca virus (RHBV), Rice stripe virus (RSV), and Urochloa hoja blanca virus (UHBV), preferably Rice stripe virus (RSV).
[0012] Furthermore, the plant is a grass plant.
[0013] The grass plants include but are not limited to rice, corn, wheat, oats and barley; more preferably rice, and most preferably Hordeum vulgare 11.
[0014] On the other hand, the present invention provides an SRR1 gene mutant, which is produced by a mutation in the region shown in SEQ ID NO: 3 in the sequence shown in SEQ ID NO: 1.
[0015] The types of "mutations" include: addition, deletion, and substitution of nucleotides.
[0016] Furthermore, the gene mutant lacks any one or more of the 33rd to 37th bases in the sequence shown in SEQ ID NO: 1.
[0017] In some embodiments, the gene mutant comprises the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. More specifically, SEQ ID NO: 6 is the sequence shown in SEQ ID NO: 1 with nucleotide position 37 deleted; SEQ ID NO: 7 is the sequence shown in SEQ ID NO: 1 with nucleotide positions 33 to 36 deleted.
[0018] The present invention utilizes CRISPR / Cas9 gene editing technology to introduce mutations in the ATATCGCAGTCCCCCTAGGAGGG (SEQ ID NO: 3) region of the OsSRR1 gene to prepare a variety of OsSRR1 gene mutants. The two types of mutants described above were selected for subsequent research, and it was confirmed that the mutants can enhance resistance to rice stripe disease. Among them, the more preferred one is the one that lacks nucleotide 37 of the OsSRR1 gene (SEQ ID NO: 1), corresponding to SEQ ID NO: 6.
[0019] On the other hand, the present invention provides an SRR1 protein mutant, characterized in that the protein mutant refers to an SRR1 protein that is terminated prematurely, and the sequence of the SRR1 protein has an amino acid residue sequence shown in SEQ ID NO: 2 or an amino acid residue sequence that has more than 80% homology with the amino acid residue sequence.
[0020] The SRR1 protein mutant is encoded by the above-mentioned SRR1 gene mutant. In other words, the SRR1 protein of the present invention is indirectly produced by CRISPR / Cas9 gene editing technology.
[0021] "Premature termination" refers to the deletion / addition / replacement of bases at specific sites within the open reading frame of the SRR1 gene, resulting in premature termination of the SRR1 protein and the subsequent inability to produce a complete SRR1 protein. The site of the SRR1 gene mutation determines the amino acid sequence and activity of the protein it encodes. It is important to understand that gene mutations can lead to loss of protein function or enhance protein activity, which requires specific analysis of each case.
[0022] Furthermore, the number of amino acid residues constituting the SRR1 protein mutant is less than 50.
[0023] Furthermore, the protein mutant terminates prematurely at the 45th or 46th amino acid position of the SRR1 protein.
[0024] Among them, the protein mutant terminating at the 45th amino acid site corresponds to the OsSRR1 gene mutant lacking nucleotides 33 to 36 (i.e., SEQ ID NO: 7); the protein mutant terminating at the 46th amino acid site corresponds to the OsSRR1 gene mutant lacking nucleotide 37.
[0025] Specifically, the protein mutant contains the amino acid residue sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5.
[0026] The amino acid residue sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 correspond to protein mutants with premature termination at amino acid positions 45 and 46, respectively. The present invention demonstrates that protein mutants with premature termination at amino acid position 46 can both enhance resistance to rice stripe disease and enable the SRR1 protein to function normally in rice growth and development. Therefore, these protein mutants are preferred.
[0027] Furthermore, the SRR1 gene mutant or protein mutant is used to prepare an anti-plant disease agent, wherein the gene mutant and the protein mutant are as described above.
[0028] On the other hand, the present invention provides a biological material containing the above-mentioned SRR1 gene or the above-mentioned SRR1 gene mutant or the above-mentioned SRR1 protein mutant, wherein the biological material is any one or more of a vector, a host cell, a transformed plant cell, and a plant.
