Application of CHD2 gene as target spot in inhibition of avian leukosis virus replication

By targeting the CHD2 gene using CRISPR/Cas9 technology, a CHD2 gene knockout cell line was constructed, solving the problem of the difficulty in blocking avian leukosis virus and achieving broad-spectrum inhibition of different ALV subpopulations, providing a novel and highly efficient antiviral technology.

CN120796285APending Publication Date: 2025-10-17HARBIN VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES (CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER HARBIN BRANCH CENTER)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511156247.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing technologies cannot effectively block and eliminate avian leukosis virus (ALV) infection. Traditional purification measures cannot completely block and eliminate it. Furthermore, ALV has the characteristic of integrating into the host genome, resulting in a major technical bottleneck in the prevention and control of avian leukosis.

Method used

Using CRISPR/Cas9 technology to target the CHD2 gene, sgRNA was designed to knock out or silence CHD2 gene expression, and a DF-1 cell line with CHD2 gene knockout was constructed. The replication of avian leukosis virus was inhibited by knocking out the CHD2 gene.

Benefits of technology

It achieves broad-spectrum inhibition of different ALV subpopulations, providing a novel and efficient antiviral technology that can completely knock out the CHD2 gene in host cells and inhibit the replication of avian leukosis virus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796285A_ABST
    Figure CN120796285A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a CHD2 gene as a target spot in inhibition of replication of an avian leukosis virus (ALV), and further discloses a construction method of a CHD2 gene knockout DF-1 cell line and an application of the CHD2 gene knockout DF-1 cell line in inhibition of replication of different subgroups of ALV. The CHD2 gene knockout DF-1 cell line is successfully constructed through a CRISPR / Cas9 gene editing technology, and experimental results show that the cell line can significantly inhibit replication of ALV of different subgroups. The invention proposes that the replication of different subgroups of ALVs can be effectively inhibited by inhibiting the expression of the CHD2 gene or the encoded protein thereof for the first time. The discovery provides a technical means for carrying out anti-ALV infection disease-resistant breeding work by taking the CHD2 gene as a target spot in the future, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a new target for inhibiting avian leukosis virus replication, in particular to the application of CHD2 gene as a target in inhibiting avian leukosis virus replication. The present application belongs to the technical field of biological gene engineering. BACKGROUND

[0002] China is a large country in the world for raising poultry. As an important breed disease of poultry, avian leukosis seriously threatens the safety of breed source of poultry. The pathogen of avian leukosis is avian leukosis virus (ALV), which is mainly vertically transmitted. At present, there is no effective drug and vaccine for prevention and control, and the prevention and control is mainly carried out by purifying the breeding chicken population. Since ALV has the characteristics of latent infection, the breeding chicken population needs to be detected for many times and continuously purified. However, once the purification is stopped, the positive rate of ALV in the breeding chicken population will rebound. In addition, since ALV has the characteristics of integration into the host genome, once infected, it cannot be cleared and will be infected for life. Therefore, the traditional purification measures cannot completely block and clear the infection of ALV, and the prevention and control of avian leukosis still faces a major technical bottleneck. At present, it is urgent to research new avian leukosis prevention and control technology. The best prevention and control and eradication method for avian leukosis and other breed diseases is to block the infection of the virus from the source, to take the key host factors dependent on virus replication as the target from the perspective of the host, to establish new anti-virus technology, and to make the chicken population form a natural protective barrier.

[0003] Chromatin-remodeling enzymes DNA-binding protein (CHD) family proteins are chromatin regulators, including 9 members. In addition to the SNF2-related helicase / ATPase domain located in the central position, there are two tandem chromatin domains located in the N-terminal region of the protein. According to the differences of other CHD domains, it is divided into three families of subgroups. The first family subgroup includes CHD1 and CHD2; the second family subgroup includes CHD3, CHD4 and CHD5; the third family subgroup includes CHD6, CHD7, CHD8 and CHD9. CHD family proteins use the energy of ATP hydrolysis to move, eject or recombine nucleosomes, thereby controlling the access of regulatory proteins to DNA or histones. CHD2 has the functional domain typical of CHD family. At present, the research on CHD2 is less, and the research on CHD1 which belongs to the first subgroup with CHD2 is relatively more. CHD1 is the first DNA-binding protein found in the CHD family. CHD1 is located in the transcriptionally active region and interacts with the transcription elongation complex including PAF and FACT complex. The chromatin domain of human CHD1 can specifically bind to methylated H3K4, which indicates the possible mechanism of the protein targeting the active transcription site. Studies have shown that CHD1, as a transcription inhibitor of HIV, plays an important role in maintaining HIV latent infection. However, recent studies have shown that CHD1 and CHD2 are both positive regulators of HIV transcription. At present, as an important DNA-binding protein, the function of CHD family proteins in regulating viral replication has not been fully analyzed.

