IL2 promoter-based reporter gene cell line and construction and application thereof
By constructing a reporter gene cell line based on the IL2 promoter, the problems of existing T cell activation detection methods such as reliance on donor primary cells and insufficient reagent standardization were solved, achieving efficient and rapid T cell activation detection and drug screening.
Patent Information
- Application Number
- CN202511060511.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-30
- Publication Date
- 2025-10-10
AI Technical Summary
Existing T cell activation detection methods rely on donor primary cells, have complex operating procedures and insufficient reagent standardization, resulting in high variability in results and making it difficult to meet the quality control requirements of drug development.
A reporter gene cell line based on the IL2 promoter was constructed. Multiple copies of NFAT, AP-1, and NF-κB nuclear protein binding site genes were inserted upstream of the modified miniaml IL2 promoter, and a luciferase reporter gene was connected downstream. Jurkat cells were infected using lentiviral packaging to establish an efficient detection method.
It achieves efficient and rapid detection of T cell activation, can screen drugs targeting T cell pathway activation, and prepare models for monitoring IL2 promoter activation and/or inhibition, thereby improving the standardization and accuracy of detection.
Smart Images
Figure CN120758571A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to an IL2 promoter-based reporter gene cell line and the construction and application thereof. Background Art
[0002] T cells play a central role in cell-mediated immunity, mediating long-term, antigen-specific effector and memory responses. In recent years, immunotherapies targeting the induction, enhancement, and engineering of T cell responses have become cutting-edge approaches in the treatment of diseases such as cancer and autoimmune diseases. The activation mechanism of T cells involves multi-level signal integration: first, the specific binding of the T cell antigen receptor (TCR) / CD3 complex to the antigen peptide-MHC complex (pMHC) triggers the first signal, which determines the specificity of the immune response; second, the interaction of co-stimulatory molecules (such as CD28 and the B7 family) provides a second signal, enhancing the strength of the TCR signal and promoting IL-2 secretion; third, cytokines (such as IL-2 and IL-12) activate downstream pathways through receptor binding, generating a third signal that drives T cell proliferation and functional differentiation.
[0003] When the T cell antigen receptor (TCR) / CD3 complex binds to the costimulatory receptor CD28, simultaneous engagement of these cell surface receptors triggers intracellular signaling events and activates nuclear transcription factors such as nuclear factor of activated T cells (NFAT), NF-κB, and AP-1. Binding of the TCR / CD3 complex leads to phosphorylation and activation of PLC-γ, intracellular calcium ion flux, and transcriptional activation of the NFAT pathway. In contrast, cooperative binding of TCR / CD3 with the costimulatory receptor CD28 activates ERK / JNK and IκB kinase (IKK), which in turn regulate transcriptional activation of the AP-1 and NF-κB pathways, respectively. The IL-2 promoter contains DNA binding sites for NFAT, NF-κB, and AP-1. Consequently, coactivation of TCR / CD3 and CD28 leads to the production of interleukin-2 (IL-2), which is often used as a functional indicator of T cell activation.
[0004] Currently, T cell activation detection methods rely on peripheral blood mononuclear cells (PBMCs) as the source of T cells. These cells must be co-cultured with antigen presenting cells (APCs) or stimulated with anti-TCR / CD3 antibodies. These methods have problems such as dependence on donor primary cells, complex operating procedures, and insufficient reagent standardization, resulting in high variability in results and difficulty meeting the quality control requirements of drug development. Summary of the Invention
[0005] The present invention aims to provide an IL2 promoter-based reporter gene cell line and its construction and application. This approach aims to address existing T cell activation detection methods, which suffer from reliance on donor primary cells, complex procedures, and insufficient reagent standardization, resulting in high variability in results and difficulty meeting quality control requirements for drug development.
[0006] In a first aspect, the present invention provides a method for constructing a reporter gene cell line based on an IL2 promoter, comprising the following steps: S1, sequentially connecting multiple copies of the NFAT gene, multiple copies of the AP-1 gene, multiple copies of the NF-κB gene, the Minimal IL-2 promoter gene, the luciferase gene, and the Fast gene to obtain a connection fragment; S2, connecting the connection fragment with a lentiviral vector to obtain a recombinant lentiviral vector; S3, packaging the recombinant lentiviral vector and concentrating it to obtain a lentiviral venom; S4, adding the lentiviral venom and polybrene to Jurkat cells for infection, and obtaining an IL2 promoter-based reporter gene cell line after drug screening and monoclonal amplification.
