Acute myelogenous leukemia auxiliary diagnosis, prognosis diagnosis or risk stratification circRNA marker and application thereof

Abstract

The invention belongs to the technical field of biology, and relates to a circRNA marker for auxiliary diagnosis, prognosis diagnosis or risk stratification of acute myelogenous leukemia and application of the circRNA marker. The invention finds that the expression level of the circular RNA hsacirc0002782 is obviously increased compared with that of a normal bone marrow specimen, which indicates that the circular RNA hsacirc0002782 has huge potential as an AML biomarker, thereby providing a new and possibly more accurate method for early detection of AML, and being beneficial to timely intervention and treatment. By developing a gene detection product based on circular RNA hsacirc0002782, early diagnosis of AML at the molecular level is realized, and a high-precision diagnosis tool can help a doctor to identify a patient with potential risk at the initial stage of a disease, so that a more effective personalized medical scheme is provided.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and relates to a circRNA marker for auxiliary diagnosis, prognosis diagnosis or risk stratification of acute myeloid leukemia and application thereof. BACKGROUND

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous hematopoietic malignancy characterized by differentiation arrest and clonal proliferation of hematopoietic stem cells and progenitor cells. Chromosome karyotype analysis is often used to evaluate the prognosis of AML patients. With the improvement of molecular biology technology, gene mutations and rearrangements have been widely used in clinical practice. Some molecular mutations such as NPM1, FLT3-ITD, CEBPA, c-KIT have been included in the NCCN and ELN guidelines as markers for risk stratification and prognosis evaluation system of AML. With the continuous improvement of medical level, due to the discovery of arsenic trioxide and all-trans retinoic acid, most acute promyelocytic leukemia (APL) patients can be completely cured through the combination therapy of the two drugs.

[0003] Despite the significant progress in prognostic risk stratification, supportive therapy, multiple chemotherapy drug intensification therapy, autologous or allogeneic hematopoietic stem cell transplantation (auto / allo-HSCT), etc., due to the characteristics of AML recurrence and refractoriness, the prognosis of adult non-AML-M3 patients is still not optimistic. In recent years, the advent of multi-kinase targeting inhibitors for gene mutations has brought people hope, but long-term follow-up data is lacking, therefore, it is urgent to explore the mechanism of AML molecular pathogenesis, find new therapeutic targets and discover potential markers for AML stratification. SUMMARY

[0004] The purpose of the present application is to solve the above-mentioned problems existing in the prior art, and to provide a circRNA marker for auxiliary diagnosis, prognosis diagnosis or risk stratification of acute myeloid leukemia, so as to make the prognosis diagnosis of AML more accurate and rapid.

[0005] The purpose of the present application can be achieved by the following technical solutions: A circRNA marker for auxiliary diagnosis, prognosis diagnosis or risk stratification of acute myeloid leukemia, wherein the circRNA marker is RNA hsa_circ_0002782 as shown in SEQ ID NO. 1.

[0006] The present application also provides an application of a detection reagent for the expression level of RNA hsa_circ_0002782 in the preparation of a product for auxiliary diagnosis, prognosis diagnosis or risk stratification of acute myeloid leukemia.

[0007] In the above application, the detection reagent for the expression level of RNA hsa_circ_0002782 includes a primer that specifically recognizes RNA hsa_circ_0002782.

[0008] In the above application, the primers that specifically recognize RNA hsa_circ_0002782 include the upstream primer shown in SEQ ID NO. 2 and the downstream primer shown in SEQ ID NO. 3.

[0009] The present invention also provides a product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, including primers that specifically recognize RNA hsa_circ_0002782.

[0010] In the above-mentioned product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, the primers that specifically recognize RNA hsa_circ_0003141 include the upstream primer shown in SEQ ID NO. 2 and the downstream primer shown in SEQ ID NO. 3.

[0011] The above-mentioned product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia also includes primers that specifically recognize the internal reference GAPDH.

[0012] In the above-mentioned product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, the primers specifically identifying the internal reference GAPDH include the upstream primer shown in SEQ ID NO.4 and the downstream primer shown in SEQ ID NO.5.

[0013] In the above-mentioned product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, it is a kit or a gene chip.