[0029] In some embodiments, CRISPR / Cas9 gene editing technology is used to prepare or generate corresponding SRR1 gene / protein mutants in the biological material (such as callus tissue, rice plant). In the present invention, the biological material refers to the OsSRR1 knockout mutant (OsSRR1-ko) of Zhonghua 11; more specifically, the OsSRR1-ko includes OsSRR1-ko-#1 and OsSRR1-ko-#2, wherein OsSRR1-ko-#1 corresponds to a protein mutant terminating at the 46th amino acid site (SEQ ID NO: 5) or a gene mutant in which the 37th nucleotide of the sequence shown in SEQ ID NO: 1 is deleted (SEQ ID NO: 6); OsSRR1-ko-#2 corresponds to a protein mutant terminating at the 45th amino acid site (SEQ ID NO: 4) or a gene mutant in which the 33rd to 36th nucleotides of the sequence shown in SEQ ID NO: 1 are deleted (SEQ ID NO: 7); OsSRR1-ko-#1 and its corresponding mutations are preferred.
[0030] Furthermore, the present invention provides the use of a biological material containing the above-mentioned SRR1 gene or the above-mentioned SRR1 gene mutant or the above-mentioned SRR1 protein mutant in rice disease resistance breeding.
[0031] In some embodiments, the biological material is rice, and the variety is Zhonghua 11.
[0032] The beneficial effects of the present invention include:
[0033] 1. Using RNA-Seq technology, through multiple rounds of screening, a new target gene for controlling rice stripe disease, OsSRR1, was identified, providing new ideas for the prevention and control of rice stripe disease;
[0034] 2. Using CRISPR / Cas9 technology, multiple OsSRR1 gene / protein mutants were generated, and one was identified that not only improves rice resistance to rice stripe disease but also maintains normal function in regulating other physiological processes, providing new options for plant disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0036] Figure 1 : Hierarchical cluster analysis of differentially expressed genes.
[0037] Figure 2 : Expression detection results of variable splicing-related genes at the RNA level.
[0038] Figure 3 :The mutation of OsSRR1 gene / protein in OsSRR1-ko knockout strain, among which, Figure 3 A in the figure indicates the mutation of OsSRR1 gene; Figure 3 B in the figure represents the mutation of OsSRR1 protein.
[0039] Figure 4 : mRNA expression level of OsSRR1 gene in OsSRR1-ko knockout line.
[0040] Figure 5 : Disease symptoms of OsSRR1-ko knockout strain and control Zhonghua 11 after RSV infection.
[0041] Figure 6: qRT-PCR detection results of RSV virus content in OsSRR1-ko knockout strain and control Zhonghua 11 after RSV infection.
[0042] Figure 7 : Results of RSV viral protein level detection in the OsSRR1-ko knockout strain and the control Zhonghua 11 after RSV infection, CP protein: capsid protein.
[0043] Meaning of the symbols in the figure:
[0044] ZH11: Zhonghua 11 wild-type rice; OsSRR1-ko: Zhonghua 11 rice line with OsSRR1 knockout gene. DETAILED DESCRIPTION
[0045] The present invention is further elaborated below in conjunction with the accompanying drawings and specific embodiments. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.
[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and three replicates were used. The rice varieties used in the present invention are Nipponbare (Nip) and Zhonghua 11. The relevant culture media are detailed in Table 1. The materials and reagents used are commercially available unless otherwise specified.
[0047] Table 1 Culture medium selected in the present invention
[0048]
[0049] Example 1: Experimental method
[0050] 1.1 Artificial inoculation of RSV
[0051] Rice materials (such as Nip, Zhonghua 11, and OsSRR1-ko transgenic lines) were soaked and germinated for 2-3 days. After the radicle broke through the seed coat, the radicle end was vertically implanted downward into a standard glass culture vessel with a volume of 1 L using the directional sowing method. Approximately 30 seeds were placed in each beaker. Three biological replicates were set up and cultured at 30°C under 16 h light / 8 h dark conditions.
[0052] The artificial virus transmission process is mainly divided into three steps: identification of RSV virus source, acquisition of virus by vector insects and virus transmission by vector insects.