[0007] In the present invention, the inventors have discovered that by inserting multiple copies of NFAT, AP-1, and NF-κB nuclear protein binding site genes upstream of the modified miniaml IL2 promoter, connecting a modified luciferase reporter gene downstream, and transfecting it into Jurkat cells, an IL2 promoter-based reporter gene cell line is obtained. Further, by detecting the expression level of the luciferase reporter gene in the IL2 promoter-based reporter gene cell line, T cell activation can be efficiently and rapidly detected; in addition, the IL2 promoter-based reporter gene cell line can be used to screen drugs targeting T cell pathway activation, or to prepare a model for monitoring IL2 promoter activation and / or inhibition.
[0008] In some embodiments, in step S1, the multi-copy NFAT gene, the multi-copy AP-1 gene, and the multi-copy NF-κB gene are all five copies, and their nucleotide sequences are shown as SEQ ID NOs: 1-3, respectively.
[0009] In some embodiments, in step S1, the nucleotide sequences of the Minimal IL-2 promoter gene, the luciferase gene, and the Fast gene are shown as SEQ ID NOs: 4-6, respectively.
[0010] In some embodiments, in step S2, the lentiviral vector comprises a pCDH-Puro vector.
[0011] In some embodiments, in step S3, packaging specifically includes: mixing the recombinant lentiviral vector with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G to obtain a mixed plasmid; adding PEI40K transfection agent to the mixed plasmid, mixing evenly, adding to HEK293T cells, and culturing to obtain a cell culture fluid; concentration specifically includes: centrifuging at 3000-5000g for 25-35 minutes, and redissolving the obtained virus particles.
[0012] In some embodiments, the mass ratio of the recombinant lentiviral vector, packaging plasmid psPAX2, and envelope plasmid pMD2.G is (13-17): (8-12): (3-7), the mass ratio of the mixed plasmid and PEI40K transfection agent is (24-36): (85-95), and the confluency of HEK293T cells is 80-90%.
[0013] In some embodiments, in step S4, the final concentration of polybrene added is 5-7 μg / mL, and the concentration of Jurkat cells is 0.5-1×10 6 pieces / mL.
[0014] In some embodiments, in step S4, drug screening specifically includes: adding puromycin at a concentration of 0.5-1.5 μg / mL for drug screening to obtain a reporter gene pool cell line based on the IL2 promoter.
[0015] In a second aspect, the present invention provides a reporter gene cell line based on an IL2 promoter, which is constructed by any of the above-mentioned construction methods.
[0016] In a third aspect, the present invention provides the use of the above-mentioned IL2 promoter-based reporter gene cell line in any of the following: 1) T cell activation detection; 2) screening of drugs targeting T cell pathway activation; 3) preparation of a model for monitoring IL2 promoter activation and / or inhibition.
[0017] The beneficial effects of the present invention are as follows: different from the prior art, the present invention inserts multiple copies of NFAT, AP-1 and NF-κB nuclear protein binding site genes upstream of the modified miniaml IL2 promoter, connects a modified luciferase reporter gene downstream thereof, and transfects into Jurkat cells to obtain an IL2 promoter-based reporter gene cell line, and further detects the expression level of the luciferase reporter gene in the IL2 promoter-based reporter gene cell line, thereby efficiently and rapidly detecting the activation of T cells; in addition, the IL2 promoter-based reporter gene cell line can be used to screen drugs targeting T cell pathway activation, or to prepare a model for monitoring IL2 promoter activation and / or inhibition, and therefore has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 This is a map of the recombinant lentiviral vector pCDH-miniIL2-LuciferaseFAST constructed in Example 1 of the present invention; Figure 2 This is the fluorescence detection result of the IL2 promoter-based reporter gene pool cell line constructed in Example 2 of the present invention; Figure 3 This is the fluorescence detection result of the IL2 promoter-based reporter gene cell line constructed in Example 2 of the present invention. DETAILED DESCRIPTION
[0019] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0020] Experimental procedures in the examples, where specific conditions are not specified, were generally performed in accordance with conventional methods in molecular biology, including but not limited to those described in M.R. Green's Molecular Cloning: A Laboratory Manual and Robert F. Weaver's Molecular Biology, or according to the recommendations of kit and instrument manufacturers. Unless otherwise specified, reagents and biological materials used in the examples were commercially available.
