Sex specific molecular marking method of largemouth bass and application of gender specific molecular marking method

Abstract

The invention relates to the technical field of molecular biology and aquatic product breeding, in particular to a sex specific molecular marking method of largemouth bass and application thereof, and the sex specific molecular marking method comprises the following steps: step 1, extracting genome DNA in fin ray tissues of the largemouth bass; 2, carrying out PCR (Polymerase Chain Reaction) or qPCR (Quantitative Polymerase Chain Reaction) amplification by using a sex specific primer pair; step 3, judging the gender according to an amplification result: if a specific band of 350bp-380bp is amplified in common PCR (Polymerase Chain Reaction), or a CT (Computed Tomography) value in qPCR is less than or equal to 27, judging that the sex is male; if there is no amplified band or the CT value is greater than 27, determining that the fish is female; the primer and the probe designed based on the SVER-Y region are high in specificity and low in misjudgment rate; the application range is wide, and the method is suitable for micropterus salmoides at different growth stages; qPCR can be completed within 2 hours, and the method is suitable for large-scale sample screening.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology and aquatic breeding, and in particular to a sex-specific molecular marker method for largemouth bass and an application thereof. Background Art

[0002] Largemouth bass (Micropterus salmoides) is a key freshwater fish species in my country, widely favored by fish farmers for its rapid growth and delicious meat. Female largemouth bass typically grow faster than males, making sex-controlled breeding crucial for improving aquaculture profitability. Currently, sex determination relies primarily on the following methods: physiological sex determination: This involves dissecting and observing gonadal morphology, but is only applicable to sexually mature individuals and requires sacrificing the fish; chromosome analysis: This method is highly accurate but complex, requiring specialized equipment and technicians; endoscopic techniques: This requires surgical incisions, is expensive, and has limited applicability; ultrasonic testing: This method is not suitable for small individuals and has high equipment costs; hormone testing: This method is costly, can experience large fluctuations in hormone levels, and can be prone to misidentification; and whole-genome sequencing: This method is highly accurate but also expensive, with complex and time-consuming data analysis. Summary of the Invention

[0003] The purpose of the present invention is to provide a sex-specific molecular marker method for largemouth bass and its application, so as to solve the problems existing in the above-mentioned prior art.

[0004] The above technical objectives of the present invention are achieved through the following technical solutions: A sex-specific molecular marker method for largemouth bass comprises the following steps: Step 1: extracting genomic DNA from fin ray tissue of largemouth bass; Step 2: Perform PCR or qPCR amplification using sex-specific primer pairs; Step 3. Determine the sex based on the amplification results: If a specific band of 350bp-380bp is amplified in conventional PCR, or the CT value is ≤27 in qPCR, the animal is determined to be male; if no amplified band is found or the CT value is >27, the animal is determined to be female.

[0005] In a further embodiment, the sex-specific primer pair comprises: Common PCR primer pairs: Forward primer F: ACAGCCTGCCTGAGGAAATC (SEQ ID NO: 1) Reverse primer R: TCACTGCAATGCTGACGACT (SEQ ID NO: 2) qPCR primer pairs and probes: Forward primer F: CAGTGACGTCTCCTGTGGTC (SEQ ID NO: 3) Reverse primer R: TCTGTTGGTGCTTTCCCACA (SEQ ID NO: 4) Probe sequence: TGAATGAGTCTCTTGGCTCCGGCTTG (SEQ ID NO: 5) In a further embodiment, the genomic DNA is extracted using the SDS lysis method, including liquid nitrogen grinding, proteinase K digestion, phenol-chloroform extraction, ethanol precipitation and other steps.

[0006] In a further embodiment, the conventional PCR reaction system comprises: 2×PCR premix, betaine additive, primer pair and DNA template, and the reaction procedure comprises pre-denaturation, denaturation, and annealing / extension steps.

[0007] In a further embodiment, the qPCR reaction system comprises: 2×qPCR premix, betaine additive, primer pair, probe and DNA template, and the reaction procedure includes pre-denaturation, denaturation, annealing / extension and collection of fluorescence signals.

[0008] In a further embodiment, the method is applicable to sexing of juvenile and adult largemouth bass.

[0009] In a further embodiment, the method can also be used in sex-controlled breeding of largemouth bass.