[0053] First, RSV-infected rice plants were collected from the field for total RNA extraction. RT-qPCR was performed using RSV (CP)-specific primers to detect viral mRNA levels in the infected plants. After pretreatment, infected plants were transplanted according to the following process: aged leaves were removed, while young stem and leaf tissue was retained. The infected rice samples were then transferred to 5 L transparent glass containers for substrate fixation. The roots were then wrapped with paddy soil to optimize water contact. The container surface was covered with multiple layers of filter paper to absorb excess liquid and maintain a suitable humidity environment for insect activity. After transplanting, newly hatched larvae (1-2 instars) of small brown planthoppers were brushed onto the infected seedlings using a soft-bristled brush. The seedlings were sealed with gauze and placed in an artificial climate chamber (26°C, 16 h light: 8 h dark) to allow natural infection. The poison acquisition cycle is set at 3-5 days, and the duration of poisoning is adjusted according to the physiological state of the poison source; after the poison acquisition is completed, the insects are transferred to healthy Wuyujing No. 3 seedlings and completed a 10-12 day cycle culture. During this period, the host plants are replaced regularly to ensure the normal development of the insects.
[0054] After the virus feeding is complete, the vector insects enter the transmission phase. At the beginning of the vector insect cycle phase, the virus recipient plant cultivation process must be initiated simultaneously. Specific implementation methods: Once the seedlings from the above steps reach the same height as the top of a 5-liter transparent glass container, they can be used as recipient material for virus inoculation. Vector insects that have completed the cycle phase are inoculated at a density of two per plant for virus transmission experiments. An insect suction device is used to precisely control the inoculum number, and a soft-bristled brush is used to evenly disperse the insects onto the surface of the recipient plants. The inoculation cycle lasts for 72 hours; the duration of inoculation is adjusted appropriately based on the physiological state of the recipient plants and insect vitality. After inoculation, the vector insects are re-seeded with a soft-bristled brush onto healthy Wuyujing No. 3 seedlings. The inoculated recipient plants are watered and allowed to recover in an artificial climate for 48 hours. They are then transplanted to the field experimental plot according to standard agronomic practices, and the progression of the disease is continuously observed and recorded.
[0055] Finally, a virus inoculation experiment was conducted using healthy 3rd- to 4th-instar gray leafhoppers carrying RSV. 2-3 gray leafhoppers were inoculated onto rice leaves at the 3- to 4-leaf stage (two-week-old) at a ratio of 2-3 gray leafhoppers per plant. Rice inoculated with gray leafhoppers of the same age that did not carry RSV was used as a control. After feeding the gray leafhoppers with rice for 3 days, all the insects were swept out.
[0056] 1.2 Detection of gene expression levels
[0057] The expression level of the gene can be detected by RNA level (such as qRT-PCR and RNA-seq) and protein level (such as Western blot).
[0058] 1.2.1 RNA level detection
[0059] Total RNA was extracted from rice leaves 30 days after RSV inoculation using the TRIzol reagent kit. The RNA was sent to Hangzhou Lianchuan Biotechnology Co., Ltd. for transcriptome sequencing. qRT-PCR (ChamQ SYBR qPCR Master Mix (Low Rox) Kit) was used to measure the expression of specific genes. Gene information and quantitative primers used are shown in Table 2.
[0060] Table 2 Gene information and qRT-PCR primers
[0061]
[0062] 1.2.2 Protein level detection
[0063] The experimental steps of Western blot are as follows:
[0064] Before performing Western blot analysis, you need to prepare an SDS-PAGE gel. Because different proteins have different molecular weights, SDS-PAGE gels of varying concentrations need to be prepared. This study used 12% SDS-PAGE gels. The specific steps are as follows:
[0065] (1) Install the glue making device in the fume hood and fix the glue plate. Add an appropriate amount of dd H2O to the center of the glue plate and let it stand for 10 minutes. The sealing performance can be judged by the change of the liquid level.
[0066] (2) After confirming that the gel plate is fixed, prepare 12% SDS-PAGE lower separation gel, mix thoroughly, and add 5 mL of each gel to the pre-assembled gel plate. Then add isopropanol to level the liquid surface and let it stand at room temperature for 1 hour to solidify.
[0067] (3) When the separation gel is completely solidified, pour off the isopropanol or dry it with filter paper. Then prepare a 5% SDS-PAGE top gel solution and add 1 mL per gel to the gel plate. When inserting the sample comb, tilt it 45° and insert it slowly to avoid air bubbles. Let it stand for 20 minutes to solidify. After solidification, remove the comb and proceed with Western blot electrophoresis.
