Visual rapid detection method for solenopsis invicta

Abstract

The invention discloses a visualized rapid detection method for solenopsis invicta, and relates to the technical field of biological detection, and the technical key points are as follows: a rapid molecular detection method for invading species solenopsis invicta is developed on the basis of a loop-mediated isothermal amplification technology, mitochondrial DNA (mitochondrial DNA, mtDNA) cytochrome b (Cytochrome b, Cytb) genes of the solenopsis invicta are taken as targets, and the primers are used for detecting the mitochondrial DNA of the solenopsis invicta and the cytochrome b of the solenopsis invicta; the method comprises the following steps: designing and screening specific LAMP primers (F3 / B3, FIP / BIP); the method can accurately distinguish the solenopsis invicta from nine related species of solenopsis invicta, breaks through the dependence of traditional molecular detection on professional equipment and complex operation, and provides a high-sensitivity and high-specificity field detection tool for solenopsis invicta invasion monitoring and port quarantine.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, and particularly relates to a visual rapid detection method for Solenopsis invicta. BACKGROUND

[0002] As one of the 100 most threatening invasive species identified by the International Union for Conservation of Nature (IUCN), the research and control of Solenopsis invicta have important practical significance. Further research shows that based on the relationship model between the number of invaded counties and the length of invasion time of Solenopsis invicta, the number of invaded counties in China will still be in a rapid growth stage in the next 10 years. According to the prediction of MaxEnt niche model, if no intervention measures are taken, the suitable area will cover more than 90% of the area south of the Yangtze River in China by 2030, including important agricultural production areas such as Sichuan Basin and Jianghan Plain.

[0003] Molecular biology detection of Solenopsis invicta has been carried out in China. Chen Yan et al. designed specific primers and probes based on the COI gene of the genus Solenopsis, and distinguished Solenopsis invicta from Solenopsis geminata by real-time fluorescence molecular detection technology. Zeng Ling et al. used Cytb gene sequences to establish a PCR-RFLP method to quickly identify Solenopsis invicta and Solenopsis geminata. In 2009, Chen Yan et al. designed specific primers to effectively distinguish Solenopsis invicta from Solenopsis richteri through Cytb gene analysis. In addition, with the development of new technologies, the detection of Solenopsis invicta is also constantly innovating. Valles et al. developed a lateral flow immunoassay method to achieve rapid identification by combining a new monoclonal antibody with Solenopsis invicta venom proteins. Chi et al. found that training detection dogs to recognize the smell of Solenopsis invicta can accurately identify samples and live Solenopsis invicta.

[0004] Traditional laboratory molecular detection methods have limitations, such as dependence on complex instruments, temperature cycling, long detection time, tedious steps, and professional operation, and the results are difficult to interpret directly. Although the lateral flow immunoassay method is simple, it may produce false negatives at low antigen concentrations and may produce false positives due to cross-reactions with closely related species. When the sample is in the developmental stage with insufficient antigen expression, the detection effect is poor, and complex samples may interfere with antigen-antibody binding. The method of using trained dogs to recognize the smell of Solenopsis invicta is also limited, as it cannot completely simulate the smell of the real environment, and the performance of the dogs is easily affected by fatigue, mood, or health. In addition, long-term investment is required for training, and the working life of the dogs is limited, requiring experienced dog trainers to guide.

[0005] Therefore, the present application aims to provide a visual rapid detection method for Solenopsis invicta to solve the above problems. SUMMARY

[0006] The purpose of the present application is to solve the above problems, provide a visual rapid detection method of Solenopsis invicta, the present application develops a rapid molecular detection method for the invasive species Solenopsis invicta based on loop-mediated isothermal amplification technology, which can accurately distinguish Solenopsis invicta from nine closely related ant species; break through the dependence of traditional molecular detection on professional equipment and complex operation, and provide a high-sensitivity, high-specificity on-site detection tool for Solenopsis invicta invasion monitoring and port quarantine.