[0021] Currently, existing T cell activation detection methods have problems such as dependence on donor primary cells, complex operating procedures and insufficient reagent standardization, which lead to high variability in results and make it difficult to meet the quality control requirements of drug development.
[0022] To address the problems of existing T cell activation detection methods, such as reliance on donor primary cells, complex operational procedures, and insufficient reagent standardization, which lead to high variability in results and difficulty in meeting quality control requirements for drug development, the present invention provides an IL2 promoter-based reporter gene cell line and its construction and application.
[0023] In a first aspect, the present invention provides a method for constructing a reporter gene cell line based on an IL2 promoter, comprising the following steps: S1, sequentially connecting multiple copies of the NFAT gene, multiple copies of the AP-1 gene, multiple copies of the NF-κB gene, the Minimal IL-2 promoter gene, the luciferase gene, and the Fast gene to obtain a connection fragment; S2, connecting the connection fragment with a lentiviral vector to obtain a recombinant lentiviral vector; S3, packaging the recombinant lentiviral vector and concentrating it to obtain a lentiviral venom; S4, adding the lentiviral venom and polybrene to Jurkat cells for infection, and obtaining an IL2 promoter-based reporter gene cell line after drug screening and monoclonal amplification.
[0024] In the construction method provided by the present invention, multiple copies of NFAT, AP-1, and NF-κB nuclear protein binding site genes are inserted upstream of the modified miniaml IL2 promoter, a modified luciferase reporter gene is connected downstream thereof, and Jurkat cells are infected by lentiviral packaging to obtain an IL2 promoter-based reporter gene cell line. The expression level of the luciferase reporter gene in the IL2 promoter-based reporter gene cell line is further detected, thereby efficiently and rapidly detecting T cell activation. In addition, the IL2 promoter-based reporter gene cell line can be used to screen drugs targeting T cell pathway activation, or to prepare a model for monitoring IL2 promoter activation and / or inhibition.
[0025] In some embodiments, in step S1, the multi-copy NFAT gene, the multi-copy AP-1 gene, and the multi-copy NF-κB gene are all five copies, and their nucleotide sequences are shown as SEQ ID NOs: 1-3, respectively.
[0026] In the present invention, by selecting specific nucleoprotein binding site genes and increasing the copy number of the above genes, the expression of the above genes can be enhanced, the activity of the binding sites can be increased, and rapid and specific screening of substances that activate and / or inhibit the IL2 promoter can be facilitated.
[0027] In some embodiments, in step S1, the nucleotide sequences of the Minimal IL-2 promoter gene, the luciferase gene, and the Fast gene are shown as SEQ ID NOs: 4-6, respectively.
[0028] In the present invention, by connecting the Fast gene to the C-terminus of the luciferase gene, when the Minimal IL-2 promoter initiates expression, the protein expressed by the modified luciferase gene reacts faster and the relative amplitude of the reaction increases, making it more suitable for monitoring rapid transcriptional events such as NFAT, AP-1, and NF-κB, such as promoter activation and inhibition, and can effectively avoid interference from endogenous regulatory factors (such as Egr-1 and SP1).
[0029] In some embodiments, in step S2, the lentiviral vector comprises a pCDH-Puro vector.
[0030] It can be understood that the lentiviral vector can be routinely selected according to actual needs, as long as the virus particles can be efficiently packaged. For example, in the present application, the lentiviral vector preferably comprises a pCDH-Puro vector.
[0031] In some embodiments, in step S3, the packaging specifically comprises: mixing the recombinant lentiviral vector with a packaging plasmid psPAX2 and an envelope plasmid pMD2.G to obtain a mixed plasmid; adding PEI40K transfection agent to the mixed plasmid, and after uniform mixing, adding to HEK293T cells, and after cultivation, obtaining a cell culture solution; the concentration specifically comprises: centrifuging at 3000-5000g (preferably 4000g) for 25-35min, preferably 30min, and resuspending the obtained virus particles.
[0032] In the present application, by using the helper plasmid, the recombinant lentiviral vector can be rapidly and efficiently packaged to obtain virus particles.
[0033] In some embodiments, the mass ratio of the recombinant lentiviral vector, the packaging plasmid psPAX2 and the envelope plasmid pMD2.G is (13-17):(8-12):(3-7), preferably 15:10:5; the mass ratio of the mixed plasmid and the PEI40K transfection agent is (24-36):(85-95), preferably 30:90; and the fusion degree of the HEK293T cells is 80-90%.
