System for efficiently detecting transcriptional activity of bidirectional promoter as well as construction method and application of system

Abstract

Based on three key enzymes of a betacyanin synthetic route, a plant expression vector tool capable of simply, conveniently and quickly detecting the transcriptional activity of the bidirectional promoter at high throughput is developed. By utilizing the tool provided by the invention, the bidirectional transcriptional activity can be judged by only constructing the candidate DNA sequence to the specified position of the vector and observing whether red color appears in the tissue through transient expression or stable genetic transformation, so that the method is simple, convenient and efficient.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and particularly relates to a system for efficiently detecting bidirectional promoter transcription activity and a construction method and application thereof. BACKGROUND

[0002] A bidirectional promoter refers to a DNA sequence between the transcription initiation sites of "head-to-head" type genes in a genome. A traditional promoter can only initiate the expression of a gene on one side, while a bidirectional promoter can initiate the expression of genes on both sides, and has important application value in the field of genetic engineering. According to genome and transcriptome data, a large number of DNA sequences with bidirectional transcription activity in organisms can be predicted, but the real transcription activity of these sequences needs to be verified.

[0003] In the traditional method, researchers usually adopt two methods: (1) single-directional reporter gene method. The forward sequence and reverse sequence of the promoter are respectively constructed upstream of a certain reporter gene, and it is observed whether both sequences can make the reporter signal appear in the transformed tissue through transient expression or genetic transformation; (2) bidirectional reporter gene method. Different reporter genes are constructed at both ends of the sequence, and then it is observed whether both reporter signals can appear. Commonly used reporter substances include fluorescent proteins (such as green fluorescent protein, GFP) and β-glucuronidase (β-Glucuronidase, GUS). However, the detection process of these two signal substances is time-consuming and laborious, and the experimental cost is high. The detection of the fluorescent protein signal needs to use a special light source to irradiate the transformed tissue to excite its fluorescent signal, and the commonly used instrument is a laser confocal microscope. The GUS signal detection process involves many toxic and expensive reagents, and needs to go through many steps such as staining, decolorization and microscope photography. The detection steps of the GFP signal are: (1) fix the tissue on a glass slide and place it under a laser confocal microscope; (2) select 488 nm wavelength excitation light to irradiate the tissue, and observe whether green fluorescent signal appears in the microscope; (3) use a special camera and professional software for focusing and photographing. The detection steps of the GUS signal are: (1) configure GUS dye solution (50 mM pH 7.0 potassium phosphate buffer, 10 mM Na2-EDTA, 0.1% Triton X-100, 1 mg / mL X-Gluc, 100 ug / mL chloramphenicol, 1 mM potassium ferricyanide, 1 mM potassium ferrocyanide, 20% methanol); (2) incubate the tissue in the GUS dye solution at 37°C for 5-10 hours and then decolorize with 70% ethanol; (3) observe and photograph under a microscope. It can be found that both methods have the disadvantages of complicated process, high cost and environmental pollution in vector construction and signal detection, and are not suitable for large-scale detection of the transcription activity of bidirectional promoters.

[0004] Betacyanin is a purple-red plant pigment synthesized from the ubiquitous tyrosine in cells. Tyrosine is converted into betacyanin, a visible red pigment, by the enzymes cytochrome P450 (CYP76AD1, AD1), L-DOPA4,5-dioxygenase (DODA), and glycosyltransferase (GT). Summary of the Invention

[0005] The purpose of the present invention is to create a new gene expression vector that allows researchers to quickly and easily detect whether a candidate DNA sequence has bidirectional transcription activity.

[0006] The present invention provides a vector for detecting the transcriptional activity of a bidirectional promoter, the vector comprising a CYP76AD1 gene, a DODA gene and a GT gene, and is characterized in that: the CYP76AD1 gene and the DODA gene are connected by 2A to form CYP76AD1-2A-DODA; the CYP76AD1-2A-DODA genes are constructed in the same direction as the vector, and the GT gene is constructed in the opposite direction to that of the CYP76AD1-2A-DODA.

[0007] Further preferably, the CYP76AD1-2A-DODA gene and the GT gene are connected in a "head-to-head" form.