[0068] The specific experimental steps for Western blot protein detection are as follows:
[0069] A. Electrophoresis and Wet Transfer Parameters
[0070] (1) Electrophoresis condition setting: After assembling the electrophoresis apparatus, inject 1× electrophoresis buffer and set the gradient voltage program: perform constant voltage electrophoresis at 90 V for 20 min on the upper stacking gel, and adjust to 120 V for 60 min after the sample migrates to the separation gel;
[0071] (2) Electrophoresis termination basis: Terminate electrophoresis when the frontmost band of the pre-stained protein marker migrates to the bottom of the gel, or determine the termination time based on the size of the target band required for the experiment, and cut off the colloid in the non-target area based on the protein molecular weight marker;
[0072] (3) Wet transfer process: The PVDF membrane was immersed in methanol for more than 15 seconds for activation. At this time, the membrane should evenly change from opaque to translucent. Then, it was immersed in the equilibrium buffer for more than 2 minutes and assembled in the order of anode-sponge-membrane-gel-sponge-cathode. The protein transfer was completed using the GenScript fully automatic wet transfer system.
[0073] B. Immunoblotting Detection Procedure
[0074] (1) Blocking treatment: Immerse the transferred PVDF membrane in 5% skim milk for blocking and shake at room temperature for 90 minutes;
[0075] (2) Antibody incubation: Dilute the primary antibody working solution with blocking solution according to the titer and incubate at room temperature with shaking for 120 min. Low-abundance proteins can be incubated at 4°C overnight.
[0076] (3) Secondary antibody reaction: After three rinses with TBST, add species-specific secondary antibody diluted 1:10,000 and react at room temperature with shaking for 60 min;
[0077] (4) Signal detection: After removing moisture from the surface of the PVDF membrane, the membrane surface was evenly covered with ECL developer, and the signal was collected by the chemiluminescence imaging system. After development, the uniformity of the sample loading was verified by the Ponceau red staining method.
[0078] The specific antibody against the RSV CP protein was provided by Professor Wu Jianxiang of Zhejiang University. The chemical reagents used in the experiment, including Ponceau red dye, Tris-HCl buffer systems with different pH values (pH 8.8 and 6.8), sodium dodecyl sulfate (SDS), polyacrylamide (APS), and concentrated TBS buffer (20×), were all purchased from Shanghai Bioengineering. The protein immunoblotting detection system used was the EasySee Western Blot Kit from Quanshijin Biotechnology Co., Ltd.; and the protein molecular weight standards used prestained color markers from Beijing Kangrun Chengye Biotechnology Co., Ltd.
[0079] 1.3 Construction of rice YL-Hu-OsSRR1 vector
[0080] The YL-Hu-OsSRR1 vector is a CRISPR / Cas9 gene editing vector. The present application uses overlapping PCR method to construct the vector, and the construction scheme is as follows: according to the OsSRR1 gene sequence shown in SEQ ID NO: 1, primers are designed on the CRISPR-GE website, and the sgRNA fragment is cloned from rice, and the target sequence is: ATATCGCAGTCCCCCTAGGAGGG (SEQ ID NO: 3). The PCR primer sequence is: YL-Hu-OsSRR1-F: CAGTGGTCTCATGCAACTGTGCGGTGTGTTAAAGT (SEQ ID NO: 56); YL-Hu-OsSRR1-R: CAGTGGTCTCAAAACCCAGTAATGCCTTACCCGCTGT (SEQ ID NO: 57).
[0081] After the PCR product is recovered and purified, the target sequence is connected to the U3 promoter and the gRNA scaffold, respectively, with the pYLsgRNA-OsU3 vector as the template; the two products obtained by PCR are mixed as templates, and the U3 promoter, the target sequence and the gRNA scaffold are connected together by overlapping PCR to form an sgRNA expression cassette; the gRNA expression cassette product and the uncut pYLCRISPR / Cas9Pubi-H plasmid are mixed, and the mixture is digested with Bsa I enzyme at 37°C, and the reaction time is 15 min; after the enzyme digestion reaction is completed, 1.5 μL 10 × DNA Ligase Buffer and 35 U T4 ligase are added, and the variable temperature cycle enzyme digestion and ligation are performed for 15 cycles, and the cycle program is 37°C for 5 min; 10°C for 5 min, and 20°C for 5 min; positive clones are selected, sequenced, and confirmed that the expression vector YL-Hu-OsSRR1 has been successfully constructed, the recombinant plasmid is obtained, and the quality of the plasmid is detected by 1% agarose gel electrophoresis. The recombinant vector with correct sequencing is transformed into Agrobacterium GV3101.