[0034] In the present application, by controlling the mass ratio of the recombinant lentiviral vector, the packaging plasmid psPAX2, the envelope plasmid pMD2.G and the PEI40K transfection agent within a specific range, the yield of virus particles can be further improved.
[0035] In some embodiments, in step S4, the final concentration of the added polybrene is 5-7μg / mL, preferably 6μg / mL; and the concentration of the Jurkat cells is 0.5-1×10 6 6 / mL, preferably 0.8×10 6 6 / mL.
[0036] It can be understood that the final concentration of the added polybrene and the concentration of the Jurkat cells can be routinely adjusted according to actual needs, as long as the positive cells can be efficiently infected.
[0037] In some embodiments, in step S4, drug screening specifically includes: adding puromycin at a concentration of 0.5-1.5 μg / mL for drug screening to obtain a reporter gene pool cell line based on the IL2 promoter.
[0038] In the present invention, by adding a specific concentration of puromycin for drug screening, a reporter gene pool cell line based on the IL2 promoter can be quickly and efficiently screened.
[0039] In a second aspect, the present invention provides a reporter gene cell line based on an IL2 promoter, which is constructed by any of the above-mentioned construction methods.
[0040] The IL2 promoter-based reporter gene cell line provided by the present invention can efficiently and rapidly detect T cell activation and can be used to screen drugs targeting T cell pathway activation or to prepare a model for monitoring IL2 promoter activation and / or inhibition.
[0041] In a third aspect, the present invention provides the use of the above-mentioned IL2 promoter-based reporter gene cell line in any of the following: 1) T cell activation detection; 2) screening of drugs targeting T cell pathway activation; 3) preparation of a model for monitoring IL2 promoter activation and / or inhibition.
[0042] Some specific embodiments are listed below. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.
[0043] Example 1 This example provides a method for constructing a reporter gene cell line based on the IL2 promoter.
[0044] Specifically, the steps include: S1. Five copies of the NFAT gene (NFAT 5x), five copies of the AP-1 gene (AP-1 5x), five copies of the NF-κB gene (NF-κB 5x), the Minimal IL-2 promoter gene, the luciferase gene, and the Fast gene were sequentially ligated to obtain a ligated fragment. This ligated fragment was then submitted to Wuhan GenScript Biotech Co., Ltd. for synthesis.
[0045] The nucleotide sequence of the NFAT 5x gene is shown below: TGGAAAGATTGGAAAGACTGGAAAGATAGGAAACACTGGAAAGA(SEQ ID NO: 1); The nucleotide sequence of the AP-1 5x gene is shown below: TGAGTCACTGACTCAGTGAGTCACTGACTCAGTGAGTAA (SEQ ID NO: 2); The nucleotide sequence of the NF-κΒ 5x gene is as follows: TGGGGACTTTCCACTGGGGACTTTCCACTGGGGACTTTCCACTGGGGACTTTCCACTGGGGACTTTCCACT (SEQ ID NO: 3); The nucleotide sequence of the minimal IL-2 promoter gene is as follows: CATTTTGACACCCCCATAATATTTTTCCAGAATTAACAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGC (SEQ ID NO: 4); The nucleotide sequence of the luciferase gene is as follows: The nucleotide sequence of the Fast gene is shown below: AACCCTGATTTCCCCCAAGAGGTGGAAGAACAGGACGCCAGCACCCTGCCTGTGTCCTGCGCCTGGGAGAGCGGCATGAAGCGGCACAGAGCCGCTTGTGCCAGCGCCTCTATCAACGTG (SEQ ID NO: 6).
[0046] S2. Linearize the lentiviral vector pCDH-Puro using SnaBI and EcoRI. Simultaneously, digest the ligated fragment synthesized in step S1 with SnaBI and EcoRI and ligate it into the linearized pCDH-Puro vector. Transform E. coli DH5α and select a single plaque for sequencing at Wuhan GenScript Biotech Co., Ltd. The nucleotide sequences of sequencing primers F and R are as follows: Primer F: 5′-TTCCTACTTGGCAGTACATCTACGTA-3′ (SEQ ID NO: 7); Primer R: 5′-CGGATCCATTTAAATTCGAATTC-3′ (SEQ ID NO: 8); The sequencing results showed that the inserted gene sequence was identical to the synthesized sequence, and the recombinant lentiviral vector was successfully constructed. The recombinant lentiviral vector was named pCDH-miniIL2-LuciferaseFAST, and its map is shown below. Figure 1 shown.
