CircRNA (Ribonucleic Acid)-based molecular marker combination and application thereof

Abstract

The invention provides a molecular marker combination based on circRNA (Ribonucleic Acid), wherein the molecular marker combination comprises hsacirc0005986 and hsacirc0067531. The invention also provides application of the molecular marker composition in diagnosis of liver cancer, and a diagnostic kit prepared based on the molecular marker composition. The invention has outstanding advantages in the aspect of auxiliary diagnosis of liver cancer, can realize auxiliary diagnosis of early liver cancer, and improves the survival rate of patients.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular diagnostics, in particular to a combination of whole blood circRNA as a marker for diagnosing liver cancer. BACKGROUND

[0002] Liver cancer is one of the malignant tumors with the highest mortality rate. Primary liver cancer mainly includes hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma (ICC), and HCC-ICC mixed type of three different pathological types, of which HCC accounts for more than 85%-90%. At present, the prevention of liver cancer in clinical practice mainly adopts three-level prevention, and the treatment mainly adopts surgical resection. For liver cancer that cannot be surgically resected, comprehensive therapy such as radiotherapy, chemotherapy, and cytokine therapy can be used. Early diagnosis of liver cancer is closely related to the five-year survival rate of patients after surgery. The five-year survival rate of advanced liver cancer is close to 0, while the five-year survival rate of early liver cancer after radical surgery treatment can reach more than 60%. Usually, liver cancer with a diameter of less than or equal to 3 cm is called "small liver cancer", and under the premise of scientific treatment, the five-year survival rate can reach more than 90%, and many patients can survive for a long time. Because liver cancer has insidious onset, no specific symptoms in the early stage, and a development course of usually 30-50 years, and limited means of early detection, most patients are already in the advanced stage when diagnosed, losing the opportunity for radical surgery, combined with poor prognosis, and the five-year survival rate is only 3-5%. Therefore, discovering early biomarkers of liver cancer for clinical diagnosis is particularly important for the secondary prevention (early detection, early diagnosis, and early treatment) of liver cancer patients.

[0003] The common tumor markers for liver cancer currently include alpha-fetoprotein (AFP), gamma-glutamyltransferase isozyme II (GGT2), abnormal prothrombin (AP), alpha-L-fucosidase (AFU), acid isozyme ferritin (AIF), aldolase A (ALD-A), 5'-nucleotide phosphodiester isozyme V (5'-NPDV), etc. Currently, AFP can assist in early diagnosis of liver cancer. When the content of AFP is greater than 500 μg / L for more than 4 weeks, or the content of AFP gradually increases from a low concentration without decrease, or the content of AFP is maintained at more than 200 μg / L for 8 consecutive weeks, liver cancer can be preliminarily diagnosed. However, about 30% to 40% of AFP-negative patients in the clinic are difficult to find intrahepatic tumors through conventional means. The main reason is that the level of AFP in serum of hepatocellular carcinoma is often related to the degree of differentiation of hepatocytes. The hepatocytes of stage I liver cancer are close to normal cells, so the content of AFP is not enough to be measured, so the discovery of early liver cancer is often missed. In addition, many inflammations can cause abnormal elevation of AFP, which has poor specificity. Moreover, the sensitivity of AFP in ICC is low. In addition to detecting diagnostic markers, ultrasound imaging, computed tomography (CT), X-ray hepatic angiography, radionuclide liver imaging, magnetic resonance imaging (MRI), liver biopsy, laparotomy or laparoscopic exploration, etc. can be performed. Ultrasound has a high detection rate for liver cancer greater than 1 cm, but its sensitivity for liver cancer less than 1 cm is not high. Therefore, early screening for liver cancer urgently needs more accurate techniques and methods.