[0004] Therefore, the present application takes CHD2 as the research object, studies its regulation on ALV replication, analyzes its molecular mechanism of regulating ALV replication, and expects to provide technical means for further screening of antiviral target and establishing new efficient antiviral technology. SUMMARY

[0005] The present application aims to provide a new target for inhibiting avian leukemia virus replication.

[0006] In order to achieve the above purpose, the following technical means are adopted in the present application.

[0007] The present application provides the application of the reagent or drug designed with CHD2 gene as the target in the preparation of the drug for inhibiting avian leukemia virus replication. The reagent or drug designed with CHD2 gene as the target can knock out or silence the expression of CHD2 gene.

[0008] Preferably, the NCBI Gene ID of the CHD2 gene is 415507.

[0009] Preferably, the reagent or drug designed to target the CHD2 gene is sgRNA capable of knocking out the CHD2 gene.

[0010] Preferably, the sgRNA sequence is shown as SEQ ID NO: 1.

[0011] Further, the present application also provides a method for constructing a CHD2 gene knockout DF-1 cell line, comprising the following steps: (1) Vector construction According to the CHD2 gene sequence in NCBI, the CHD2 knockout sgRNA sequence is designed, the sequence is shown as SEQ ID NO: 1, which is inserted into the pMD-18T vector to construct the CHD2-sgRNA knockout plasmid. (2) Construction and screening of CHD2 gene knockout DF-1 cell line The pMJ920 plasmid and the CHD2-sgRNA plasmid are co-transfected into DF-1 cells, and after 48 hours, the cells with GFP fluorescence are screened using a flow cytometry sorter, and then they are inoculated into a 96-well plate, and after 7 days, the monoclonal cell line is observed and cultured under a light microscope, the genome of the cell line is extracted using a genome extraction kit, and PCR amplification is performed using identification primers for preliminary identification, and further sequencing identification is performed to determine whether the CHD2 gene is effectively knocked out, thereby obtaining the CHD2 gene knockout DF-1 cell line.

[0012] In the construction method, the identification primers are preferably: CHD2-JD-F: GCAACGAAGCAGAGCGTAT; CHD2-JD-R: ACACAAACCAAATGGCCAGC.

[0013] The CHD2 gene knockout DF-1 cell line constructed according to the method is also within the protection scope of the present application.

[0014] Further, the present application also provides the application of the CHD2 gene knockout DF-1 cell line in inhibiting the replication of avian leukemia virus.

[0015] And the application of the CHD2 gene knockout cell line in animal breeding against avian leukemia virus.

[0016] Preferably, the avian leukemia virus is subgroup A avian leukemia virus, subgroup K avian leukemia virus, or subgroup J avian leukemia virus.

[0017] Compared with the prior art, the present application has the following advantages: 1. The application first finds that by knocking out the CHD2 gene of a host cell, the replication of different subgroups of ALV can be inhibited, which can be used as a target to prepare a drug for inhibiting the replication of avian leukemia virus.

[0018] 2. The application provides an sgRNA targeting the CHD2 gene, which can specifically target the CHD2 gene, and the complete knockout of the CHD2 gene in a host cell can be realized by combining a CRISPR / Cas9 technology. 3. The application provides a method for constructing a CHD2 gene silencing or knockout by transfecting the sgRNA recombinant plasmid into a host cell through a CRISPR / Cas9 gene editing technology, and by silencing the CHD2 gene, a cell line with the ability to inhibit the replication of different subgroups of avian leukemia virus is obtained, which can be used for animal breeding against different subgroups of avian leukemia virus. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Construction and identification of CHD2 knockout cell line; Figure 2 Fluorescent quantitative PCR detection of the effect of CHD2 knockout on ALV-J replication; Figure 3 Western blot detection of the effect of CHD2 knockout on ALV-J replication; Figure 4 Fluorescent quantitative PCR detection of the effect of CHD2 knockout on different subgroups of ALV replication. DETAILED DESCRIPTION

[0020] The experimental methods of the application are described in detail in the following examples in order to more clearly illustrate the technical features and implementation steps thereof. Those skilled in the art should understand that the examples are only typical examples of the application and do not constitute any limitation on the scope of the application. Technical details can be adjusted or replaced without departing from the spirit and scope of the application, and these adjustments and replacements are all within the protection scope of the application.