[0082] 1.4 Genetic transformation of rice
[0083] 1.4.1 Callus induction and subculture: Select newly harvested mature wild-type rice seeds (Zhonghua 11), peel the husks, pour into a 50-mL centrifuge tube, add 15 mL of 75% ethanol and disinfect for 1 minute, pour out the ethanol, rinse three times with sterile water, pour out, and then add 15 mL of 30% sodium hypochlorite and disinfect for 20 minutes. After pouring out the sodium hypochlorite, rinse with sterile water 5-6 times; use a pipette to remove excess water, transfer the seeds to induction medium, and place them in a 28°C light incubator for 3 weeks. Use pre-sterilized tweezers to clip the grown callus tissue to the subculture medium and subculture in a 28°C light incubator for 1 week.
[0084] 1.4.2 Transformation and Culture of Agrobacterium: The plasmid containing the target vector was transformed into Agrobacterium tumefaciens GV3101 (Manufacturer: Shanghai Weidi, Catalog No.: AC1003S) using the following steps: 5 μL of YL-Hu-OsSRR1 plasmid (concentration 100-200 ng / μL) was added to 100 μL of competent Agrobacterium GV3101, and the mixture was pipetted and mixed. The mixture was added to a sterile electrode cup pre-cooled at 4°C, and transformed by electroporation at 220 V. Non-resistant LB liquid medium was added, and the culture was shaken at 28°C for about 3 h. The culture was evenly spread on LB solid medium containing 50 μg / mL Kan and 50 μg / mL Rif, and cultured in the dark at 28°C for 2-3 days until single colonies appeared.
[0085] 1.4.3 Agrobacterium transfection of callus: Use a pipette to aspirate the infection solution and rinse the Agrobacterium off the plate to prepare the Agrobacterium suspension required for rice transformation. Select a sufficient amount of callus (in good condition, bright yellow in color, round and firm in texture, with particles approximately 3 mm in diameter) and place it in a 100 mL sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium suspension (ensure sufficient bacterial suspension is in contact with the material). Incubate the callus at room temperature for 20 minutes with occasional shaking. Pour off the bacterial suspension and place the callus on sterile filter paper to absorb any excess. Immediately transfer the callus to a solid co-culture medium covered with a layer of sterile filter paper and incubate in the dark at 26°C for 3 days.
[0086] 1.4.4 Screening and Culture: After 3 days of co-culture, the callus tissue should be cleaned. Use a 1 mL blue pipette tip to transfer the callus on the co-culture medium to a sterilized Erlenmeyer flask and rinse twice with sterile water. Rinse once with sterile water containing 500 μg / L carbenicillin for the third time. After removing excess water with a pipette, transfer the callus to sterile filter paper and use the air from the clean bench to dry the water for about 30 minutes. After the callus is dried, transfer it to the screening medium for screening culture at 28-30°C in the dark. The screening period is 3-4 weeks.
[0087] 1.4.5 Rooting of seedlings: When the seedlings grow to about 2-3 cm and have obvious roots, they can be transferred to rooting medium for further growth. The rooting medium should be poured into a higher bottle or tube so that the seedlings have enough space to grow upwards. The best conditions for rooting are sterile light culture at 28-30 degrees Celsius.
[0088] 1.5 Identification and screening of positive transgenic plants
[0089] Young leaves from individual T0 and T1 generations were extracted using the CTAB method. Target-specific primers were used to amplify the sgRNA target site. Amplified products were detected by 1% gel electrophoresis. Specific fragments of the correct size were recovered and sequenced. Sequencing primers were as follows: OsSRR1-F: ACTGTGCGGTGTGTTAAAGT (SEQ ID NO: 58); OsSRR1-R: AGTAATGCCTTACCCGCTGT (SEQ ID NO: 59). Subsequently, qRT-PCR was used to examine the expression of the OsSRR1 gene in transgenic plants. Finally, two lines with a high positive rate and no expression of the OsSRR1 gene were selected from the positive lines and subcultured to obtain T2 seeds for research on resistance to rice stripe disease (including observation of disease resistance traits).