[0014] The above-mentioned product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia also includes pharmaceutically acceptable excipients.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1. This study systematically discovered and validated for the first time that the expression level of the circular RNA hsa_circ_0002782 in bone marrow samples from patients with acute myeloid leukemia (AML) is significantly higher than that in normal controls. High-throughput sequencing, qRT-PCR validation, and multicenter clinical sample analysis confirmed that this circular RNA is highly specifically and consistently upregulated in AML patients. The difference in expression was statistically significant and unaffected by fluctuations in common reference genes. Compared to traditional diagnostic methods that rely on morphology and immunophenotyping, molecular marker-based detection methods offer higher sensitivity and specificity. Abnormal expression of hsa_circ_0002782 can be detected particularly early in the disease, before clinical symptoms fully manifest. This provides a novel approach for non-invasive or minimally invasive early screening for AML, helping to achieve the clinical goal of "early detection and early intervention" and significantly improving overall patient survival.

[0017] 2. This invention further developed a highly sensitive genetic test for hsa_circ_0002782, which enables early molecular diagnosis of AML in blood or bone marrow samples. This test is particularly suitable for regular screening of high-risk populations, such as patients with MDS transformation and those at risk of secondary leukemia after chemotherapy and radiotherapy. This test is simple to use, cost-effective, and has promising clinical translational potential, potentially becoming a supplemental or pre-screening tool in the AML diagnostic process.

[0018] 3. This study uses circular RNA hsa_circ_0002782 as a biomarker for regular monitoring, which not only helps assess disease progression and treatment response but also can be used to tailor individualized treatment plans. This approach improves the efficiency of disease management, enables more rational allocation of medical resources, and reduces the cost of long-term treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the first-generation sequencing result of the product after RT-PCR using hsa_circ_0002782 in Example 1.

[0020] Figure 2 This is the amplification efficiency of the internal reference GAPDH gene and the target hsa_circ_0002782 gene established based on the AML2 cell line in Example 1.

[0021] Figure 3 This is an illustration of Example 2 showing that quantitative RT-PCR detection revealed upregulated expression of hsa_circ_0002782 in newly diagnosed AML patients and its diagnostic value.

[0022] Figure 4The relationship between hsa_circ_0002782 expression and overall survival and event-free survival in acute myeloid leukemia in Example 2; where a is overall survival; b is event-free survival.

[0023] Figure 5 These are the cell proliferation results after knockdown of hsa_circ_0002782 in acute myeloid leukemia cell lines AML2 and NB4 using the small interfering virus in Example 3; a represents AML2; b represents NB4.

[0024] Figure 6 This is the result of cell apoptosis after knockdown of hsa_circ_0002782 in the acute myeloid leukemia cell line AML2 using small interfering virus in Example 3.

[0025] Figure 7 This is the result of cell apoptosis after knockdown of hsa_circ_0002782 in acute myeloid leukemia cell line NB4 using small interfering virus in Example 3.

[0026] Figure 8 The AML circRNA chip screening in Example 4; A is a hierarchical clustering diagram showing the circRNA expression differences among the AML group, ALL group, and normal control group; B is a scatter plot showing the circRNA expression differences between the normal control and AML group (the two green lines indicate expression differences ≥ 2-fold); C is a volcano plot showing the circRNA expression differences between the AML group and the normal control group (red dots indicate expression differences ≥ 2-fold).

[0027] Figure 9 In Example 5, the diagnostic efficacy of hsa_circ_0002782 in AML was verified by the receiver operating characteristic curve (ROC curve). DETAILED DESCRIPTION

[0028] The following are specific embodiments of the present invention, which further describe the technical solutions of the present invention, but the present invention is not limited to these embodiments.

[0029] The present invention relates to a specific circular RNA, namely hsa_circ_0002782, and a specific recognition primer pair thereof and a primer sequence of an internal reference gene GAPDH.

[0030] The sequences and primers involved in the present invention are composed of: Circular RNA hsa_circ_0002782 shown in SEQ ID NO. 1: .

[0031] In order to effectively detect and quantitatively analyze the presence and expression level of hsa_circ_0002782, the present invention provides a primer pair that specifically recognizes RNA hsa_circ_0002782, including a forward primer as shown in SEQ ID No. 2 and a reverse primer as shown in SEQ ID No. 3: SEQ ID NO.2: CCTGCTGTCACAGAAGCTAATGG; SEQ ID NO.3: TGGAGCTGGTTATTTGGGTAGCA; These two short sequences were designed to pair with complementary sequences on hsa_circ_0002782, allowing for amplification and detection of this circular RNA using molecular biology techniques such as PCR (polymerase chain reaction). Primer design took into account factors such as specificity, efficiency, and amplification product length to ensure optimal experimental results.

