Application of overexpressed Igf2bp3 gene and method for regulating olfactory function

Abstract

The invention discloses application of an overexpressed Igf2bp3 gene and a method for regulating and controlling an olfactory function. The application of the substance for overexpressing the Igf2bp3 gene in any one of the following aspects: preparing a medicament for treating olfactory dysfunction; preparing a medicine for promoting regeneration of the olfactory sensory neurons; preparing a medicine for repairing the olfactory nerve injury; preparing a medicine for promoting olfaction function recovery; the medicine for improving the olfactory function is prepared. The method for regulating and controlling the olfactory function comprises the following steps: transfecting cells in olfactory epithelium by using a lentiviral vector capable of overexpressing exogenous IGF2BP3 in living cells or a lentiviral vector capable of transcribing and interfering a nucleotide sequence expressed by an Igf2bp3 gene; according to the invention, the Igf2bp3 gene is used as a regulation and control target to regulate and control the recovery of the olfactory function after the olfactory injury; the overexpressed Igf2bp3 can promote the regeneration of olfactory sensory neurons and further increase the number of OMP positive neurons so as to promote the recovery of olfactory functions.

Description

Technical Field

[0001] The present invention relates to a drug for treating diseases related to olfactory disorders, and in particular to an application of overexpressing the Igf2bp3 gene and a method for regulating olfactory function. Background Art

[0002] Olfactory dysfunction caused by damage to the sensory neurons of the olfactory epithelium is highly prevalent and poorly treated, particularly when caused by the influenza virus, which severely impacts patients' quality of life. Currently, the effectiveness of surgical intervention combined with topical anti-inflammatory medications for the treatment of olfactory dysfunction remains inconsistent in clinical practice, primarily due to the incomplete understanding of the key regulatory molecular targets and mechanisms for the repair of damaged sensory neurons in the olfactory epithelium. However, regeneration of the olfactory nerves in the olfactory epithelium is a key factor in regulating the recovery of olfactory function.

[0003] Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3), also known as IMP3, CT98 or CRD-BP3, is an RNA binding protein (RBP) that affects cell behavior by regulating the stability and translation efficiency of mRNA. As a key regulator of embryonic development, IGF2BP3 is expressed in tumors through mRNA. 6 A-dependent mRNA stability regulation reprograms oncogene expression, driving malignant phenotypes and therapeutic resistance, and can serve as a prognostic marker and target for tumors. However, there have been no reports of using IGF2BP3 as a molecular intervention target to regulate olfactory function or treat olfactory disorders. Summary of the Invention

[0004] Objectives of the Invention: This invention aims to provide a method for regulating olfactory function, addressing the problem of how to construct an animal model capable of regulating olfactory function, by providing a substance that overexpresses the Igf2bp3 gene for use in the preparation of a drug for treating olfactory disorders and for the regeneration and repair of olfactory sensory neurons.

[0005] Technical solution: Use of the substance for overexpressing the Igf2bp3 gene of the present invention in any of the following:

[0006] preparing a drug for treating olfactory dysfunction;

[0007] preparing a drug for promoting the regeneration of olfactory sensory neurons;

[0008] Preparation of drugs for repairing olfactory nerve damage;

[0009] preparing a drug for promoting recovery of olfactory function;

[0010] Preparation of a medicine for enhancing olfactory function.

[0011] Preferably, the substance overexpressing the Igf2bp3 gene is an expression vector capable of overexpressing the exogenous insulin-like growth factor 2 mRNA binding protein 3 in living cells.

[0012] Preferably, the living cells are living cells in the olfactory epithelium, and the expression vector is a viral vector or a plasmid vector into which an Igf2bp3 gene expression cassette is cloned.

[0013] The expression cassette comprises a target gene (Igf2bp3) and necessary expression elements (such as a promoter), which ensure that the Igf2bp3 gene can express the biologically active insulin-like growth factor 2 mRNA binding protein 3 in the host cell.