[0004] Circular RNA (circRNA) is a kind of non-coding RNA with sequence conservation, stable and not easy to degrade, specific expression pattern, and widely exists in various tissues and cells, which is formed by reverse splicing of linear RNA. In addition, circRNA has multiple functions, such as binding miRNA as miRNA sponge, encoding polypeptide and protein, and direct transport between cells. Current studies have found that circRNA can participate in various aspects of liver cancer development, invasion, metastasis and anticancer drug resistance, and many circRNAs have different expressions in liver cancer patient tissues and blood samples, which have important influences on the prognosis of liver cancer. These advantages make circRNA a promising biomarker for detecting disease progression and prognosis. SUMMARY

[0005] The present application provides a circRNA detection kit with high sensitivity and specificity, which can realize liver cancer diagnosis through blood, and provides the application of circRNA in the preparation of a liver cancer detection reagent.

[0006] The present application provides a combination of molecular markers based on circRNA, comprising hsa_circ_0005986 and hsa_circ_0067531.

[0007] In one embodiment according to the present application, the combination of molecular markers further comprises one, two or more selected from the group consisting of hsa_circ_0000839, hsa_circ_0039411, hsa_circ_0003489, hsa_circ_0003620, hsa_circ_0000284 and hsa_circ_0000976.

[0008] In one embodiment according to the present application, the combination of molecular markers comprises hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489.

[0009] Preferably, the nucleotide sequence of the cDNA of hsa_circ_0005986 is SEQ ID NO: 1

[0010] AACACTACTGAGCCTGTGGCGGCCACCGAGACCCTGGCTGAGGTACCCGAACATGTGCTGCGAGGACTTCCGGAGGAAGTGAGGCTTTTCCCTTCTGCTGTTGACAAGACCCGGATTGGTGTCTGGGCCACTAAACCAATTTTAAAAGGCAAAAAATTTGGGCCATTTGTTGGTGATAAGAAAAAAAGATCTCAGGTTAAGAATAATGTATACATGTGGGAGGTGTATTACCCAAATTTGGGATGGATGTGCATTGATGCCACTGATCCAGAGAAGGGAAACTGGCTGCGATATGTGAATTGGGCTTGCTCAGGAGAAGAGCAAAATTTATTCCCACTGGAAATCAACAGAGCCATTTACTATAAAACTTTAAAG;

[0011] Preferably, the nucleotide sequence of the cDNA of hsa_circ_0067531 is SEQ ID NO: 2

[0012] AGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAAATCTTGGACAGGGATCCCT

[0013] TGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACTTTGCGACAAGACTGCCG

[0014] AGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATCAAGTGGAATAAACTT

[0015] GAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAACTGCCCCCCCGGG

[0016] AGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGAGAATATGCTGTAGGCTGCCTGCGACAGATGAG;

[0017] and / or the nucleotide sequence of the cDNA of hsa_circ_0000839 is SEQ ID NO: 3

[0018] AAATCATAGCCCACTAATGAGTTTTGGAGCCAGCTTTGTCAGTTTTTTGAATGCCATGA

[0019] TGACATTTGAGGAAGAAAAAATGCAGTTGGCATGTGATGACTTAAAAACCACAGAAA

[0020] AACTGTGTGAAAGTGAAGAGGCTGGAGTAATTGAAACAATCAAGAATAAAATTAAGA

[0021] AGAACGTTGATGTCCGAAAATCCGCCCCCTCTATGGTTGATCGGCTTCAGAGGCAGAT

[0022] AATCATAGCTGACTGCCAGGTTTACCTGGCTGTGCTTTCATTTGTAAAACAAGAATTGTCAG;

[0023] and / or the nucleotide sequence of the cDNA of hsa_circ_0039411 is SEQ ID NO: 4

[0024]

[0025] and / or the nucleotide sequence of the cDNA of hsa_circ_0003489 is SEQ ID NO:5