[0090] 1.6 Analysis of rice resistance after RSV inoculation
[0091] Resistance analysis in rice primarily involves observing symptoms after disease onset and measuring viral expression in rice leaves. Rice traits were observed 30 days after virus inoculation. Two groups were used for these observations: one group consisted of normally grown rice (mock group), including OsSRR1-ko transgenic lines in the Zhonghua 11 background (OsSRR1-ko-#1 (n = 15) and OsSRR1-ko-#2 (n = 15)) and wild-type Zhonghua 11 (n = 15); the other group consisted of OsSRR1-ko transgenic lines inoculated with RSV as described in step 1.1 (OsSRR1-ko-#1 and OsSRR1-ko-#2) (n = 15) and wild-type Zhonghua 11 (n = 15). Zhonghua 11 served as the control.
[0092] Collect the above-mentioned untreated and RSV-infected rice leaves (n = 3) and detect the expression of the virus using qRT-PCR and Western blot techniques. The specific steps are the same as described in step 1.2.
[0093] Example 2: Preliminary screening of target genes for controlling rice stripe disease
[0094] To further explore the host factors that respond to rice stripe virus, the present invention artificially inoculated two-week-old rice plants with RSV (see Example 1 for details). 30 days later, leaves from diseased (n = 3) and healthy (n = 3) rice plants were collected for plant total RNA extraction. After passing quality inspection and RNA purity analysis, the extracted plant total RNA was used as a transcriptome sequencing sample for high-throughput sequencing.
[0095] After sequencing was completed, a total of 3.6×10 8 The terminal reads of 100 bp in length were used to express a total of 21,567 genes. Subsequently, the obtained data were differentially analyzed based on the criteria of differential expression fold ≥ 2 or ≤ 0.05. The analysis found that there were 8,952 differentially expressed genes after RSV infection. These differentially expressed genes were analyzed by KEGG (Kyoto Encyclopedia of Genes and Genomes) and hierarchical clustering ( Figure 1 ), and found that, similar to previous studies, hormone-related pathways and transcription factors related to disease resistance pathways were significantly enriched. It is worth noting that Cluster 8 mainly clustered 22 genes related to mRNA splicing, RNA splicing, and RNA binding functions. These genes have rarely been reported to be associated with plant resistance to rice stripe disease. In order to discover new disease resistance genes, this example conducted an in-depth analysis of Cluster 8. Specifically, these genes were verified by qPCR ( Figure 2 and Table 3). After RSV infection, the expression levels of three genes decreased, and the expression levels of six genes decreased. Overall, more than half of the genes were strongly induced after RSV infection, among which LOC_Os12g38430 (OsSRR1), LOC_Os01g06290, LOC_Os03g17710, and LOC_Os04g02870 had the highest induced expression levels. Therefore, we further explored whether these proteins play a role in RSV infection of plants.
[0096] Table 3 Expression trends of different genes after RSV infection
[0097]
[0098] Example 3: Further screening of target genes for controlling rice stripe disease
[0099] This study further screened target genes for controlling rice stripe disease by constructing knockout rice lines (Zhonghua 11) for LOC_Os12g38430 (OsSRR1), LOC_Os01g06290, LOC_Os03g17710, and LOC_Os04g02870 and observing their resistance to rice stripe disease. Due to limited space, this example uses LOC_Os12g38430 (OsSRR1) as an example to describe the above process. The specific experimental steps are the same as those described in Example 1.
[0100] This example utilizes CRISPR / Cas9 editing technology to knock out a target gene; specifically, a mutation is introduced into the region represented by SEQ ID NO: 3 of the OsSRR1 gene (SEQ ID NO: 1). It should be understood that when using CRISPR / Cas9 technology for gene editing, mutations can only be guaranteed to occur within a specific sequence region, and the type of mutation that occurs within this region (e.g., nucleotide deletions, additions, or substitutions) is uncontrollable and random.