[0014] Preferably, the viral vector comprises at least one of a lentivirus, an adenovirus, an adeno-associated virus, and a retrovirus, and is preferably a lentivirus. The living cells in the olfactory epithelium are living olfactory sensory neurons.

[0015] Preferably, the nucleotide sequence of the Igf2bp3 gene is shown in SEQ ID No. 1.

[0016] Another aspect of the present application discloses a method for regulating olfactory function for non-diagnostic and therapeutic purposes, comprising transfecting cells in the olfactory epithelium with a lentivirus vector capable of overexpressing the exogenous insulin-like growth factor 2 mRNA binding protein 3 in living cells; or transfecting cells in the olfactory epithelium with a lentivirus vector capable of transcribing a nucleic acid sequence interfering with the expression of the Igf2bp3 gene in living cells.

[0017] In the above method, overexpression of the Igf2bp3 gene can significantly increase the number of olfactory sensory neurons in the olfactory epithelium, suggesting that it can promote the regeneration of olfactory sensory neurons and promote the recovery of olfactory function. Interference with the expression of the Igf2bp3 gene can significantly reduce the number of olfactory sensory neurons in the olfactory epithelium, and further inhibit the recovery of olfactory function and the regeneration of olfactory sensory neurons. According to this effect, Igf2bp3 can be used as a molecular target to freely regulate the number of olfactory sensory neurons and olfactory function in the olfactory epithelium according to the needs of drug research and development.

[0018] Preferably, the nucleic acid sequence interfering with the expression of the Igf2bp3 gene is as follows:

[0019] 5'-GCCGCGGAGAAGTCCATTACT-3'.

[0020] Preferably, the olfactory epithelium is epithelial tissue in the nasal olfactory mucosa of experimental animals. The above method can be used to construct an experimental animal model with adjustable olfactory function, which is convenient for subsequent research on therapeutic targets and related drug efficacy, and has application prospects in the pharmaceutical industry.

[0021] Preferably, the transfection method is intranasal injection of a lentivirus suspension, and the lentivirus titer is 1x10 8 ~ 9x10 8 TU / mL.

[0022] Preferably, the cells comprise olfactory sensory neurons.

[0023] The present application is based on the regulation of Igf2bp3 gene on olfactory sensory neuron regeneration, and interference with the expression of Igf2bp3 gene inhibits olfactory recovery and olfactory epithelial sensory neuron regeneration. Overexpression of Igf2bp3 gene mediated by lentivirus can significantly promote olfactory recovery and olfactory epithelial sensory neuron regeneration, and has good effect.

[0024] Beneficial effects: Compared with the prior art, the present application has the following obvious advantages:

[0025] The present application takes Igf2bp3 gene as a regulation target to regulate the recovery of olfactory function after olfactory injury. Igf2bp3 gene as a regulation target can promote the recovery of olfactory function by promoting the regeneration of olfactory sensory neurons and increasing the number of OMP positive neurons, which is beneficial to the development of new treatment methods and strategies. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 WB detection results of the expression amount of IGF2BP3 protein in the olfactory epithelium after olfactory injury;

[0027] Figure 2 The influence of interfering with the expression of Igf2bp3 gene in olfactory epithelium on olfactory function recovery and the number of OMP positive neurons;

[0028] Figure 3 The influence of overexpression of Igf2bp3 gene in olfactory epithelium on olfactory function recovery and the number of OMP positive neurons. DETAILED DESCRIPTION

[0029] The technical solutions of the present application will be further described below in combination with the drawings.

[0030] Example 1: Investigation of Igf2bp3 expression in olfactory epithelium after olfactory injury

[0031] (1) Olfactory epithelial sample protein extraction

[0032] Adult C57BL / 6 mice were injected intraperitoneally with methimazole (75 mg / kg) to induce olfactory damage. A control group of mice received an equal volume of saline. Olfactory mucosal tissue samples were collected at 0, 3, 7, and 14 days after injection. Total protein was extracted from the olfactory mucosal tissue using RIPA lysis buffer (containing protease and phosphatase inhibitors). Protein concentration was determined using a BCA assay to ensure consistency between samples.