[0008] Furthermore, an enzyme cleavage site is added between the start codons of the CYP76AD1 and GT genes.

[0009] Furthermore, the start codons of the CYP76AD1 gene and the GT gene are ATG; two enzyme cleavage sites are inserted between the start codons ATG of the CYP76AD1 and GT. BamHI and XbaI.

[0010] Furthermore, the CYP76AD1 gene, DODA gene and GT gene in the vector do not include promoters on both sides; and / or, the CYP76AD1 gene, DODA gene and GT gene in the vector are flanked by terminators; preferably, the terminators are HSP terminators and / or NOS terminators; preferably, one side of the GT gene is connected to the terminator HSPterminator, and one side of the DODA gene is connected to the terminator NOS terminator.

[0011] Preferably, the 2A nucleic acid sequence is GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT, and the encoded amino acid sequence is GSGATNFSLLKQAGDVEENPGP.

[0012] Furthermore: the vector is a binary plant Agrobacterium expression vector; preferably, the binary plant Agrobacterium expression vector is pBI121, pHNR or pCAMBIA2300; more preferably, the binary plant Agrobacterium expression vector is pBI121.

[0013] The present invention also provides a process for constructing a vector for detecting the transcriptional activity of a bidirectional promoter, comprising the following steps: (1) Using pBI121 as the backbone vector, double enzyme digestion was performed using SacI and HindIII; (2) From 35S:RUBY Amplification of plasmids CYP76AD1-2A-DODA sequence sum GT-HSP18.2 sequence; (3) The above step (2) CYP76AD1-2A-DODA sequence sum GT-HSP18.2 Sequences were constructed head-to-head to linearize pBI121 In the carrier, the CYP76AD1 Insert two restriction sites between the start codons ATG and GT BamHI and XbaI, That’s it; Preferably, the CYP76AD1-2A-DODA The primers for the sequences are as follows: Forward primer ADF: GACCATGATTACGCCAAGCTTCTTATCTTTAATCATATTCCATAGTCCATACC, Reverse primer ADR: GGTCGCATGATCCATGGATCCTCTAGAATGACCGCCATCAAGATGAACA; The GT-HSP18.2 The sequence primers are as follows: Forward primer GTF: CTTGATGGCGGTCATTCTAGAGGATCCATGGATCATGCGACCCTCG, Reverse primer GTR: CGATCGGGGAAATTCGAGCTCCTAGGCGGAGGTGAACTTGTAGGA.

[0014] The application provides a system for detecting bidirectional promoter transcription activity, comprising the vector and a bidirectional promoter DNA sequence to be detected, wherein the bidirectional promoter DNA sequence to be detected is inserted into the restriction enzyme site of the vector.

[0015] Further, the restriction enzyme site of the vector is XbaI and / or BamHI, and the bidirectional promoter DNA sequence to be detected is CaMV 35S promoter.

[0016] The following is the explanation and description of the nomenclature of the application: The nucleotide sequence of the CYP76AD1 gene, the nucleotide sequence of the DODA gene, the nucleotide sequence of the GT gene, the nucleotide sequence of the 2A gene and the HSP18.2 nucleotide sequence in the application are referred to the journal Horticulture Research, He et al., (2020) 7:152.

[0017] Obviously, according to the above content of the application, according to the ordinary technical knowledge and common means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the application.

[0018] The beneficial technical effects of the application are: 1. Betalain is a purple-red plant pigment, and its synthesis substrate is tyrosine which is ubiquitous in cells. Tyrosine can be converted into red pigment visible to the naked eye under the action of cytochrome P450 (CYP76AD1, hereinafter referred to as AD1), L-DOPA 4,5-dioxygenase (DODA) and glycosyltransferase (GT). Based on the three enzymes in the above synthesis pathway, a new reporter gene system, RUBY, is developed. Without special instruments, chemicals and complex processing steps, whether there is RUBY signal can be determined by observing whether red pigment appears in the transformed tissue with the naked eye.