[0026] CTTCAGAAGCTGCTTACCATGGACCCAATAAAGCGAATTACCTCAGAACAGGCTATGCAGGACCCCTATTTCTTAGAAGACCCACTTCCTACATCAGACGTTTTTGCCGGTTGTCAAATCCCTTACCCAAAACGAGAATTTTTAACGGAAGAAGAACCTGATGACAAAGGAGACAAAAAGAACCAGCAGCAGCAGGGCAATAACCACACTAATGGAACTGGCCACCCAGGGAATCAAGACAGCAGTCACACACAGGGACCCCCGTTGAAGAAAGTGAGAGTTGTTCCTCCTACCACTACCTCAGGTGGACTTATCATGACCTCAGACTATCAG;

[0027] and / or the nucleotide sequence of the cDNA of hsa_circ_0000976 is SEQ ID NO:24

[0028] GTGTAGTCGCCGCCGCCAGCCGCCATGGGCAAACAGAACAGCAAGCTGCGGCCCGAGGTGCTGCAGGACCTGCGGGAGAACACGGAGTTCACCGACCACGAGCTGCAGGAGTGGTACAAGGGCTTCCTCAAGGACTGCCCCACCGGCCACCTGACCGTGGACGAGTTCAAGAAGATCTACGCCAACTTCTTCCCCTACGGCGACGCTTCCAAGTTCGCCGAGCACGTCTTCCGCACCTTCGACACCAACGGCGACGGCACCATCGACTTCCGGGAGTTCATCATTGCGCTGAGCGTGACCTCGCGGGGCAAGCTGGAGCAGAAGCTCAAGTGGGCCTTCAGCATGTACGACCTGGACGGCAACGGCTACATCAGCCGCAGCGAGATGCTGGAGATCGTGCAG;

[0029] and / or the nucleotide sequence of the cDNA of hsa_circ_0003620 is SEQ ID NO:25:

[0030] GCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAAGATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAG;

[0031] and / or the nucleotide sequence of the cDNA of hsa_circ_0000284 is SEQ ID NO:26:

[0032]

[0033] In one embodiment according to the present application, the molecular marker combination further comprises an internal reference β-actin.

[0034] The present application further explores the diagnostic value of hsa_circ_0000976, hsa_circ_0003620 and hsa_circ_0000284 as molecular markers in liver cancer.

[0035] The present application further provides the use of the above-mentioned molecular marker combination in the preparation of a diagnostic kit for detecting liver cancer.

[0036] In another aspect of the present application, a diagnostic kit for liver cancer is provided, which comprises a PCR reaction system; the PCR reaction system comprises a primer pair designed for any of the above-mentioned molecular marker combinations.

[0037] The molecular marker combination is selected from:

[0038] 1) hsa_circ_0005986 and hsa_circ_0067531;

[0039] 2) hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489;

[0040] 3) hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0003620 and hsa_circ_0000284;

[0041] 4) hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000976, hsa_circ_0003620 and hsa_circ_0000284

[0042] 5) hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411, hsa_circ_0003489, hsa_circ_0000976, hsa_circ_0003620 and hsa_circ_0000284.

[0043] According to one embodiment of the present invention, the primer pair for hsa_circ_0005986 comprises a forward primer having a nucleotide sequence of SEQ ID NO.6 and a reverse primer having a nucleotide sequence of SEQ ID NO.7; and / or,

[0044] The primer pair for hsa_circ_0067531 comprises a forward primer with a nucleotide sequence of SEQ ID NO.8 and a reverse primer with a nucleotide sequence of SEQ ID NO.9; and / or,

[0045] The primer pair for hsa_circ_0000839 comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.10 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.11; and / or,

[0046] The primer pair for hsa_circ_0039411 comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.13; and / or,

[0047] The primer pair for hsa_circ_0003489 includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.15.

[0048] In one embodiment according to the present invention, an internal reference primer pair is further included for an internal reference marker, and the internal reference marker is β-actin; preferably, the internal reference primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.16 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.17.