[0101] In this example, 20 OsSRR1 gene knockout mutants (OsSRR1-ko) were obtained, and the mutation status of each strain was different. Then, two OsSRR1 gene knockout strains (OsSRR1-ko-#1 and OsSRR1-ko-#2) with homozygous mutations and high positive rates were obtained through screening. The specific mutation status is as follows: Figure 3 shown.
[0102] Sequencing results showed that OsSRR1-ko-#1 lacked a base A at the target site, meaning that the OsSRR1 protein terminated prematurely at the 46th amino acid site, corresponding to the sequence shown in SEQ ID NO: 5; while OsSRR1-ko-#2 lacked four bases CCCT at the target site, causing the OsSRR1 protein to terminate prematurely at the 45th amino acid site, corresponding to the sequence shown in SEQ ID NO: 4. It should be understood that although the two protein mutants terminated at the 46th or 45th amino acid sites, respectively, the sequences of these protein mutants after the 12th or 11th amino acid residues were not identical to those of wild-type ZH11 ( Figure 3 B in the figure). In other words, after the gene mutation, the protein coding does not stop immediately, but needs to encode a polypeptide incorrectly before it stops. In short, these mutations all cause the activity and function of the OsSRR1 protein to be lost to varying degrees. At the same time, the expression level of the OsSRR1 gene in the mutant was detected ( Figure 4 In summary, the above experimental results indicate that the OsSRR1 gene knockout rice line was successfully constructed and can be used for subsequent phenotypic observations and determination of physiological indicators (including virus content).
[0103] Depend on Figure 5 Under normal growth conditions, the leaves of OsSRR1-ko-#1 and OsSRR1-ko-#2 showed varying degrees of curling compared to the control (ZH11), with OsSRR1-ko-#2 exhibiting more severe curling. Severe leaf curling can negatively impact rice growth and yield in multiple ways, including a significant decrease in photosynthetic efficiency, leading to insufficient energy and biomass production, and hindering plant growth and development at all stages (vegetative and reproductive), ultimately resulting in reduced yield and decreased rice quality. In addition, compared with the control (ZH11) and OsSRR1-ko-#1, the plant height of OsSRR1-ko-#2 was slightly lower, and the number of tillers was significantly more. The plant type was not compact enough (i.e., the plants were loose and the tillering angles were too large). These characteristics would lead to poor ventilation and light transmittance in the population, intensified competition for light; intensive planting was impossible, reducing the planting amount within a certain area; increased ineffective tillers, serious nutrient waste; individual development was poor, and the quality of the ears was poor; and an increased risk of lodging.
[0104] In terms of disease resistance, both OsSRR1-ko-#1 and OsSRR1-ko-#2 lines showed excellent resistance to rice stripe disease compared to the control, as shown in the following: First, the OsSRR1 knockout lines had taller plants, smaller lesions on the leaves, and greener leaves, especially OsSRR1-ko-#1; Second, the virus content in the leaves of the OsSRR1 knockout lines was significantly lower ( Figure 6 and Figure 7 ).
[0105] Both OsSRR1-ko-#1 and OsSRR1-ko-#2 lines exhibit resistance to rice stripe disease, further validating the disease resistance function of the OsSRR1 gene and providing a new target for rice stripe disease control. Furthermore, the two lines exhibited certain differences in their disease resistance and phenotypes under normal growth conditions, likely due to differences in the pattern of mutations in the OsSRR1 gene / protein. Specifically, although the protein in the OsSRR1-ko-#1 line terminates prematurely at amino acid position 46, mutations occur after amino acid position 12, while the protein in the OsSRR1-ko-#2 line mutates after amino acid position 11. In other words, the OsSRR1-ko-#1 protein contains an additional amino acid (P) that matches the wild-type OsSRR1 protein. Notably, the amino acid in question is proline. Due to its unique cyclic side chain structure (pyrrolidine ring), proline plays unique and critical roles in protein structure, such as constraining conformation, increasing local rigidity and stability, disrupting or terminating α-helices, promoting and stabilizing β-turns (particularly at position i+1), enhancing overall (thermal) stability by reducing the entropy of the unfolded state, and forming peptide bonds that are susceptible to cis-trans isomerization, affecting folding dynamics and the structure of specific functional sites. Therefore, the proline at position 12 may be crucial for maintaining the conformation of the OsSRR1 protein or for its function (such as binding to RNA and subsequently regulating leaf shape, plant architecture, tillering, and plant height), contributing to the phenotypic differences between the two OsSRR1-ko knockout lines. Even though OsSRR1-ko-#1 plants fail to produce the complete OsSRR1 protein, the resulting OsSRR1 mutant protein still retains its function in regulating plant growth and development, maximizing disease resistance without affecting normal plant growth.