[0019] 2. The application also develops a plant expression vector tool capable of simple, rapid and high-throughput detection of bidirectional promoter transcription activity based on the three key enzymes in the above synthesis pathway. Using the tool of the application, researchers only need to construct the candidate DNA sequence to the designated position of the vector, and observe whether red appears in the tissue through transient expression or stable genetic transformation. If red appears, it is considered that the sequence has bidirectional transcription activity, and if red does not appear, it is considered that the sequence does not have bidirectional transcription activity. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 : Schematic diagram of the construction process of the vector RUBY-BD; Figure 2 : Tobacco leaf transient expression diagram. DETAILED DESCRIPTION

[0021] The present application is further illustrated by the following examples, but is not limited thereto.

[0022] Example 1 Construction procedure (1) Using pBI121 (GenBank: AF485783; Figure 1 ) as the backbone vector, double enzyme digestion was performed using SacI (Thermo Scientific, cat. FD1133) and HindIII (Thermo Scientific, cat. FD0504).

[0023] The enzyme digestion step was as follows: 50 microliter system, Water (nuclease-free), 30 microliter; 10x FastDigest or 10x FastDigest Green Buffer, 5 microliter; plasmid, 10 microliter (5 microliter); FastDigest enzyme 1 microliter, FastDigest enzyme 1 microliter, 37°C, 30 minutes, 65°C, 5 minutes. SacI HindIII (2) The sequences of (Addgene: #160908) were amplified from the plasmid

[0024] (Forward primer ADF: GATCGGATCCATGGATCATGCGACCCTCG, reverse primer ADR: GAGCTCCTAGGCGGAGGTGAACTTGTAGGA; the underlined part is the homologous recombination arm, and the non-underlined part is the gene-specific primer) and 35S:RUBY (Forward primer GTF: CTTGATGGCGGTCATTCTAGAGGATCCATGGATCATGCGACCCTCG, reverse primer GTR: GATCGGATCCATGGATCATGCGACCCTCG; the underlined part is the homologous recombination arm, and the non-underlined part is the gene-specific primer) sequences. AD1-2A-DODA GAC CATGATTACGCC GGTCGCATGATCC AT GT-HSP18.2 CGATCGGGGAAATTC

[0025] ​​​​​Amplification step: 50 μL system, 2 x Rapid Taq Master Mix 25 μL; Primer 1 (10 μM), 2 μL; Primer 2 (10 μM), 2 μL; Template DNA, 0.1-10 ng (2 μL); ddH2O, To 50 μL (19 μL); PCR program: 95°C, 3 min; 95°C, 15 s, 58°C, 15 s, 72°C, 180 s, 30-35 cycles; 72°C, 5 min.

[0026] (3) Homologous recombination was performed by using DLV201 Trelief Seamless Cloning Kit (Dalgen, cat. DLV201-20) to construct two sequences in the form of "head-to-head" into linearized pBI121 vector to generate a new vector RUBY-BD ( Figure 1 ).

[0027] Recombination reaction step: linearized vector, 2 μL; insert fragment 1, 1 μL; insert fragment 2, 1 μL; 2 x Seamless Cloning Mix, 5 μL; ddH2O, Up to 10 μL (1 μL); 50°C, 15 min.

[0028] Example 2 Vector construction Linearized plasmid was generated by XbaI and BamHI double digestion or single digestion of RUBY-BD, and candidate DNA sequence was inserted into the enzyme digestion site to construct the vector.

[0029] Construction of RUBY-BD (35S+ / -; 35S+; 35S-) vector: two groups of primers were designed according to CaMV 35S promoter in pBI121 (GenBank: AF485783): 35S+F: GGCGGTCATGGATCC TCGATAGTCATTTAGGTTGGTGAGACTTTTCAACAAAGGGTAATATCC, 35S+R: GGTCGCATGATCCAT TGTTCTCTCCAAATGAAATGAACTTCCT.

[0030] 35S-F: CTTGATGGCGGTCAT TGTTCTCTCCAAATGAAATGAACTTCCT.

[0031] 35S-R: CTAAATGACTATCGATGAGACTTTTCAACAAAGGGTAATATCCG.

[0032] Amplification was performed using 2× Rapid Taq Master Mix (Vazyme, cat. P222-01).