[0049] The primer pair for hsa_circ_0000976 comprises a forward primer with a nucleotide sequence of SEQ ID NO.18 and a reverse primer with a nucleotide sequence of SEQ ID NO.19; and / or,

[0050] The primer pair for hsa_circ_0003620 comprises a forward primer with a nucleotide sequence of SEQ ID NO.20 and a reverse primer with a nucleotide sequence of SEQ ID NO.21; and / or,

[0051] The primer pair for hsa_circ_0000284 includes a forward primer with a nucleotide sequence of SEQ ID NO.22 and a reverse primer with a nucleotide sequence of SEQ ID NO.23.

[0052] In an embodiment according to the present application, the PCR reaction system further comprises SYBR Green mixture, forward primer solution, reverse primer solution and pure water.

[0053] Preferably, the total volume of the PCR reaction system is 20 μL; wherein the volume of the SYBR Green mixture is 10 μL, the volume of the forward primer solution is 0.4 μL, the volume of the reverse primer solution is 0.4 μL, the cDNA template is 2 μL, and the rest is nuclease-free pure water; the use concentration of the forward primer solution is 10 μM, and the use concentration of the reverse primer solution is 10 μM; the DNA template is the original solution after the reverse transcription reaction.

[0054] Preferably, the PCR reaction conditions are as follows:

[0055] Pre-denaturation at 95℃ for 30 s, denaturation at 95℃ for 5 s, annealing at 53℃ for 30 s, extension at 72℃ for 30 s, and 40 cycles of reaction.

[0056] In an embodiment according to the present application, a reverse transcription reaction system is further included; preferably, the reverse transcription reaction system comprises gDNA remover, 4×RT Master Mix and nuclease-free ddH2O.

[0057] The beneficial effects of the above technical solutions of the present application are as follows:

[0058] 1) The combination of hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489 is used as a molecular marker, and after a large data clinical verification test, it has outstanding advantages in the auxiliary diagnosis of liver cancer. These five molecular markers are used for the first time in the development of a liver cancer circRNA detection kit. The liver cancer circRNA detection kit uses a real-time fluorescent quantitative PCR method to achieve the auxiliary diagnosis of early liver cancer and improve the survival rate of patients.

[0059] 2) The liver cancer circRNA detection kit of the present application selects five circRNA markers, hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489, for combination to distinguish liver cancer patients from normal people, and the diagnostic efficiency AUC can reach 0.9356, and the sensitivity and specificity are 85.5% and 94.9%, respectively.

[0060] Compared with the diagnostic efficiency AUC of AFP commonly used in current clinical for primary liver cancer patients and normal people, the sensitivity and specificity are 82.14% and 76.79%, respectively; for early small liver cancer, the sensitivity is only 46%, and the area under the curve AUC is usually between 0.6-0.7, and the combination of the five circRNAs is more advantageous.

[0061] 3) By R language 4.2.2, Prism software and IBM SPSS Statistics21 analysis, it is found that the diagnostic efficiency (P<0.001) of the combination of the above-mentioned five circRNAs is significantly higher than that of the above-mentioned single marker. BRIEF DESCRIPTION OF DRAWINGS

[0062] Figure 1 ROC analysis of hsa_circ_0005986 for diagnosing liver cancer patients;

[0063] Figure 2 ROC analysis of hsa_circ_0067531 for diagnosing liver cancer patients;

[0064] Figure 3 ROC analysis of hsa_circ_0000839 for diagnosing liver cancer patients.

[0065] Figure 4 ROC analysis of hsa_circ_0039411 for diagnosing liver cancer patients.

[0066] Figure 5 ROC analysis of hsa_circ_0003489 for diagnosing liver cancer patients.

[0067] Figure 6 ROC analysis of the combination of the five circRNAs (hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489) of the present application for diagnosing liver cancer patients.

[0068] Figure 7 ROC analysis of hsa_circ_0000976, hsa_circ_0003620, hsa_circ_0000284 and other three circRNAs outside the circRNA combination group for diagnosing liver cancer patients.