[0033] (2) Western blot

[0034] The extracted protein samples were subjected to SDS-PAGE electrophoresis to separate proteins of different molecular weights. The separated proteins were then transferred to a PVDF membrane, and the membrane was blocked with 5% skim milk powder for 1 hour to reduce nonspecific binding. IGF2BP3 primary antibody (dilution 1:1000, rabbit anti-IGF2BP3) was added, and the membrane was incubated overnight at 4°C. Subsequently, HRP-conjugated secondary antibody (dilution 1:5000, rabbit anti-IGF2BP3) was added, and the membrane was incubated for 1 hour at room temperature. Chemiluminescence was developed using ECL reagent, and imaging was performed using the ImageQuantLAS 4000 imaging system. Western blot bands were quantified using ImageJ software, and the relative expression of IGF2BP3 was calculated using β-tubulin as an internal control.

[0035] The results are as follows Figure 1 As shown, Figure 1 Figure A is a WB example figure, and Figure B is a WB relative expression statistical figure. Figure 1 Western blot was used to verify the expression changes of Igf2bp3 in the olfactory epithelium after olfactory damage (β-Tubulin was used as an internal reference). Figure 1 The results showed that compared with the control group on day 0 (D), the expression of IGF2BP3 protein in the olfactory epithelium of mice increased significantly after methimazole-induced olfactory damage, reaching the highest level on the 7th day after damage, and gradually decreased on the 14th day. The expression of IGF2BP3 protein showed a phenomenon of first increasing and then decreasing.

[0036] Example 2: Investigating the effect of interfering with Igf2bp3 expression in the olfactory epithelium on the recovery of olfactory function

[0037] (1) Intranasal injection of Igf2bp3 interfering lentivirus (Sh-IGF2BP3).

[0038] Select adult C57BL / 6 mice, randomly divided into two groups, 5 in each group. The control group (NC group) was intranasally injected with a slow virus carrying an empty vector. The experimental group (Sh-IGF2BP3 group) was intranasally injected with a slow virus carrying IGF2BP3 interference sequence (GCCGCGGAGAAGTCCATTACT), both viruses were purchased from Genomeditech Co., Ltd. Intranasal injection was performed using a brain stereotaxic instrument to ensure uniform distribution of the virus in the olfactory mucosa. Each mouse was injected with 2.5 μL of slow virus suspension in each nasal cavity, and the virus titer was 3×10^8 TU / mL. Two weeks after intranasal virus transfection, olfactory mucosa tissue samples were taken from different groups of mice.

[0039] (2) Verification of the interference efficiency of Igf2bp3 in the olfactory epithelium.

[0040] Olfactory epithelium sample protein extraction and Western blot, as in Example 1

[0041] (3) Effect of interfering IGF2BP3 in the olfactory epithelium on the recovery of olfactory function.

[0042] Two weeks after intranasal virus transfection, olfactory damage was induced by intraperitoneal injection of methimazole (75 mg / kg) in the above two groups of mice. Olfactory behavior was examined at 0 days, 1 day, 3 days, 7 days, 14 days, and 21 days. Specifically, the buried sugar test: 24 hours before the experiment, the mice were fasted (free water), and the motivation of the mice for food was increased. The mice were placed individually in the test cage (familiar environment) for 10 minutes, and the thickness of the bedding in the cage was about 3-5 cm. A piece of sugar block that the mice liked was placed on the surface of the bedding, and the mice were allowed to explore and eat freely to ensure that they were familiar with the target food. The same sugar block was buried 1-2 cm deep in the bedding (the position was random but marked). The mice were placed in the cage, and the timing started. Record the time when the mouse first dug up the sugar block and bit it (latency), and the longest time was not more than 10 minutes (if not found, record as 10 minutes). Y-maze butyric acid aversion test: the mice were placed in the center of the Y-maze and allowed to freely explore all arms for 5-10 minutes (no odor) to familiarize themselves with the environment. Once a day for 2-3 consecutive days until the mouse's exploratory behavior is stable (reducing novelty interference). The Y-maze is divided into a butyric acid arm, where a filter paper soaked in 1% butyric acid (a source of aversive odor for mice) is placed at the end of the arm. Control arm: filter paper soaked in water is placed at the end of the arm. The third arm: keep closed. The mouse was placed in the center of the maze, and the number of times and the time spent in each arm were recorded within 5 minutes. Normal mice: will actively avoid the butyric acid arm (shorter time spent, fewer times entering). Olfactory defect mice: randomly explore each arm (no significant difference), and finally calculate the preference ratio.