[0033] The fragment amplified using primers 35S+F / R was ligated with the above-mentioned RUBY-BD linearized plasmid to construct the RUBY-BD (35S+) vector. The fragment amplified using primers 35S-F / R was ligated with the above-mentioned RUBY-BD linearized plasmid to construct the RUBY-BD (35S-) vector. The RUBY-BD (35S+ / -) vector was constructed by ligating both amplified fragments simultaneously with the RUBY-BD linearized plasmid. Figure 2 Transform the above vector into biological tissue using the same method as above. After a certain period of time, observe the tissue to see if red pigment appears. If so, it indicates that the sequence has bidirectional transcriptional activity; otherwise, it does not.

[0034] Agrobacterium transformation Competent Agrobacterium (Coolaber, cat. CC405) stored at -80°C was partially thawed at room temperature (in an ice-water mixture), then placed on ice. Add 1 μl of plasmid per 50 μl of Agrobacterium culture, mix thoroughly with a pipette, place on ice for 5 minutes, snap-freeze in liquid nitrogen for 5 minutes, and then water-bath at 37°C for 5 minutes. Add 700 μl of LB liquid medium and incubate at 28°C with shaking for 5 hours. Centrifuge at 5,000 rpm for 1 minute, decant the supernatant until approximately 100 μl remain, and resuspend the cells. Spread the culture onto solid LB medium (50 mg / L Kan, 50 mg / L Rif) and incubate at 28°C with an inverted plate for 48 hours. Pick a single colony and add it to 600 μl of liquid LB medium (50 mg / L Kan, 50 mg / L Rif) and incubate at 28°C with shaking for 5 hours. Isolate the plasmid and perform PCR analysis. Agrobacterium with the correct band is considered a successfully transformed sample.

[0035] Transient expression in tobacco leaves Use Nicotiana benthamiana ( Nicotiana benthamianaAs a transient transformation plant, vermiculite and nutrient soil are mixed in a ratio of 1:1 and then loaded into a planting box, accounting for about 3 / 4 of the volume of the planting box, and the vermiculite and nutrient soil mixture is irrigated with pure water; select full Nicotiana benthamiana seeds and evenly spread them in the planting box, cover the planting box with a layer of transparent film to keep the moisture, and place it in a plant room with 25±℃ 16 hours of light and 8 hours of darkness; after a week, the Nicotiana benthamiana grows two true leaves, and the Nicotiana benthamiana needs to be transplanted, two plants are transplanted in each planting box, and after transplantation, the Nicotiana benthamiana grows for one month to 4-5 true leaves; two days before injection, water is needed to be sufficient, and thick and green Nicotiana benthamiana plants with good growth are selected; the agrobacterium liquid is cultured to OD600=0.4-0.6; the cultured liquid is centrifuged at 4000r / min for 10 minutes, then taken out, the supernatant is discarded, and the bottom precipitate is left, the tobacco buffer is used to resuspend the precipitate, and the OD600 of the agrobacterium carrying different vectors is all 0.6; first, use a sterile injection needle to make a needle eye on the front of the Nicotiana benthamiana leaf, then use a syringe to suck the resuspended liquid; when injecting, cover the needle eye on the front of the leaf with the tip of the finger, and inject the resuspended liquid into the leaf from the back of the tobacco leaf; different syringes are needed for injecting different resuspended liquids to prevent cross contamination of the liquid; after injection, the injected tobacco is placed in a plant room with 25℃ 16 hours of light and 8 hours of darkness for 24-48 hours, and during this process, the color change of the tobacco leaf can be observed with the naked eye.

[0036] See Figure 2 From left to right: (1) positive control, 35S promoter drives RUBY to express in tobacco leaves transiently, and red pigment can be observed with the naked eye; (2) RUBY-BD, no sequence is inserted between the start codons of AD1 and GT, and no red color appears in the tobacco leaves; (3) RUBY-BD(35S+ / -), two 35S promoters in a "head-to-head" arrangement are inserted between the start codons of AD1 and GT, and the tobacco leaves appear red, indicating that the vector can be used to detect bidirectional promoter activity; (4) RUBY-BD(35S+), a forward 35S promoter is inserted between the start codons of AD1 and GT, and the tobacco leaves do not appear red, indicating that a unidirectional promoter cannot cause red pigment to be produced; (5) RUBY-BD(35S-), a reverse 35S promoter is inserted between the start codons of AD1 and GT, and the tobacco leaves do not appear red, similar to (4), also indicating that a unidirectional promoter cannot cause red pigment to be produced.