[0007] In order to achieve the above purpose, the technical scheme of the present application is as follows:

[0008] The present application provides a visual rapid detection method of Solenopsis invicta, which comprises the following steps:

[0009] S1, extracting DNA sample of ants, diluting the DNA sample to 40 ng / μL with 40 ng / μL ultrapure water, and storing at -20℃ for standby;

[0010] S2, preparing LAMP reaction solution, 25 μL system contains: 2x reaction solution 12.5 μL, 1-Cytb primer group, Bst DNA polymerase 1 μL, DNA sample 2 μL, deionized water to 24 μL, and then adding 1 μL fluorescent visual detection reagent; the reaction condition is set as 63℃ constant temperature amplification for 45 minutes, then 80℃ heating for 5 minutes, and observing the reaction result;

[0011] S3, judging whether the DNA sample is the DNA sample of Solenopsis invicta according to the color development result of the reaction solution and the real-time turbidity curve analysis.

[0012] The 1-Cytb primer group contains the following primers: 1-Cytb F3, 1-Cytb B3, 1-Cytb FIP and 1-Cytb BIP, each 1 μL.

[0013] The 1-Cytb F3 is TACAAAATATCTCCAATGGATGA.

[0014] The 1-Cytb B3 is TTTGCCCTCAAGGAAGGA.

[0015] The 1-Cytb FIP is:

[0016] CCTCGGGCGATATGAGTGTATATAATAATATTCACATTAATGGCGCT AC.

[0017] The 1-Cytb BIP is:

[0018] CCACACATGAATAATCGGAGTAACTCATAGCCTAGGAATGCTGTA G.

[0019] Compared with the prior art, the present scheme has the beneficial effects:

[0020] The present application is based on loop-mediated isothermal amplification technology, and a rapid molecular detection method for invasive species Solenopsis invicta is developed. The mitochondrial DNA cytochrome b (Cytb) gene of Solenopsis invicta is used as a target, and specific LAMP primers (F3 / B3, FIP / BIP) are designed and screened. Whether the DNA sample is a Solenopsis invicta DNA sample can be judged by visual color development (positive green / negative orange) and real-time turbidity curve. The system can accurately distinguish Solenopsis invicta from nine closely related ant species. The present application breaks through the dependence of traditional molecular detection on professional equipment and complex operation, and provides a high-sensitivity, high-specificity on-site detection tool for Solenopsis invicta invasion monitoring and port quarantine. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 is a schematic diagram of the best primer screening of Solenopsis invicta LAMP in the embodiment of the present application, wherein A is a real-time turbidity curve; B is a color development reaction (1: primer 1-Ctyb; 2: primer 2-Cytb; 3: primer 3-Cytb; 4: ddH2O);

[0022] Figure 2 is a schematic diagram of the best reaction temperature screening of Solenopsis invicta LAMP in the embodiment of the present application, wherein A is a real-time turbidity curve; B is a color development reaction (1: 65℃; 2: 63℃; 3: 61℃; 4: 59℃; 5: 57℃; 6: 55℃; 7: ddH2O);

[0023] Figure 3 is a schematic diagram of the best reaction time screening of Solenopsis invicta LAMP in the embodiment of the present application, wherein A is a real-time turbidity curve; B is a color development reaction (1: 30min; 2: 45min; 3: 60min; 4: ddH2O);

[0024] Figure 4 is a specific verification diagram of Solenopsis invicta LAMP in the embodiment of the present application, wherein A is a real-time turbidity curve; B is a color development reaction (1: Solenopsis invicta; 2: Solenopsis geminata; 3: Pheidole megacephala; 4: Pheidole megacephala; 5: Pheidole indica; 6: Pheidole indica; 7: Pheidole indica; 8: Pheidole indica; 9: Pheidole indica; 10: Pheidole indica; 11: ddH2O;

[0025] Figure 5Figure is a schematic diagram of PCR (A) and LAMP (B) sensitivity test verification in the embodiment of the present application, wherein A is PCR sensitivity test; B is LAMP sensitivity test; M, DNA standard molecular weight; 8, blank control; 1-7, DNA concentration is 40 ng / μL, 4 ng / μL, 400 pg / μL, 40 pg / μL, 4 pg / μL, 400 fg / μL, 40 fg / μL, respectively;