[0043] (4) Effect of interfering Igf2bp3 on the number of olfactory sensory neurons in the olfactory epithelium

[0044] Sample collection and processing: On day 28 after injury, mice were anesthetized and fixed by heart perfusion with normal saline and 4% paraformaldehyde. Subsequently, the nasal tissues of mice were fixed in 4% paraformaldehyde solution for 6 hours. After fixation, the tissues were placed in EDTA solution for decalcification treatment for 72 hours, during which the decalcification solution was replaced regularly. After decalcification, the tissues were placed in a 30% sucrose solution for overnight dehydration treatment. Finally, the tissues were cut into 20-micron-thick sections using a freezing microtome for immunohistochemical staining analysis.

[0045] Immunohistochemical staining analysis: After the section was subjected to antigen repair and blocking treatment, the olfactory sensory neuron (OMP) primary antibody (dilution 1:200, rabbit anti) was added and incubated at 4°C overnight. The next day, the fluorescently labeled secondary antibody (dilution 1:500, rabbit anti) was added and incubated at room temperature for 1 hour. Subsequently, a fluorescence microscope was used for observation and photography, and finally ImageJ software was used for quantitative analysis of OMP positive cells.

[0046] The results are shown in Figure 2 Figure 2 Figures A and B are Western blot detection of changes in IGF2BP3 protein expression in the olfactory epithelium after interference with Igf2bp3 (β-Tubulin is the internal reference), and the results of A-B show that compared with the control group, after injection of the interference virus interfering with the expression of Igf2bp3, the IGF2BP3 protein expression in the olfactory epithelium of mice was significantly down-regulated.

[0047] Figure 2 Figures C and D are behavioral analysis of mouse olfactory function. After interfering with the expression of Igf2bp3 in the olfactory epithelium, the ability of mice to find food after olfactory injury and the avoidance behavior to butyric acid were significantly weakened compared with the control group (NC).

[0048] Figure 2 Figures E-G are staining diagrams of OMP in the olfactory epithelium of mice at different positions in the Igf2bp3 interference expression group and the control NC group. Compared with the control group, the number of OMP positive cells in the olfactory epithelium of mice was significantly reduced after interference with Igf2bp3.

[0049] Example 3: Investigation of the effect of overexpression of Igf2bp3 in the olfactory epithelium on the recovery of olfactory function

[0050] (1) Intranasal injection of overexpression lentivirus of Igf2bp3 (IGF2BP3-OE).

[0051] Adult C57BL / 6 mice were selected and randomly divided into two groups, 5 in each group. The control group (NC group) was intranasally injected with a lentivirus carrying an empty vector, and the sequence of Igf2bp3 was:

[0052] ​

[0053] Both viruses were purchased from Genecopoeia. The experimental group is the Igf2bp3 overexpression group (IGF2BP3-OE) which was intranasally injected with IGF2BP3 overexpression lentivirus. Intranasal injection was performed using a stereotaxic instrument to ensure uniform distribution of the virus in the olfactory mucosa. Each mouse was injected with 2.5 μL of lentivirus suspension in each nasal cavity, and the virus titer was 3x10^8 TU / mL. Two weeks after intranasal virus transfection, the olfactory mucosa tissue samples of mice in different groups were taken.

[0054] (2) Verification of the efficiency of Igf2bp3 overexpression in the olfactory epithelium

[0055] Olfactory epithelial sample protein extraction and Western blotting were performed as described in Example 1.