[0069] Figure 8The evaluation result diagram of the 8 circRNA combinations of the circRNA joint group and hsa_circ_0000976, hsa_circ_0003620 and hsa_circ_0000284 for diagnosing liver cancer patients.

[0070] Figure 9 The evaluation result diagram of the 3 circRNAs (hsa_circ_0005986, hsa_circ_0067531 and hsa_circ_0000839) in the circRNA joint group and 5 circRNAs (hsa_circ_0003620, hsa_circ_0000284, etc.) for diagnosing liver cancer patients.

[0071] Figure 10 The evaluation result diagram of the 2 circRNAs (hsa_circ_0005986 and hsa_circ_0067531) in the circRNA joint group and 5 circRNAs (hsa_circ_0000976, hsa_circ_0003620 and hsa_circ_0000284, etc.) for diagnosing liver cancer patients. DETAILED DESCRIPTION

[0072] To make the technical problems, technical solutions and advantages to be solved by the present application clearer, the following will be described in detail with reference to the drawings and specific embodiments.

[0073] If not specifically stated, the reagents used in the embodiments can be purchased through commercial channels.

[0074] Example 1: Extraction of total RNA from blood

[0075] Liver cancer patients and healthy controls were collected from the Central Hospital of Xinxiang, wherein 55 liver cancer patients (age 55±9; gender: 42 males and 13 females) had serum AFP levels all greater than 20 ng / mL, and 59 healthy controls (age 25±10; gender: 32 males and 27 females) were collected. Total RNA was extracted from whole blood. Thermo Fisher Trizol (15596018CN) reagent was used for extraction, and the operation method was as follows:

[0076] (1) The whole blood of liver cancer patients and normal persons was divided into 2 mL RNase-free EP tubes, 1 mL Trizol and 200 μL chloroform were added, and it was shaken and shaken uniformly, and it was shaken uniformly at room temperature for 15 min;

[0077] (2) Low temperature centrifuge 4℃, 12000xg centrifuge 15min, the solution is divided into three layers, the RNA is dissolved in the water phase, and the water phase is transferred to another new 1.5mL Rnase-free EP tube;

[0078] (3) Add 1 μL of accounting precipitation with glycogen, add isopropyl alcohol in an amount of half of Trizol, mix well, and stand at room temperature for 10-30 min;

[0079] (4) 4℃, 12000xg centrifuge 10min, after centrifugation, RNA precipitate appears at the bottom of the tube, discard the supernatant;

[0080] (5) Add 1 mL of 75% ethanol, gently invert by hand, 12000xg centrifuge for 5min, discard the supernatant;

[0081] (6) Dry at room temperature, add 20 μL of DEPC water to dissolve the precipitate.

[0082] Example 2 Reverse transcription experiment

[0083] Take 2 μg of total RNA for reverse transcription, use Umibio (Shanghai Yumibio Biotechnology Co., Ltd.) 4x premixed rapid reverse transcription kit (UR32501), and follow the recommended steps of the reagent, which are as follows:

[0084] (1) Prepare the reaction reagent in an ice box, and the reaction system is as shown in Table 1.

[0085] Table 1 Reverse transcription first step system

[0086]

[0087] Mix well and centrifuge the reaction components to the bottom of the tube.

[0088] (2) After incubation at 42℃ for 2min, place the EP tube on ice again, and add the following reaction components.

[0089] Table 2 Reverse transcription second step system

[0090]

[0091] Mix well and point the reaction components to the bottom of the tube.

[0092] (3) Place the reaction solution in a PCR instrument, first 42℃ for 15min, then 95℃ for 30s, and end the reverse transcription reaction.

[0093] (4) The first strand cDNA of reverse transcription can be immediately used for fluorescence quantitative PCR amplification experiment, or can be stored in a-20℃ refrigerator for standby.