[0026] Figure 6 Figure is a LAMP sensitivity verification diagram of Solenopsis invicta in the embodiment of the present application, wherein A is real-time turbidity curve; B is color reaction (1: 40 ng / μL; 2: 4 ng / μL; 3: 400 pg / μL; 4: 40 pg / μL; 5: 4 pg / μL; 6: 400 fg / μL; 7: 40 fg / μL; 8: ddH2O). DETAILED DESCRIPTION

[0027] In order to enable persons skilled in the art to better understand the present application, the technical solutions of the present application will be further described in detail below in combination with the embodiments of the present application and the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by persons skilled in the art without creative labor should belong to the protection scope of the present application.

[0028] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below in combination with the embodiments.

[0029] Embodiment:

[0030] 1. Materials and methods

[0031] 1.1 Test material

[0032] The test material is a certain number of Solenopsis invicta, and the test material is identified by morphology and DNA barcoding. There are 9 species of closely related species (see Table 1) for testing. The test material is identified by morphology and DNA barcoding.

[0033] Table 1: Test ant species

[0034]

[0035]

[0036] 1.2 Main reagents and instruments

[0037] Blood / cell / tissue genomic DNA extraction kit (DP304) (Tiangen Biotech (Beijing) Co., Ltd.); 10x PCR buffer, 2.5 mM dNTP Mix, 5 U / μL Taq DNA polymerase (all purchased from TAKARA); primers synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.

[0038] DNA amplification kit (DNA Amplification Kit), fluorescence detection reagent (Fluorescence Detection Reagent) (both purchased from Ruiyan Biotechnology Co., Ltd.); LA-500 isothermal amplification real-time turbidity detection system purchased from Japan Ruiyan Chemical Co., Ltd.; Ultra-micro UV spectrophotometer N60 purchased from Germany IMPLEN company.

[0039] 1.3 DNA extraction of test materials

[0040] All test materials were taken as single-headed ants, and the ants were ground in 1.5 mL centrifuge tubes. The DNA samples of S. invicta were extracted using blood / cell / tissue genomic DNA extraction kit (DP304), and the concentration of total DNA was detected using ultra-micro UV spectrophotometer. All test samples were verified for species correctness by DNA barcode sequencing, and the DNA of S. invicta was diluted with ultrapure water according to the requirements and stored at -20℃ for standby.

[0041] 1.4 Primer design

[0042] Specific LAMP primer sets were designed using online LAMP primer design software Primer Explorer V5 (http: / / primerexplorer.jp / lampv5e / index.html) provided by Japan Eiken Chemical Co., Ltd. Three groups of LAMP primers were designed, and the primers were synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.

[0043] 1.5 LAMP reaction system and reaction condition optimization

[0044] 1.5.1 LAMP reaction system

[0045] The LAMP reaction solution was prepared according to the instructions of the LAMP amplification reaction kit DNA Amplification kit (Loop-mediated isothermal method, LAMP). The 25 μL system contained: 2x reaction solution (RM) 12.5 μL, FIP / BIP (40 μM) 1 μL each, F3 / B3 (5 μM) 1 μL each, Bst DNA polymerase 1 μL, DNA template 2 μL, deionized water (DW) to 24 μL, and 1 μL of fluorescent visual inspection reagent (FD) was added. The reaction conditions were set at 65°C constant temperature amplification for 60 minutes, followed by heating at 80°C for 5 minutes to inactivate the enzyme activity.

[0046] 1.5.2 LAMP reaction condition optimization

[0047] By setting 6 temperature gradients (55°C, 57°C, 59°C, 61°C, 63°C, 65°C), each temperature was constant temperature reaction for 60 minutes, the turbidity detection and color reaction were used to evaluate the amplification effect, and the best reaction temperature was determined. On the basis of the optimized temperature, the influence of 3 amplification times (30 minutes, 45 minutes, 60 minutes) on the amplification efficiency was further investigated. The real-time turbidimeter recorded data every 6 seconds, and the turbidity of positive reaction showed S-shaped rising curve, while the turbidity of negative reaction remained stable. The colorimetric result determination standard was: the reaction solution changed from orange to green indicating positive, and remained orange indicating negative. All tests were repeated 3 times to ensure data reliability.