[0032] When performing gene expression analysis, a stable internal reference gene is often required to normalize the data and eliminate errors between samples due to processing or individual differences. The upstream and downstream primers for the internal reference GAPDH provided by the present invention are shown in SEQ ID NO. 4 for the forward primer and SEQ ID NO. 5 for the reverse primer: SEQ ID NO.4: ATGGGGAAGGTGAAGGTCG; SEQ ID NO.5:GGGTCATTGATGGCAACAATATC.

[0033] This pair of primers can be used to amplify GAPDH mRNA in the sample and then used to correct the relative expression level of the target RNA.

[0034] In the following examples, the present invention uses real-time fluorescence quantitative PCR to detect the expression differences of hsa_circ_0002782 in AML samples, and analyzes the prognosis of AML in the high expression group and the low expression group in combination with clinical information. Therefore, a kit for detecting changes in gene expression can be prepared for the prognostic diagnosis of AML.

[0035] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below with reference to the accompanying drawings and specific examples. Unless otherwise specified, the techniques involved in the present invention are all conventional molecular biology techniques, and the enzymes, reagents and reaction conditions involved can be reasonably selected based on the experience of those skilled in the art. The reagents and consumables involved are common commercially available products, and the detection methods and instruments involved are also well known and mastered by those skilled in the art.

[0036] Example 1

[0037] RT-QPCR and sequencing verification of the hsa_circ_0002782 gene and hsa_circ_0002782 primers

[0038] S1. Cell collection and pretreatment AML2 cells cultured in vitro were collected and washed twice with PBS. 1 mL of RNAiso Plus reagent (TaKaRa) was added to the cell pellet, mixed by repeated pipetting, and stored at -80°C until use.

[0039] S2. RNA Extraction Add 200 μl of chloroform directly to the RNAiso Plus Lysis Buffer from step 1 above, shake vigorously up and down for 15 seconds, let stand for 10 minutes, and centrifuge at 12,000 g for 15 minutes at 4°C. Transfer the supernatant to a new EP tube, add an equal volume of isopropanol, mix thoroughly, let stand for 10 minutes, and centrifuge at 12,000 g for 10 minutes at 4°C. Discard the supernatant, add 1 ml of 75% ethanol, wash by inversion, and centrifuge at 12,000 g for 5 minutes at 4°C. Discard the supernatant, add 1 ml of anhydrous ethanol, wash by inversion, and centrifuge at 12,000 g for 5 minutes at 4°C; discard the supernatant, and dry at room temperature. Add an appropriate volume (20-50 μl) of DEPC water based on the amount of RNA precipitate to dissolve the RNA and measure the RNA concentration (A260 / A280 = 1.8-2.1).

[0040] S3, cDNA reverse transcription cDNA was reverse transcribed using Thermo Fisher Scientific's RevertAid First Strand cDNA Synthesis Kit. Reverse transcription was performed according to the recipes in Tables 1 and 2 below.

[0041] Table 1: Reagents and usage

[0042] Reaction procedure: 65°C, 5 minutes; 4°C, set aside;

[0043] Table 2: Reaction system

[0044] Reaction program: 25°C, 5 minutes; 42°C, 60 minutes; 70°C, 5 minutes; 4°C, spare primers;

[0045] Table 3: Primer sequences

[0046] S4. Quantitative PCR (QPCR) hsa_circ_0002782 and GAPDH were amplified by qPCR using TaKaRa's TB Green™ Premix ExTaq™ II (Tli RNaseH Plus) kit. The experimental system was performed according to Table 4 below.

[0047] Table 4: PCR amplification system

[0048] The reaction procedure was a three-step PCR amplification protocol: initial denaturation at 95°C for 1 min; a second denaturation step at 95°C for 15 sec, annealing at 60°C for 30 sec, and extension at 72°C for 32 sec, for 40 cycles. The standard melting curve protocol was: 95°C for 15 sec; 60°C for 1 min; 95°C for 15 sec; and 60°C for 15 sec.

[0049] S5. Agarose electrophoresis The PCR amplification products were detected by 3% agarose gel electrophoresis using GAPDH as an internal reference. The PCR products were sent to Shanghai Sangon Sequencing Co., Ltd. for sequencing. After sequence alignment, the hsa_circ_0002782 gene was clearly detected. Figure 1 .