[0047] S3. One day before transfection, use HEK293T cells (80-90% confluency) in the exponential growth phase with a viability greater than 98% to plate a 10 cm dish. On the day of transfection, take 15 μg of transfer plasmid pCDH-miniIL2-LuciferaseFAST, 10 μg of packaging plasmid psPAX2, and 5 μg of envelope plasmid pMD2.G, mix them, and then add 90 μg of PEI40K transfection reagent. After the plasmid and transfection reagent form a complex, add it to the above HEK293T cells. Place the cells in a 37°C, 5% CO2 incubator and culture for 3 days. After 3 days, collect the cell culture medium, then centrifuge at 4000g for 30 minutes, and re-dissolve the resulting viral particles in 3 mL of DMEM buffer to obtain lentiviral venom.
[0048] S4. On the day of infection, Jurkat cells (0.8×10 6The Jurkat cells are placed in a 12-well plate, 1 mL of the above-mentioned lentivirus and 6 μg / mL of polybrene are added to the 12 wells, the plate is mixed and covered with plastic wrap, and then centrifuged in a centrifuge at 25°C, 1200g, 1h; after centrifugation, the cells are gently resuspended, and then placed in a 37°C, 5% CO2 incubator for continuous infection; the next morning, the virus is removed by centrifugation at 800 rpm for 5 min, and then the cells are placed in a 37°C, 5% CO2 incubator for 2 days of culture; after 2 days, 1 μg / mL of puromycin is added to the above-mentioned Jurkat cells for drug screening, and after the cells recover, Pool fluorescence detection is performed, as follows: First, prepare the reagent: prepare the solution according to the instructions in the ONE-Glo™ Luciferase Assay kit (Promega, E6110).
[0049] Among them, Ionomycin calcium ion carrier (Beyotime, S1672-250nmol), the mother liquor concentration is 5mM Ionomycin, that is, 3735.35 μg / ml, take 2 μl Ionomycin mother liquor, add 1492 μl culture medium 1640, to get 5 μg / ml Ionomycin solution.
[0050] Induction solution: dissolve PMA in DMSO, the mother liquor concentration is 1 mg / ml, dilute the PMA mother liquor 4 times with 5 μg / ml ionomycin solution, the initial concentration is 10 μg / ml, and continuously dilute 12 points to obtain the induction solution.
[0051] Control solution: dilute DMSO 100 times with 1640 culture medium.
[0052] Then perform fluorescence detection, as follows: 1) On the day of detection, collect the Jurkat Pool cell strain in the logarithmic growth phase, centrifuge the cells, count the cells, and take 3×10 4 cells to a 96-well plate, each well has a volume of 90 μl; 2) Add 10 μl of the induction solution and the control solution to each well of the 96-well plate, respectively, so that the total volume of each well is 100 μl, that is, the final concentration is diluted by about 10 times, and then place the plate in the incubator for 6h; 3) Take the prepared Luciferase Assay detection reagent and place it in the dark at room temperature to allow the temperature to equilibrate; 4) Take the cell culture plate and place it at room temperature to allow the temperature to equilibrate; 5) Add 100 μl of Luciferase reagent to the 96-well plate, mix well by blowing, and then wait for 3 minutes; 6) After waiting for 3 minutes, take 170 μl of the sample to be tested and add it to the chemiluminescent plate (96-well chemiluminescent plate, Nunc, 463201). Place the luminescent plate in a fluorescence instrument for detection.
[0053] The results are as follows Figure 2 shown.
[0054] from Figure 2 It can be seen that the addition of ionomycin and PMA activated the activity of the IL2 promoter in Jurkat Pool cells, thereby promoting the expression of the luciferase gene. The results showed that the reporter gene based on the IL2 promoter has been successfully transfected into Jurkat cells, and as the T cell activation increases (PMA concentration increases), the expression of the luciferase gene increases.
[0055] The cells of the IL2 promoter-based reporter gene pool cell line obtained above were counted and monoclonal clones were inoculated. During the monoclonal process, the growth status of the clones was observed and the medium was changed in time. During the monoclonal process, drug maintenance (1 μg / mL puromycin) was always used to obtain the IL2 promoter-based reporter gene cell line.