[0010] The present invention also provides a kit for sex identification of largemouth bass, comprising the above-mentioned sex-specific primer pair and / or probe, PCR or qPCR reaction premix, betaine additive, DNA extraction reagent and instructions for use.

[0011] In summary, the present invention has the following beneficial effects: simple operation: no complex equipment is required and it can be completed in an ordinary laboratory; low cost: compared with whole genome sequencing, the cost of a single test is significantly reduced; high accuracy: primers and probes designed based on the SVER-Y region have strong specificity and a low error rate; wide scope of application: suitable for largemouth bass at different growth stages; fast and efficient: qPCR can be completed within 2 hours, suitable for large-scale sample screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the electrophoresis diagram of the normal PCR amplification result, showing a band at 368 bp in the male sample; Figure 2 is the qPCR amplification curve graph, showing that the CT value of male samples is ≤27; Figure 3 Schematic diagram of primer specificity alignment. DETAILED DESCRIPTION

[0013] In order to make the content of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific examples, but the present invention is not limited thereto. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0014] Example 1: like Figure 1-Figure 3 As shown, a sex-specific molecular marker method for largemouth bass and its application, The following steps are involved: Step 1: extracting genomic DNA from fin ray tissue of largemouth bass; Step 2: Perform PCR or qPCR amplification using sex-specific primer pairs; Step 3: Determine sex based on amplification results: If a specific band of 350 bp to 380 bp is amplified in conventional PCR, with 368 bp being the optimal value, or if the CT value in qPCR is ≤ 27, the animal is determined to be male; if no amplified band is present or the CT value is > 27, the animal is determined to be female. The sex-specific primer pair includes: Common PCR primer pairs: Forward primer F: ACAGCCTGCCTGAGGAAATC; Reverse primer R: TCACTGCAATGCTGACGACT; qPCR primer pairs and probes: Forward primer F: CAGTGACGTCTCCTGTGGTC; Reverse primer R: TCTGTTGGTGCTTTCCCACA; Probe sequence: TGAATGAGTCTCTTGGCTCCGGCTTG; the genomic DNA is extracted using the SDS lysis method, including liquid nitrogen grinding, proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation steps; the conventional PCR reaction system comprises: 2×PCR premix, betaine additive, primer pair, and DNA template, and the reaction procedure comprises pre-denaturation, denaturation, and annealing / extension steps; the qPCR reaction system comprises: 2×qPCR premix, betaine additive, primer pair, probe, and DNA template, and the reaction procedure comprises pre-denaturation, denaturation, annealing / extension, and fluorescence signal collection; the kit comprises, wherein the kit is provided with the sex-specific primer pair and / or probe according to claim 2; PCR or qPCR reaction premix; betaine additive; DNA extraction reagent; and instructions for use; the kit is suitable for sex identification of juvenile and adult largemouth bass.

[0015] Specific implementation process: DNA extraction: 50 mg of fin ray tissue was ground in liquid nitrogen, then digested with lysis buffer and proteinase K at 56°C for 1 hour, extracted with phenol-chloroform, precipitated with ethanol, washed, and dissolved in sterile water. PCR reaction: Primers F (SEQ ID NO: 1) and R (SEQ ID NO: 2) were used in the following reaction system: 2× PCR premix: 12.5 μl; primer F (10 μM): 0.4 μl; primer R (10 μM): 0.4 μl; betaine: 4 μl; DNA template: 2 μl; DEPC water: 5.7 μl; total volume: 25 μl.

[0016] The reaction procedure was as follows: 5 min at 37°C, then 5 min at 95°C, and finally 34 cycles of 95°C for 15 seconds, then switching to 60°C for 30 seconds.

[0017] Result analysis: Electrophoresis test: if a band appears at 368bp, it is male, otherwise it is female.

[0018] Example 2: qPCR sex identification; DNA extraction; qPCR reaction: using primers F (SEQ ID NO: 3), R (SEQ ID NO: 4) and probe (SEQ ID NO: 5), the reaction system is as follows: 2×qPCR premix: 12.5 μl; primer F: 0.4 μl; primer R: 0.4 μl; probe: 0.2 μl; betaine: 4 μl; DNA template: 2 μl; DEPC water: 5.5 μl; total volume: 25 μl.