[0021] Example 1 Construction and identification of CHD2 knockout cell line Materials and methods 1. Main experimental materials DF-1 cells, ALV-A, ALV-K and ALV-J were preserved in the laboratory; anti-ALV p27 mouse MAb was prepared in the laboratory; TIANamp Genomic DNA extraction kit was purchased from TIANGEN company; pMD-18T vector was purchased from TARAKA company; RNAiso Plus was purchased from Dalian Baobioengineering Co., Ltd. (Takara); NP40 lysis buffer was purchased from Shanghai Biyun Tian company; THUNDERBIRD™ SYBR® Qpcr Mix was purchased from TOYOBO company; reverse transcription reagent was purchased from Vazyme company; 5×SDS PAGE loading buffer was purchased from Solabio; mouse anti-β-actin monoclonal antibody was purchased from Sigma company; pMJ920 plasmid was preserved in the laboratory.

[0022] 2. Vector construction According to the sequence of CHD2 gene (Gene ID: 415507) in NCBI (https: / / www.ncbi.nlm.nih.gov / ), the template sequence (AGCCAGTCTGAGAGCGAGCAG, SEQ ID NO. 1) of CHD2 knockout guide RNA (sgRNA) was designed using E-CRISP online software (http: / / www.e-crisp.org / E-CRISP / designcris / html), inserted into pMD-18T vector, and CHD2-sgRNA knockout plasmid was constructed.

[0023] 3. Construction and screening of CHD2 KO cell line The pMJ920 plasmid and CHD2-sgRNA plasmid were co-transfected into DF-1 cells (chick embryo fibroblast cell line), and after 48 h of culture, cells with GFP fluorescence were screened using a flow cytometry sorter. According to the dilution ratio of 5 cells per well, they were inoculated into a 96-well plate, and after 7 days, the monoclonal cell line was observed and expanded under a light microscope, and the obtained monoclonal cell line was named CHD2KO. The genomic DNA of CHD2KO cell line was extracted using genomic extraction kit, and the online website https: / / www.primer3plus.com / was used to design the identification primers CHD2-JD-F (GCAACGAAGCAGAGCGTATG, SEQ ID NO. 2) and CHD2-JD-R (ACACAAACCAAATGGCCAGC, SEQ ID NO. 3). Through PCR amplification, preliminary identification was carried out, and further sequencing identification was carried out to determine whether the CHD2 gene was effectively knocked out.

[0024] 4. Virus infection experiment Each CHD2 KO cell line and wild-type DF-1 cell line was plated at a density of 5 x 10 5 cells / well into a 12-well plate, and 16 h later, each was infected with ALV-A, ALV-K, and ALV-J strains at a dose of 0.1 MOI, with three parallel wells for each.

[0025] 5. Real-time fluorescent quantitative PCR detection DF-1 cells at 24 h, 36 h, 48 h, and 60 h after infection were collected with 200 μL PBS and total RNA was extracted using the Trizol lysis method. Viral RNA was reverse transcribed using a Vazyme reverse transcription kit. First, 1 μg of viral RNA was mixed with 4 μL of 4 x gDNA wiper Mix and diluted to 16 μL with RNase-free ddH2O, and the genomic DNA was removed at 42°C for 2 min. Then, 4 μL of 5 x Hiscnipt II qRT Supermix II reverse transcriptase was added to the tube, mixed well, and reverse transcribed at 50°C for 15 min and 85°C for 5 s. Finally, cDNA was obtained. Using cDNA as a template and β-actin as an internal reference gene, the mRNA level of ALV was relatively quantified using THUNDERBIRD™ SYBR® Qpcr Mix fluorescent quantitative enzyme according to the operation process of 95°C for 30 s; 95°C for 10 s, 60°C for 25 s, 40 cycles. Fluorescent quantitative PCR detection (primers: RT-ALV-F: GCAGCGAGATGCGAAGAT, SEQ ID NO. 4; RT-ALV-R: CCGCCAGGGAAGGATACA, SEQ ID NO. 5; RT-actin-F: CAACACAGTGCTGTCTGGTGGTA, SEQ ID NO. 6; RT-actin-R: ATCGTACTCCTGCTTGCTGATCC, SEQ ID NO. 7).

[0026] 6. Western Blot detection Cells at 60 h post-infection were lysed with 100 μL NP40 cell lysis solution, lysed on ice for 30 min, then 25 μL 5x loading protein loading buffer was added, boiled at 100°C for 15 min, 10 μl was taken for SDS-PAGE gel electrophoresis, then the protein was transferred to NC membrane, 5% skim milk was blocked for 1 h. After incubation with mouse anti-ALV p27 antibody and mouse anti-β-actin as primary antibody at room temperature for 1 h, the NC membrane was washed 5 times with 1x PBST, then goat anti-mouse IgG was used as secondary antibody, incubated at room temperature for 1 h, then washed 5 times with 1x PBST, and imaged using near-infrared fluorescence scanning imaging system.