[0056] Example 2 In this example, the IL2 promoter-based reporter gene cell line prepared in Example 1 was subjected to fluorescence detection to verify the function of the IL2 promoter-based reporter gene stably transfected cell line. The specific method of fluorescence detection was referred to the method in Example 1. The fluorescence detection results are shown in FIG. Figure 3 shown.
[0057] from Figure 3 As can be seen in the figure, the IL2 promoter-based reporter gene stably transfected cell line activates the IL2 promoter under stimulation with ionomycin and PMA, thereby promoting luciferase gene expression. Furthermore, as T cell activation increases (increasing PMA concentration), luciferase gene expression increases. Therefore, by measuring the expression of the luciferase gene, the degree of T cell activation can be efficiently and rapidly detected. In addition, this IL2 promoter-based reporter gene cell line can be used to screen drugs that target T cell pathway activation or to develop models for monitoring IL2 promoter activation and / or inhibition.
[0058] It should be noted that the above embodiments all belong to the same inventive concept, and the description of each embodiment has its own focus. For any details not described in individual embodiments, reference may be made to the description in other embodiments.
[0059] The above-described embodiments merely illustrate the implementation methods of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make various modifications and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. A method for constructing a reporter gene cell line based on IL2 promoter, characterized in that: The steps include: S1, connecting multiple copies of NFAT gene, multiple copies of AP-1 gene, multiple copies of NF-κB gene, Minimal IL-2 promoter gene, luciferase gene and Fast gene in sequence to obtain a connection fragment; S2, connecting the connecting fragment to the lentiviral vector to obtain a recombinant lentiviral vector; S3. Packaging the recombinant lentiviral vector and concentrating it to obtain lentiviral venom; S4. Adding the lentiviral venom and polybrene to Jurkat cells for infection, and obtaining a reporter gene cell line based on the IL2 promoter after drug screening and monoclonal amplification.
2. The method for constructing a reporter gene cell line based on the IL2 promoter according to claim 1, characterized in that: In step S1, the multi-copy NFAT gene, the multi-copy AP-1 gene, and the multi-copy NF-κB gene are all five copies, and their nucleotide sequences are shown as SEQ ID NOs: 1-3, respectively.
3. The method for constructing a reporter gene cell line based on the IL2 promoter according to claim 1, characterized in that: In step S1, the nucleotide sequences of the Minimal IL-2 promoter gene, the luciferase gene, and the Fast gene are shown in SEQ ID NOs: 4-6, respectively.
4. The method for constructing a reporter gene cell line based on the IL2 promoter according to claim 1, characterized in that: In step S2, the lentiviral vector includes a pCDH-Puro vector.
5. The method for constructing a reporter gene cell line based on the IL2 promoter according to claim 1, characterized in that: In step S3, the packaging specifically includes: mixing the recombinant lentiviral vector with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G to obtain a mixed plasmid; adding PEI40K transfection agent to the mixed plasmid, mixing evenly, adding to HEK293T cells, and culturing to obtain a cell culture fluid; The concentration specifically includes: centrifuging at 3000-5000 g for 25-35 minutes, and redissolving the obtained virus particles.
6. The method for constructing a reporter gene cell line based on the IL2 promoter according to claim 5, characterized in that: The mass ratio of the recombinant lentiviral vector, the packaging plasmid psPAX2, and the envelope plasmid pMD2.G is (13-17): (8-12): (3-7), the mass ratio of the mixed plasmid and the PEI40K transfection agent is (24-36): (85-95), and the confluency of the HEK293T cells is 80-90%.
7. The method for constructing a reporter gene cell line based on the IL2 promoter according to claim 1, characterized in that: In step S4, the final concentration of polybrene added is 5-7 μg / mL, and the concentration of Jurkat cells is 0.5-1×10 6 pieces / mL.
8. The method for constructing a reporter gene cell line based on the IL2 promoter according to claim 1, characterized in that: In step S4, the drug screening specifically includes: adding puromycin at a concentration of 0.5-1.5 μg / mL for drug screening to obtain a reporter gene pool cell line based on the IL2 promoter.
9. A reporter gene cell line based on IL2 promoter, characterized in that The method is constructed according to any one of claims 1 to 8.
10. Use of the IL2 promoter-based reporter gene cell line according to claim 9 in any of the following: 1) T cell activation assay; 2) Screening for drugs that target T cell pathway activation; 3) Prepare a model to monitor IL2 promoter activation and / or repression.