[0048] 1.6 LAMP specific detection

[0049] The genomic DNA of S. invicta and its 9 closely related species was used to analyze the specificity of the optimized LAMP system. The DNA of S. invicta was used as a positive control, and ddH2O was used as a negative control, and the LAMP reaction was run under the best reaction conditions. The specificity of LAMP was evaluated by the curve reaction of real-time turbidimeter and direct visual color change of LAMP product. The test was repeated 3 times to verify the stability of the results.

[0050] 1.7 LAMP sensitivity detection and conventional PCR sensitivity detection

[0051] The red ant DNA diluted in a 10-fold series in 1.3 was used to test the sensitivity of the established LAMP system and conventional PCR. 2 μL of different concentrations of red ant was taken as a positive control, and ddH2O was taken as a negative control. The sensitivity of LAMP was analyzed by the method of 1.5.2, and the sensitivity of LAMP was evaluated by the curve reaction of real-time turbidity instrument and direct visual color change of LAMP product. The PCR reaction system: 1 μL of red ant mtDNA Cytb gene specific upstream and downstream primers (see Table 2), 16 μL of ddH2O, 2.5 μL of 10x PCR buffer, 2 μL of dNTP Mix, 0.5 μL of Taq DNA polymerase, 2 μL of red ant DNA (the negative control was changed to 2 μL of ddH2O). The test was repeated 3 times under the same conditions.

[0052] Table 2 Red ant mtDNA Cytb gene specific primer sequences

[0053]

[0054] 2 Results and analysis

[0055] 2.1 Optimal primer screening

[0056] According to the red ant mtDNA Cytb gene, three groups of LAMP primers were designed, respectively 1-Cytb, 2-Cytb and 3-Cytb, and the cDNA of the red ant was used as a template to perform LAMP reaction on the three groups of primers. The reaction results are shown in Figure 1 The LAMP amplification results show that 1-Cytb and 3-Cytb can amplify the target curve of the red ant, and 1-Cytb is selected as the best primer group according to the turbidity reaction curve and the color of the amplification reaction solution (see Table 3).

[0057] Table 3 Red ant LAMP primer sequences

[0058]

[0059] 2.2 Optimal reaction conditions

[0060] In order to accurately determine the optimal reaction conditions of the red ant LAMP detection, the genomic DNA of the red ant was used as a template, and the effects of different temperature gradients (55℃, 57℃, 59℃, 61℃, 63℃, 65℃) on the amplification efficiency were systematically investigated. After 60 minutes of constant temperature amplification, typical color change (orange→green) and S-shaped curve recorded by real-time turbidity instrument were observed in all temperature groups. Figure 2). By comprehensively analyzing the amplification curve and the degree of color change, 63°C was determined to be the optimal reaction temperature. Under the optimized reaction temperature conditions, the reaction time was further screened in a gradient manner (30min, 45min, 60min). The results showed that ( Figure 3 ), a typical amplification curve and a clear color change appeared at 45 minutes. Based on the sensitivity analysis in 2.4, the LAMP reaction was able to detect the lowest detectable concentration within this time. Based on the principle of rapid detection, the optimal LAMP reaction time was determined to be 45 minutes. A comprehensive comparison of the amplification effects of different reaction temperatures and times ultimately determined the optimal LAMP reaction conditions to be 63°C for 45 minutes. Validation tests demonstrated that visual color change observation and turbidimetric detection results were consistent.

[0061] 2.3 Detection system specificity verification

[0062] Under the optimized LAMP reaction conditions (63°C, 45 min), the genomic DNA of red imported fire ants and nine closely related ant species were subjected to LAMP detection, with ddH2O as a negative control. Figure 4 Only samples from the red imported fire ant (RIFA) showed a positive reaction (amplification curve, green reaction solution), while the nine closely related ant species and the blank control all showed negative reactions (no amplification curve, orange reaction solution). This result confirms that the established RIFA LAMP detection method is highly specific and can effectively distinguish RIFA from other closely related species with similar morphology or ecology.