[0019] Reaction program: 37°C for 5 min; 95°C for 5 min; 95°C for 15 s and then quickly switched to 60°C for 30 s (fluorescence collection), 45 cycles.

[0020] Result analysis: If the CT value is ≤27, it is male, and >27, it is female.

[0021] Specific implementation of the qPCR sex identification method: The qPCR (real-time quantitative polymerase chain reaction) sex identification method, based on the sex-specific primer and probe system developed by this invention, amplifies and then detects the target sequence of the Y chromosome-specific SV-enriched region (SVER-Y) in largemouth bass genomic DNA, enabling rapid and accurate sex identification. This example details the implementation steps, technical principles, optimization process, and validation results of this method.

[0022] 1. Optimization and implementation of DNA extraction methods Although the SDS lysis method was used to extract genomic DNA in Example 1, the DNA extraction process was further optimized in this example to improve the sensitivity and stability of qPCR detection. The specific steps are as follows: Sample preparation: About 50 mg of dorsal or caudal fin tissue of largemouth bass was taken, quickly frozen in liquid nitrogen, ground into powder, and transferred into a 1.5 mL centrifuge tube.

[0023] Cell lysis: Add 1 mL of lysis buffer (containing 100 mM Tris-HCl pH 8.0, 10 mM EDTA, 0.5% SDS, 20 μg / mL RNase A), vortex to mix, then add 20 μL of proteinase K (20 mg / mL). Digest in a 56°C water bath overnight (12-16 hours) until the tissue is completely dissolved.

[0024] DNA purification: Extract twice with phenol-chloroform-isoamyl alcohol (25:24:1), centrifuge at 12,000 rpm for 10 minutes each time, and carefully aspirate the supernatant; add 0.1 volume of 3 M sodium acetate (pH 5.2) and 2 volumes of pre-chilled anhydrous ethanol, and precipitate at -20°C for 30 minutes; after centrifugation, wash the precipitate twice with 70% ethanol, air dry for 5 minutes, and dissolve in 50 μL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).

[0025] DNA quality testing: DNA concentration and purity were determined using a NanoDrop speCTrophotometer (A260 / A280 ratio should be between 1.8 and 2.0), and DNA integrity was verified by 1% agarose gel electrophoresis.

[0026] 2. Design and specificity verification of qPCR primers and probes Based on the SVER-Y region (located on chromosome 10) discovered in previous genome alignment analysis, specific primers and TaqMan probes were designed: Forward primer F: 5′-CAGTGACGTCTCCTGTGGTC-3′ (SEQ ID NO: 3); Reverse primer R: 5′-TCTGTTGGTGCTTTCCCACA-3′ (SEQ ID NO: 4); Probe sequence: 5′-FAM-TGAATGAGTCTCTGGCTCCGGCTTG-BHQ1-3′ (SEQ ID NO: 5); To verify the specificity of primers and probes, the following experiments were performed: Sequence alignment using the BLAST tool confirmed that the primers and probes specifically bound only to the SVER-Y region and had no significant homology to other genomic regions.

[0027] qPCR amplification was performed using genomic DNA from female and male largemouth bass as templates. The results showed that male samples showed a typical S-shaped amplification curve with a stable CT value between 22-24; female samples had no amplification signal (CT value >35 or undetectable).

[0028] Melting curve analysis was used to verify the specificity of the amplified product: a single sharp peak appeared in the male sample (Tm value approximately 78°C), while no specific peak was observed in the female sample.

[0029] Cross-reaction test: When genomic DNA of common farmed fish such as Siniperca chuatsi, Mandarin fish, and Tilapia was used as template for amplification, no non-specific amplification was observed, demonstrating that the primer system is highly species-specific for largemouth bass.