[0106] In summary, compared with OsSRR1-ko-#2, the phenotype of the OsSRR1-ko-#1 line under normal growth conditions (including plant height, leaves, plant type, and tiller number) is closer to that of the wild type, which provides a certain guarantee for the yield of the OsSRR1-ko-#1 line. In other words, the application prospect of the OsSRR1-ko-#1 line is greater than that of the OsSRR1-ko-#2 line, so the OsSRR1-ko-#1 line and its corresponding mutation are preferred. On the other hand, it also shows that the OsSRR1 gene is not only involved in plant resistance to rice stripe disease but also regulates the normal growth and development of plants. In other words, when the OsSRR1 gene is used as a target gene for the prevention and control of rice stripe disease, the OsSRR1 protein needs to lose a certain function to improve the plant's disease resistance. At the same time, the OsSRR1 protein needs to retain a certain activity to reduce its impact on plant growth and development, so as to ensure both disease resistance and yield.
[0107] In addition, the present invention also constructed knockout strains of the LOC_Os01g06290, LOC_Os03g17710, and LOC_Os04g02870 genes, but these strains did not show obvious disease resistance (i.e., after infection with RSV, their traits were consistent with the wild type), and some strains even showed susceptible traits. Therefore, the OsSRR1 gene is preferred as a target for controlling rice stripe disease.
[0108] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and that the present invention can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is limited by the appended claims rather than the above description, and it is intended that all changes that fall within the meaning and scope of the equivalent elements of the claims are included in the content of the present invention.
Claims
1. Use of the SRR1 gene / protein as a target for preventing and treating plant diseases caused by tenuivirus, characterized in that: The SRR1 gene has the nucleotide sequence shown in SEQ ID NO: 1; the SRR1 protein has the amino acid residue sequence shown in SEQ ID NO:
2.
2. The use according to claim 1, characterized in that The plant is a grass plant.
3. An SRR1 gene mutant, characterized in that: The gene mutant lacks any one or more of the 33rd to 37th bases in the sequence shown in SEQ ID NO:
1.
4. The gene mutant according to claim 3, wherein The gene mutant contains the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO:
7.
5. A SRR1 protein mutant, characterized in that: The protein mutant refers to an SRR1 protein that is terminated prematurely, and the sequence of the SRR1 protein has the amino acid residue sequence shown in SEQ ID NO: 2; the number of amino acid residues constituting the SRR1 protein mutant is less than 50.
6. The protein mutant according to claim 5, characterized in that The protein mutant terminates prematurely at the 45th or 46th amino acid position of the SRR1 protein.
7. The protein mutant according to claim 5, characterized in that The protein mutant contains the amino acid residue sequence shown in SEQ ID NO: 4 or SEQ ID NO:
5.
8. Use of an SRR1 gene mutant or protein mutant in the preparation of an anti-plant disease agent, characterized in that: The gene mutant is as described in any one of claims 3 to 4, and the protein mutant is as described in any one of claims 5 to 7.
9. A biological material comprising the SRR1 gene according to claim 1, the SRR1 gene mutant according to claims 3 to 4, or the SRR1 protein mutant according to any one of claims 5 to 7, characterized in that: The biological material is any one or more of a vector, a host cell, a transformed plant cell, and a plant.
10. Use of a biological material containing the SRR1 gene according to claim 1, or the SRR1 gene mutant according to claims 3 to 4, or the SRR1 protein mutant according to any one of claims 5 to 7 in rice disease resistance breeding.
Citation Information
Patent Citations
Application of OsSCL30 gene in regulation and control of plant height or heading period of rice
CN117904343A
Application of rice receptor-like protein OsBIR1 in resisting rice stripe virus
CN120099023A