[0050] S6. Using the cDNA of AML2 cell line as template, the PCR amplification product was shaken and mixed, centrifuged instantaneously, and gradually diluted according to the ratio of 1:100, 1:1000, 1:10000, 1:100000, 1:1000000, and 1:10000000. PCR experiments were performed according to the reaction system and reaction conditions in the above-mentioned fluorescent quantitative PCR to obtain the CT value and draw an amplification efficiency graph. The results are shown in Figure 2 The amplification efficiency of the internal reference primer GAPDH was 99.71%, and the amplification efficiency of the target gene hsa_circ_0002782 primer was 98.74%, confirming that the primer amplification efficiency was good.

[0051] Example 2

[0052] Quantitative RT-PCR detection of hsa_circ_0002782 expression in the bone marrow of acute myeloid leukemia patients

[0053] S1. Bone marrow specimen collection and processing: Bone marrow specimens were collected from 190 patients with AML who were initially diagnosed between June 2016 and June 2023 at the First Affiliated Hospital of Ningbo University, and 21 normal controls. This study was approved by the Ethics Committee of the First Affiliated Hospital of Ningbo University. Bone marrow specimens were collected from bone marrow cell culture flasks, and patient information was recorded. Mononuclear cells were collected by density gradient centrifugation using Ficoll-based lymphocyte separation medium. RNAiso Plus reagent (TaKaRa) was added, mixed by repeated pipetting, and stored at -80°C until use.

[0054] S2. RNA extraction: the method is the same as that in Example 1;

[0055] S3. cDNA reverse transcription: the method is the same as in Example 1;

[0056] S4, quantitative PCR amplification: the method is the same as in Example 1;

[0057] S5, using AML2 cell line as control, 2 -ΔΔCt The expression level of hsa_circ_0002782 gene was calculated by ΔΔCt=[Ct hsa_circ_0002782 -Ct GAPDH ] 样本 -[Ct hsa_circ_0002782 -Ct GAPDH ] 正常对照 Data were statistically analyzed using SPSS 26 software. Fisher's exact test was used to compare differences between groups. Kaplan-Meier method and Log-rank test were used to analyze differences in survival data between groups. P < 0.05 was considered statistically significant. Figure 3 It can be seen that hsa_circ_0002782 is abnormally highly expressed in newly diagnosed AML.

[0058] S6. The correlation between hsa_circ_0002782 and clinical characteristics was analyzed, and the results are shown in Table 5. The results showed that the correlation between hsa_circ_0002782 and white blood cells, platelets, bone marrow blasts, and hemoglobin was not statistically significant. However, the complete remission rate in the hsa_circ_0002782 low expression group (74.1%) was significantly higher than that in the hsa_circ_0002782 high expression group (48.7%), indicating that hsa_circ_0002782 plays a role as an independent indicator in AML and may be associated with prognosis.

[0059] Table 5: Relationship between the expression level of hsa_circ_0002782 and different clinical indicators in AML patients

[0060] S7. Analyze the relationship between hsa_circ_0002782 and AML prognosis. Figure 4 The results showed that AML with high expression of hsa_circ_0002782 had worse overall survival and event-free survival, suggesting a poor prognosis.

[0061] S8. Multivariate analysis of the relationship between hsa_circ_0002782 and AML prognosis was performed. The results are shown in Tables 6 and 7. The results showed that the expression of hsa_circ_0002782 can serve as an independent prognostic factor for AML.

[0062] Table 6: Multivariate analysis of the prognosis of overall survival in AML patients

[0063] Table 7: Multivariate analysis of prognostic factors for event-free survival in AML patients

[0064] Example 3

[0065] In vitro experiments verified the effect of hsa_circ_0002782 on the growth of acute myeloid leukemia cells

[0066] S1. Synthetic hsa_circ_0012152 small interfering RNA lentiviral vector (sh-hsa_circ_0002782) and unrelated lentiviral sequences (negative control) (see Table 8). This lentiviral vector was tagged with a puromycin-resistant marker. The acute myeloid cell line AML2 and the cell line NB4 were transfected with the lentiviral vector and selected with puromycin to construct a stable sh-hsa_circ_0012152 cell line. Compared with the cell line transfected with the negative control, the cell growth of the sh-hsa_circ_0012152 cell line was inhibited. The results are shown in Figure 5 .

[0067] Table 8: Lentiviral sequences

[0068] S2. Label the cell lines with Annexin V-APC / 7-AAD and perform apoptosis detection on flow cytometer. Figure 6 、 7 , it can be seen that the apoptosis rate (Q2+Q4) of cells in the sh-hsa_circ_0002782 group was significantly higher than that in the negative control group.