[0030] 3. Establishment and optimization of qPCR reaction system; After multiple optimization experiments, the optimal reaction system was determined as follows (25 μL system): 2× TaqMan Universal PCR Master Mix (containing UNG enzyme): 12.5 μL; Forward primer (10 μM): 0.4 μL; Reverse primer (10 μM): 0.4 μL; TaqMan probe (10 μM): 0.2 μL; 5 M Betaine: 4 μL; Genomic DNA template (50 ng / μL): 2 μL; Nuclease-free water: 5.5 μL; Reaction program settings: UNG enzyme activation: 37°C for 2 minutes (optional to prevent residual contamination) Pre-denaturation: 95°C for 5 minutes Amplification cycles (45 cycles): denaturation at 95°C for 15 seconds, annealing / extension at 60°C and fluorescence signal acquisition for 30 seconds; cooling: hold at 25°C for 10 seconds; Instrument settings: Use an Applied Biosystems QuantStudio 5 or similar qPCR instrument, select the FAM channel to collect fluorescence signals, set the threshold to 10 times the standard deviation of the fluorescence signal baseline, and set the baseline cycle to 3-15 cycles.

[0031] IV. Establishment of standard curve and quantitative analysis To verify the quantitative accuracy and repeatability of the qPCR method, a standard curve was constructed: Male largemouth bass genomic DNA was serially diluted (100 ng / μL, 10 ng / μL, 1 ng / μL, 0.1 ng / μL, and 0.01 ng / μL) as a standard.

[0032] Three replicate wells were set for each concentration for qPCR amplification, and the CT value was recorded.

[0033] The standard curve was drawn with the logarithm of DNA concentration as the horizontal axis and the CT value as the vertical axis. The results showed that the linear relationship was good within the concentration range of 0.01-100 ng / μL (R 2 >0.99), the amplification efficiency was between 90%-105%, meeting the quantitative requirements.

[0034] Detection sensitivity tests showed that this method can stably detect target sequence DNA as low as 0.01 ng / μL, equivalent to approximately 3 genome copies.

[0035] V. Establishment and Verification of Gender Determination Criteria The following sexing criteria were established by blind testing of largemouth bass specimens of known sex (verified by dissection): CT value ≤ 27: determined to be male (corresponding to successful amplification of the target sequence); CT value > 27 or undetectable (NoCT): determined to be female (target sequence missing or below the detection limit); To verify the reliability of this standard, 240 samples (120 males and 120 females) were tested: The CT values ​​of male samples ranged from 21.5 to 24.8 (mean 23.2 ± 0.8); There was no amplification signal in any female sample (CT value > 35); The accuracy of gender determination reached 100% (240 / 240); In addition, repeatability tests (repeated 3 times within the group) and reproducibility tests (different operators, different instruments) were performed on the same batch of samples. The results showed that the coefficient of variation (CV) of the CT value was less than 2%, indicating that the method has high repeatability and stability.

[0036] VI. Practical Application Examples and Large-Scale Screening Process This method has been applied to the sex control project of a largemouth bass breeding center. The specific process is as follows: Sample collection: 1000 juvenile fish (5-8 cm in length) aged 3-5 months were randomly selected from the breeding ponds, and about 2 mm 2Fin ray tissue was plated in a 96-deep-well plate, and 200 μL of DNA preservation solution (containing 25 mM NaOH and 0.2 mM EDTA) was added to each well.

[0037] High-throughput DNA extraction: Using a magnetic bead-based nucleic acid extraction system (such as the TIANamp Marine Animals DNA Kit) and an automated workstation (such as the KingFisher Flex), 96 samples can be processed simultaneously, with an extraction time of approximately 45 minutes.

[0038] qPCR assay: Use a 384-well qPCR plate, set up two technical replicates for each sample, and also include a positive control (male DNA), a negative control (female DNA), and a blank control (water). The entire amplification process takes approximately 1.5 hours.

[0039] Result analysis: The instrument automatically generates amplification curves and CT values, and automatically determines gender and generates a report using a custom analysis template (setting a CT threshold of 27).

[0040] Data: 512 males and 488 females were identified among 1,000 fish, with a sex ratio close to 1:1, consistent with theoretical expectations. Dissections of 50 fish were randomly selected for verification, and the results were fully consistent with the qPCR results.

[0041] 7. Technical Advantages and Innovations Compared with existing technologies in this field, this qPCR sex identification method has the following significant advantages: Fast detection speed: From sample processing to result output can be completed within 3 hours, which is much faster than traditional chromosome analysis (3-5 days) or whole genome sequencing (1-2 weeks).

[0042] Low cost: The cost of testing a single sample is about RMB 5, which is less than 1 / 100 of the cost of whole genome sequencing.