[0027] Results 1. Construction and screening of CHD2 KO cell line pMJ920 and CHD2-sgRNA were co-transfected into DF-1 cells, and 48 h after transfection, GFP fluorescence signal could be observed by inverted fluorescence microscope, then cells with GFP fluorescence were screened using flow cytometry sorting system, and after expansion culture, monoclonal screening and identification were carried out. Genomic DNA was extracted from the screened monoclonal cell line, the CHD2 sgRNA targeting region was amplified by PCR and sequenced. The sequencing results showed that CHD2 gene had 1 base insertion mutation, indicating that the gene was effectively knocked out, and CHD2 gene knockout cell line was successfully constructed. Figure 1 ).

[0028] 2. Knockout of CHD2 inhibits ALV-J replication To explore the effect of CHD2 knockout on ALV-J replication, wild-type DF-1 cell line and CHD2 KO cell line were infected with ALV-J-GFP, and cells were collected at 24 h, 36 h, 48 h and 60 h post-infection, total RNA was extracted and RT-qPCR experiment was carried out after reverse transcription. The results showed that compared with wild-type cell line, the viral load of ALV-J in CHD2 KO cells was significantly reduced ( Figure 2 ), indicating that knockout of CHD2 can effectively inhibit ALV-J replication. To further verify the results, cells were collected at 60 h post-infection, and Western blot experiment was carried out to detect the expression of viral structural protein p27. The results showed that after CHD2 knockout, the level of p27 protein of the virus decreased obviously ( Figure 3 ), indicating that compared with wild-type cell line, knockout of CHD2 can effectively inhibit ALV-J replication.

[0029] 3. Knockout of CHD2 inhibits ALV-A and ALV-K replication To detect the broad-spectrum antiviral effect of CHD2 gene knockout on the replication of different subgroups of ALV, wild-type DF-1 cell lines and CHD2KO cell lines were infected with ALV-A-GFP and ALV-K-GFP, respectively, and the cells were collected 60 h after infection. Total RNA was extracted and subjected to RT-qPCR analysis after reverse transcription. The results showed that the viral load of ALV-A and ALV-K in CHD2KO cells was significantly reduced compared with wild-type cell lines Figure 4 ). This result is consistent with the previous research data of ALV-J, which together indicates that CHD2 gene knockout can broadly inhibit the replication of various ALVs including subgroups A, K and J.

Claims

1. Use of a reagent or drug designed with the CHD2 gene as a target in the preparation of a drug for inhibiting the replication of avian leukosis virus (ALV), characterized in that: The reagent or drug designed with the CHD2 gene as the target can knock out or silence the expression of the CHD2 gene.

2. The use according to claim 1, characterized in that The NCBI Gene ID of the CHD2 gene is 415507.

3. The use according to claim 1, characterized in that The reagent or drug designed with the CHD2 gene as the target is an sgRNA capable of knocking out the CHD2 gene.

4. The use according to claim 3, characterized in that The sgRNA sequence is shown in SEQ ID NO:

1.

5. A method for constructing a CHD2 gene knockout DF-1 cell line, characterized in that: The following steps are involved: (1) Vector construction Based on the CHD2 gene sequence in NCBI, the CHD2 gene knockout sgRNA sequence was designed, and its sequence is shown in SEQ ID NO:

1. It was inserted into the pMD-18T vector to construct the CHD2-sgRNA knockout plasmid; (2) Construction and screening of CHD2 gene knockout DF-1 cell lines The pMJ920 plasmid and CHD2-sgRNA plasmid were co-transfected into DF-1 cells. After 48 hours, cells with GFP fluorescence were selected using a flow cytometer and plated into 96-well plates. Seven days later, monoclonal cell lines were screened under an optical microscope and expanded in culture. The genome of the cell line was extracted using a genome extraction kit, and preliminary identification was performed by PCR amplification using identification primers. Further sequencing was performed to determine whether the CHD2 gene was effectively knocked out, thereby obtaining a CHD2 gene-knockout DF-1 cell line.

6. The construction method according to claim 5, wherein: The identification primers are: 。 7. The CHD2 gene knockout DF-1 cell line constructed according to the method of claim 5 or 6.

8. Use of the CHD2 gene knockout DF-1 cell line according to claim 7 in inhibiting the replication of avian leukosis virus.

9. Use of the CHD2 gene knockout DF-1 cell line according to claim 7 in animal breeding for resistance to avian leukosis virus.

10. The use according to claim 8 or 9, characterized in that The avian leukosis virus is A subgroup avian leukosis virus, K subgroup avian leukosis virus or J subgroup avian leukosis virus.