[0056] (3) Effect of IGF2BP3 overexpression in the olfactory epithelium on the recovery of olfactory function

[0057] Details are as described in Example 2.

[0058] (4) Effect of overexpression of Igf2bp3 on the number of olfactory sensory neurons in the olfactory epithelium

[0059] Details are as described in Example 2.

[0060] The experimental results are shown in Figure 3 , Figure 3 Figures A-B in the middle are Western blot detection of the change in IGF2BP3 protein expression in the olfactory epithelium after overexpression of Igf2bp3 (β-Tubulin is the internal reference). Figure 3 Figures A-B show that compared with the control group, after injection of overexpression Igf2bp3 virus, the IGF2BP3 protein expression in the olfactory epithelium of mice was significantly increased.

[0061] Figure 3 Figures C-D in the middle are the results of behavioral analysis of mouse olfactory function, which show that after overexpression of Igf2bp3 in the olfactory epithelium, the ability of mice to find food after olfactory damage and the avoidance behavior to butyric acid were significantly improved compared with the control group (NC).

[0062] Figure 3 Figures E-G in the middle are staining of OMP in the olfactory epithelium of mice in the Igf2bp3 overexpression group and the control NC group at different positions. The results show that compared with the control group, overexpression of Igf2bp3 significantly increased the number of OMP positive cells in the olfactory epithelium of mice.

[0063] The above verification shows that interfering with the expression of the Igf2bp3 gene can inhibit the functional recovery after olfactory injury, and the number of OMP positive neurons in the olfactory epithelium is inhibited. Overexpression of the Igf2bp3 gene can significantly promote the functional recovery after olfactory injury, and the number of OMP positive neurons in the olfactory epithelium is increased. The present application first verifies that Igf2bp3 can be an important molecular target for regulating the promotion of olfactory function recovery after olfactory injury.

Claims

1. Use of a substance that overexpresses the Igf2bp3 gene in any of the following: preparing a drug for treating olfactory dysfunction; preparing a drug for promoting the regeneration of olfactory sensory neurons; Preparation of drugs for repairing olfactory nerve damage; preparing a drug for promoting recovery of olfactory function; Preparation of a medicine for enhancing olfactory function.

2. The use according to claim 1, characterized in that The substance for overexpressing the Igf2bp3 gene is an expression vector capable of overexpressing exogenous insulin-like growth factor 2 mRNA binding protein 3 in living cells.

3. The use according to claim 2, characterized in that The living cells are living cells in the olfactory epithelium, and the expression vector is a viral vector or a plasmid vector cloned with an Igf2bp3 gene expression cassette.

4. The use according to claim 3, characterized in that The viral vector includes at least one of a lentivirus, an adenovirus, an adeno-associated virus, and a retrovirus, and the living cells in the olfactory epithelium are living olfactory sensory neurons.

5. The use according to claim 3, characterized in that The nucleotide sequence of the Igf2bp3 gene is shown in SEQ ID No.

1.

6. A method for regulating olfactory function for non-diagnostic and non-therapeutic purposes, characterized in that: The method comprises transfecting cells in the olfactory epithelium with a lentiviral vector capable of overexpressing exogenous insulin-like growth factor 2 mRNA binding protein 3 in living cells; or transfecting cells in the olfactory epithelium with a lentiviral vector capable of transcribing a nucleic acid sequence that interferes with Igf2bp3 gene expression in living cells.

7. The method for regulating olfactory function according to claim 6, characterized in that: The nucleic acid sequence that interferes with Igf2bp3 gene expression is as follows: 5'-GCCGCGGAGAAGTCCATACT-3'.

8. The method for regulating olfactory function according to claim 6, characterized in that: The olfactory epithelium is the epithelial tissue in the olfactory mucosa of the nose of the experimental animal.

9. The method for regulating olfactory function according to claim 6, characterized in that: The transfection method is to inject lentiviral suspension into the nose, and the lentiviral titer is 1×10 8 ~9×10 8 TU / mL.

10. The method for regulating olfactory function according to claim 6, characterized in that: The cells include olfactory sensory neurons.

Images