[0069] Example 4

[0070] Bone marrow mononuclear cells from 3 normal controls, 3 newly diagnosed acute lymphoblastic leukemia patients and 5 newly diagnosed acute myeloid leukemia patients were collected for circRNA chip screening. Figure 8 The results showed that there were 255 upregulated circRNAs (FC ≥ 2, p < 0.05) compared with the normal control. Based on the gene expression abundance and upregulation fold, hsa_circ_0002782 was selected as the target gene.

[0071] Example 5

[0072] The expression and diagnostic efficacy of hsa_circ_0002782 in newly diagnosed AML patients and healthy controls were verified. 100 bone marrow specimens from newly diagnosed AML patients and 20 bone marrow specimens from normal controls were collected. Each sample was processed using the same method as in Example 1, and the expression level of hsa_circ_0002782 in each sample was calculated. Figure 3The results showed that hsa_circ_0002782 was significantly upregulated in acute myeloid leukemia patients (AML group) compared with healthy controls (control group). The diagnostic efficacy of hsa_circ_0002782 in AML was analyzed by receiver operating characteristic (ROC) curve (see Figure 9 ), AUC value was 0.963, sensitivity was 0.90, and specificity was 0.95. The analysis results showed that hsa_circ_0002782 can be used as a new molecular marker for auxiliary diagnosis of AML.

[0073] Based on these results, the present invention validated the identification of a new acute myeloid leukemia prognostic gene, hsa_circ_0002782, using clinical samples. Multivariate regression analysis revealed the relative expression level of hsa_circ_0002782, suggesting that hsa_circ_0002782 promotes cell growth in acute myeloid leukemia, acting as an oncogene. In particular, when combined with clinical indicators, this gene exhibits excellent predictive value and can be used in the preparation of reagents or kits for the prognosis of acute myeloid leukemia patients.

[0074] The parts of the embodiments herein that are not exhaustive of the midpoint values ​​of the technical scope claimed for protection by the present invention and the new technical solutions formed by equivalent replacement of single or multiple technical features in the technical solutions of the embodiments are also within the scope claimed for protection by the present invention; at the same time, in all the embodiments listed or not listed in the solutions of the present invention, each parameter in the same embodiment merely represents an example of its technical solution (i.e., a feasible solution), and there is no strict coordination and limitation relationship between the parameters, wherein the parameters can be replaced with each other without violating the axioms and the claims of the present invention, unless otherwise stated.

[0075] The technical means disclosed in the solutions of the present invention are not limited to the technical means disclosed in the above technical means, but also include technical solutions composed of any combination of the above technical features. The above is a specific embodiment of the present invention. It should be noted that for those skilled in the art, various improvements and modifications can be made without departing from the principles of the present invention, and such improvements and modifications are also considered to be within the scope of protection of the present invention.

[0076] The specific embodiments described herein are merely illustrative of the spirit of the present invention. Persons skilled in the art may make various modifications, additions, or substitutions to the described specific embodiments without departing from the spirit of the present invention or exceeding the scope of the appended claims.

Claims

1. A circular RNA marker for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, characterized in that: The circular RNA marker is RNA hsa_circ_0002782 as shown in SEQ ID NO.

1.

2. Application of circular RNA hsa_circ_0002782 expression level detection reagents in the preparation of products for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia.

3. The use according to claim 2, characterized in that The detection reagent for the expression level of circular RNA hsa_circ_0002782 includes a primer that specifically recognizes circular RNA hsa_circ_0002782.

4. The use according to claim 3, characterized in that The primers that specifically recognize circular RNA hsa_circ_0002782 include the upstream primer shown in SEQ ID NO. 2 and the downstream primer shown in SEQ ID NO.

3.

5. A product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, characterized in that: Includes primers that specifically recognize circular RNA hsa_circ_0002782.

6. The product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia according to claim 5, characterized in that: The primers that specifically recognize circular RNA hsa_circ_0002782 include the upstream primer shown in SEQ ID NO. 2 and the downstream primer shown in SEQ ID NO.

3.

7. The product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia according to claim 5, characterized in that: Primers specifically recognizing the internal control GAPDH are also included.

8. The product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia according to claim 7, characterized in that: The specific internal reference GAPDH primers include an upstream primer shown in SEQ ID NO. 4 and a downstream primer shown in SEQ ID NO.

5.

9. The product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia according to claim 5, characterized in that: It is a kit or a gene chip.

10. The product for auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia according to claim 5, characterized in that: Pharmaceutically acceptable excipients are also included.

Images