[0063] 2.4 Sensitivity analysis of LAMP and PCR systems

[0064] The total DNA of red imported fire ant (40 ng / μL) was diluted 10-fold (4 ng / μL, 400 pg / μL, 40 pg / μL, 4 pg / μL, 400 fg / μL, 40 fg / μL) as a template for sensitivity analysis of LAMP and PCR systems. The results showed that the minimum detection concentration of LAMP detection could reach 400 fg / μL (i.e. Figure 5 Lane B 6), the lowest concentration that can be detected by PCR is 4 pg / μL (i.e. Figure 5 Lane A 5) indicates that the sensitivity of the established LAMP method for detecting red imported fire ants is higher than that of PCR detection. The real-time turbidity curve and color reaction of the red imported fire ant LAMP detection sensitivity are shown in Figure 6 .

[0065] 3 Summary and Discussion

[0066] The present application designs specific LAMP primer sets according to the mtDNA Cytb gene sequence of the red imported fire ant, and establishes a convenient, efficient and visual detection method for the ant. The method can complete the amplification reaction in 45 min under constant temperature conditions at 63 DEG C, and realize instant result interpretation through the color change of the calcein-magnesium ion complex (positive green / negative orange yellow), which significantly reduces the dependence on precise thermal cycler, and eliminates the cumbersome process of traditional PCR product sequencing comparison. Experimental verification shows that the LAMP system has high sensitivity amplification capacity for the genome of the red imported fire ant, and the minimum detection limit can reach 400 fg / muL, which is not limited by the integrity of the sample DNA. The specificity test shows that the method can effectively distinguish the red imported fire ant from other 9 species similar to the red imported fire ant (including S. carolinum, Crematogaster mala, etc.). The method provides an accurate identification tool for port quarantine and field detection, is suitable for basic plant protection agencies and on-site quarantine scenes, can realize rapid identification in the early stage of the invasion of the red imported fire ant, provides molecular diagnosis basis for implementing accurate prevention and control strategy, reduces the dependence on professional laboratory, and promotes the application of the red imported fire ant prevention and control technology at the grassroots level.

[0067] Due to the large number of ant species, high morphological similarity, and the fact that some characteristics of the red imported fire ant may overlap with other ants, it is difficult to identify the red imported fire ant from other ants by morphology. The morphological identification of the red imported fire ant requires technicians to master rich ant professional taxonomy knowledge to accurately identify subtle differences, and the structure of the petiole, the segmentation of the antenna, the body surface marking, and the cheliceral needle need to be observed with a microscope or a magnifying glass. The current indoor molecular detection requires special equipment and professional personnel, is time-consuming, and the result is not intuitive; and the currently developed outdoor detection techniques, such as lateral flow immunoassay and detection dog detection, also have certain limitations.

[0068] The LAMP detection technology established by the present application has high sensitivity, can detect very low concentration of target DNA, is suitable for early invasion monitoring or low density population detection; the isothermal amplification (63 DEG C) does not require complex temperature control equipment, and can be completed in the field and at the port quarantine with a portable heating device, only needs 45 min, greatly shortens the reaction time; can detect various types of samples such as live / dead red imported fire ant, egg, nest soil, plant attachment, etc., covering the whole life cycle of the red imported fire ant; can process multiple samples (such as red imported fire ant residues in soil, plants or goods) in batches; the detection result is not affected by environmental temperature, humidity or physiological state (such as odor change) of the red imported fire ant.

[0069] In addition, the results of the LAMP detection technology can be detected by electrophoresis, real-time turbidity detection, and fluorescence visual detection. Due to the high sensitivity of the LAMP detection technology, false positives may be caused by aerosol pollution due to the opening of the reaction after the reaction is completed. If 2% agarose gel electrophoresis is used for detection to screen primers and determine the results, false positives may occur due to aerosols in the environment, affecting the accuracy of the detection results. In order to avoid false positives caused by aerosol pollution, the present application realizes closed tube detection by premixing fluorescent dyes, and the experimental results are used as the basis for determining the color change of the amplification product and the curve change of the real-time turbidimeter.