[0043] Wide applicability: It is not only suitable for sexually mature individuals, but can also accurately identify juvenile fish over 20 days old (body length ≥1.5 cm).

[0044] High degree of automation: Can be integrated with automated nucleic acid extraction and qPCR systems to achieve high-throughput screening of thousands of samples per day.

[0045] Objective and accurate results: Quantitative detection based on fluorescence signals avoids subjective misjudgment, and DNA quality and amplification efficiency can be further monitored by setting internal reference genes (such as β-aCTin).

[0046] 8. Precautions and troubleshooting DNA quality requirement: degraded DNA can cause false negatives, it is recommended that the A260 / A280 ratio be between 1.8-2.0 and verified by electrophoresis to be non-degraded.

[0047] Inhibitor effect: residual phenol, ethanol or hemoglobin in the sample can inhibit the PCR reaction, it is recommended to eliminate the effect by diluting the sample or purifying the DNA with a purification column.

[0048] Contamination prevention: strictly separate zones for sample handling, PCR preparation, amplification and detection, use UNG enzyme to prevent carryover contamination, regularly wipe the workbench with 10% sodium hypochlorite.

[0049] Instrument calibration: regularly calibrate the qPCR instrument for light and temperature, to ensure the accuracy of fluorescence acquisition and temperature control.

[0050] Primer and probe stability: lyophilized powder form of primers and probes can be stored at -20℃ for 2 years, avoid repeated freeze-thawing (recommended to store in small batches).

[0051] The qPCR sex identification method provided by the embodiment has been verified by a large number of experiments, and has the advantages of high reliability, good repeatability, and easy standardization, which can provide strong technical support for gender control breeding of large mouth bass. Those skilled in the art can appropriately adjust the reaction system, program parameters and the like according to actual needs, and these adjustments all fall within the protection scope of the present application.

[0052] The technical solutions in the embodiments of the present application are described clearly and completely, obviously, the described embodiments are only part of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0053] Although the embodiments of the present application have been shown and described, those skilled in the art can understand that various changes, modifications, replacements and variations can be made to these embodiments without departing from the principles and spirits of the present application, the scope of the present application is defined by the appended claims and their equivalents.

Claims

1. A sex-specific molecular marker method for largemouth bass, characterized in that: The following steps are involved: Step 1: extracting genomic DNA from fin ray tissue of largemouth bass; Step 2: Perform PCR or qPCR amplification using sex-specific primer pairs; Step 3. Determine the sex based on the amplification results: If a specific band of approximately 350 bp to 380 bp is amplified in conventional PCR, or the CT value is ≤27 in qPCR, the animal is determined to be male; if no amplified band is found or the CT value is >27, the animal is determined to be female.

2. The method according to claim 1, characterized in that The sex-specific primer pairs include: Common PCR primer pairs: Forward primer F: ACAGCCTGCCTGAGGAAATC; Reverse primer R: TCACTGCAATGCTGACGACT; qPCR primer pairs and probes: Forward primer F: CAGTGACGTCTCCTGTGGTC; Reverse primer R: TCTGTTGGTGCTTTCCCACA; Probe sequence: TGAATGAGTCTCTTGGCTCCGGCTTG.

3. The method according to claim 1, characterized in that The genomic DNA was extracted using the SDS lysis method, including liquid nitrogen grinding, proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation steps.

4. The method according to claim 1, wherein The common PCR reaction system comprises: 2×PCR premix, betaine additive, primer pair and DNA template, and the reaction procedure comprises pre-denaturation, denaturation and annealing / extension steps.

5. The method according to claim 1, wherein The qPCR reaction system includes: 2×qPCR premix, betaine additive, primer pair, probe and DNA template, and the reaction procedure includes pre-denaturation, denaturation, annealing / extension and collection of fluorescence signals.

6. Use of the method according to any one of claims 1 to 5 in sex-controlled breeding of largemouth bass, comprising a kit comprising the sex-specific primer pair and / or probe according to claim 2; a PCR or qPCR reaction premix; a betaine additive; a DNA extraction reagent; and instructions for use.

7. The kit according to claim 6, characterized in that The kit is suitable for sex identification of juvenile and adult largemouth bass.

Images