[0037] The above merely describes preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto, any changes or replacements within the technical scope disclosed by the present application, which can be easily thought by those skilled in the art, should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. A vector for detecting the transcriptional activity of a bidirectional promoter, comprising the CYP76AD1 gene, the DODA gene, and the GT gene, characterized in that: The CYP76AD1 gene and the DODA gene are connected by 2A as CYP76AD1-2A-DODA; the CYP76AD1-2A-DODA genes are constructed in the same direction as the vector, and the GT gene is constructed in the opposite direction to the CYP76AD1-2A-DODA.

2. The carrier according to claim 1, characterized in that: The CYP76AD1-2A-DODA gene and the GT gene are connected in a "head-to-head" form.

3. The carrier according to claim 1, characterized in that: An enzyme cleavage site is added between the start codons of the CYP76AD1 and GT genes.

4. The carrier according to claim 3, characterized in that: The start codons of the CYP76AD1 gene and the GT gene are ATG; two enzyme cleavage sites are inserted between the start codons ATG of the CYP76AD1 and GT BamHI and XbaI.

5. The carrier according to claim 1, characterized in that: The CYP76AD1 gene, DODA gene and GT gene in the vector do not include promoters on both sides; and / or, the CYP76AD1 gene, DODA gene and GT gene in the vector are flanked by terminators; preferably, the terminators are HSP terminators and / or NOS terminators; preferably, one side of the GT gene is connected to the terminator HSP terminator, and one side of the DODA gene is connected to the terminator NOS terminator.

6. The carrier according to claim 5, characterized in that: The 2A nucleic acid sequence is GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT, and the encoded amino acid sequence is GSGATNFSLLKQAGDVEENPGP.

7. The carrier according to claim 6, characterized in that: The vector is a binary plant Agrobacterium expression vector; preferably, the binary plant Agrobacterium expression vector is pBI121, pHNR or pCAMBIA2300; more preferably, the binary plant Agrobacterium expression vector is pBI121.

8. A process for constructing a vector for detecting the transcriptional activity of a bidirectional promoter according to any one of claims 1 to 7, The following steps are included: (1) Using pBI121 as the backbone vector, double enzyme digestion was performed using SacI and HindIII; (2) From 35S:RUBY Amplification of plasmids CYP76AD1-2A-DODA sequence sum GT-HSP18.2 sequence; (3) The above step (2) CYP76AD1-2A-DODA sequence sum GT-HSP18.2 Sequences were constructed head-to-head to linearize pBI121 In the carrier, the CYP76AD1 Insert two restriction sites between the start codons ATG and GT BamHI and XbaI, That is, Preferably, the CYP76AD1-2A-DODA The primers for the sequences are as follows: Forward primer ADF: GACCATGATTACGCCAAGCTTCTTATCTTTAATCATATTCCATAGTCCATACC, Reverse primer ADR: GGTCGCATGATCCATGGATCCTCTAGAATGACCGCCATCAAGATGAACA; The GT-HSP18.2 The sequence primers are as follows: Forward primer GTF: CTTGATGGCGGTCATTCTAGAGGATCCATGGATCATGCGACCCTCG, Reverse primer GTR: CGATCGGGGAAATTCGAGCTCCTAGGCGGAGGTGAACTTGTAGGA.

9. A system for detecting the transcriptional activity of a bidirectional promoter, characterized in that: The method comprises the vector according to any one of claims 1 to 8, and a bidirectional promoter DNA sequence to be detected, wherein the bidirectional promoter DNA sequence to be detected is removed into the enzyme cutting site of the vector.

10. The system according to claim 9, characterized in that: The restriction enzyme cutting sites of the vector are XbaI and / or BamHI, and the bidirectional promoter DNA sequence to be detected is the CaMV 35S promoter.

Images