[0070] In the LAMP detection technology reaction system established by the present application, the concentrations of Bst DNA polymerase, dNTPs, etc. have not been systematically verified, and the optimal ratio is not clear; the primer concentration ratio has not been finely adjusted, which may cause non-specific amplification. The sampling geographic range of the present application is limited and does not cover the diversified ecological populations of the red imported fire ant invasion area; the number of closely related species is not enough, and there is a lack of cross verification of the Solenopsis genus and niche overlapping ant species, which affects the specificity evaluation. Because the present application has not tested field quarantine and complex environmental samples, it cannot strongly demonstrate its role in field monitoring and port quarantine. Although the loop primer is not essential in the LAMP detection technology, the addition of the loop primer can shorten the amplification time to about 1 / 3 of the original, making the reaction more rapid and efficient. The fluorescent dye calcium yellow used in the present application is initially in a fluorescence quenching state due to the combination with manganese ions, but as the LAMP reaction proceeds, the manganese ions are removed by the reaction by-product pyrophosphate ions, allowing calcium yellow to recover and emit fluorescence. Further, calcium yellow will combine with magnesium ions in the reaction solution to enhance fluorescence. However, if the sample or sample solution contains high concentrations of metal ions such as calcium (Ca), zinc (Zn), and iron (Fe), it may interfere with the generation of fluorescence signals, leading to false detection results. Therefore, attention should be paid to the concentration control of metal ions in the sample in actual application to ensure the accuracy of the detection.

[0071] The LAMP detection technology established by the present application has the advantages of simple operation process, greatly shortened detection time, strong specificity, high sensitivity, and good stability. This technology is different from traditional morphological identification and indoor detection technology, greatly reducing the requirements for professional knowledge and skills of the identification personnel, and is expected to be used for rapid and accurate identification of the ant by grassroots quarantine personnel or non-professional identification personnel in the field, port, and other field scenes, and has good application prospects. It can provide scientific basis and technical support for rapid detection and monitoring at the port or grassroots front line, which has great significance for risk warning and rapid detection, monitoring, and protection of biological and ecological safety of invasive quarantine organisms.

[0072] The above specific embodiments are only an explanation of the present application, which is not a limitation of the present application, and the person skilled in the art can make a modification of the present embodiment without a creative contribution according to the need after reading the present specification, but as long as it is within the scope of the claims of the present application, it is protected by the patent law.

Claims

1. A visual rapid detection method for red imported fire ants, characterized by: The detection method comprises the following steps: S1. Extract ant DNA samples, dilute the DNA samples to 40 ng / μL with 40 ng / μL ultrapure water, and store at -20°C until use; S2. Prepare the LAMP reaction solution. A 25 μL system contains: 12.5 μL of 2× reaction solution, 1-Cytb primer set, 1 μL of Bst DNA polymerase, 2 μL of DNA sample, and deionized water to 24 μL. Add 1 μL of fluorescent visual detection reagent. The reaction conditions are set to 63°C for 45 minutes, followed by heating at 80°C for 5 minutes. Observe the reaction results. S3. Determine whether the DNA sample is a DNA sample of red imported fire ants based on the color development result of the reaction solution and the real-time turbidity curve analysis.

2. A visual rapid detection method for red imported fire ants as claimed in claim 1, characterized in that: The 1-Cytb primer set includes the following primers: 1 μL each of 1-Cytb F3, 1-Cytb B3, 1-Cytb FIP, and 1-Cytb BIP.

3. A visual rapid detection method for red imported fire ants as claimed in claim 2, characterized in that: The 1-Cytb F3:TACAAAATATCTCCAATGGATGA; The 1-Cytb B3: TTTGCCCTCAAGGAAGGA; The 1-Cytb FIP: CCCTCGGGCGATATGAGTGTATAATAATAATATTCACATTAATGGCGCT AC; The 1-Cytb-Bip: CCACACATGAATAATCGGAGTAACTCATAGCCTAGGAATGCTGTA G.

Images