[0094] Example 3 Fluorescent quantitative PCR reaction system

[0095] (1) The cDNA obtained in Example 2 was used for the qPCR reaction system, which was carried out using 2x Universal Blue SYBR Green qPCR Master Mix (MPC2407073) of Servicebio, and the system configuration was as follows.

[0096] Table 3 Fluorescent quantitative PCR reaction system

[0097]

[0098] (2) The primer sequences for detecting the target circRNA and the internal reference in the above table are shown in Table 4.

[0099] Table 4 Forward primer and reverse primer characteristics table

[0100]

[0101]

[0102] (3) The prepared qRT-PCR solution was added to a real-time fluorescent quantitative PCR instrument (Tianlong) for reaction, and the reaction conditions for detecting the target circRNA in the above table were shown in Table 5.

[0103] Table 5 Fluorescent quantitative PCR conditions

[0104] circRNA name pre-denaturation denaturation annealing extension cycle number hsa_circ_0005986 95℃，30s 95℃，5s 53℃，30s 72℃，30s 40 hsa_circ_0067531 95℃，30s 95℃，5s 53℃，30s 72℃，30s 40 hsa_circ_0000839 95℃，30s 95℃，5s 57℃，30s 72℃，30s 40 hsa_circ_0039411 95℃，30s 95℃，5s 53℃，30s 72℃，30s 40 hsa_circ_0003489 95℃，30s 95℃，5s 53℃，30s 72℃，30s 40 β-actin 95℃，30s 95℃，5s 60℃，30s 72℃，30s 40

[0105] (4) Data statistics: the data statistics analysis was carried out by IBM SPSS Statistics 21, the diagnostic value of the marker was evaluated by ROC curve, and the joint diagnostic value of the five kinds of circRNA involved in the kit of the application for liver cancer patients was analyzed by logistic regression.

[0106] (5) Result analysis: according to the statistical analysis of the above method of the application, it was found that:

[0107] ① hsa_circ_0005986 had a certain diagnostic value for liver cancer patients ( Figure 1 ), that is, when △Ct≥8.8803, it was judged as positive (i.e. liver cancer patient), otherwise negative. The specific sensitivity and specificity were shown in Table 6.

[0108] ② hsa_circ_0067531 had a certain diagnostic value for liver cancer patients ( Figure 2 ), that is, when △Ct≥10.7745, it was judged as positive (i.e. liver cancer patient), otherwise negative. The specific sensitivity and specificity were shown in Table 6.

[0109] ③hsa_circ_0000839 has certain diagnostic value for liver cancer patients Figure 3 ), that is, when ΔCt≥7.1355, it is judged as positive (i.e. liver cancer patient), otherwise negative. The specific sensitivity and specificity are shown in Table 6.

[0110] ④hsa_circ_0039411 has certain diagnostic value for liver cancer patients Figure 4 ), that is, when ΔCt≤14.8947, it is judged as positive (i.e. liver cancer patient), otherwise negative. The specific sensitivity and specificity are shown in Table 6.

[0111] ⑤hsa_circ_0003489 has certain diagnostic value for liver cancer patients Figure 5 ), that is, when ΔCt≤3.6353, it is judged as positive (i.e. liver cancer patient), otherwise negative. The specific sensitivity and specificity are shown in Table 6.

[0112] ⑥When the five circRNAs studied in the application are combined as diagnostic indicators for liver cancer, the Logistics regression model is

[0113] The prediction probability value Y = 0.231-1587.393×hsa_circ_0005986-743.344×hsa_circ_0067531+82.082×hsa_circ_0000839+28494.329×hsa_circ_0039411+42.705×hsa_circ_0003489, wherein hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489 are the expression amounts (2 -△Ct value) of each circRNA, indicating that when the Y value≥0.5105804, that is, the prediction probability value is greater than or equal to 0.5105804, it is judged as positive (i.e. liver cancer patient), otherwise negative. Compared with using a single detection indicator, the diagnostic value is significantly improved Figure 6 , and the specific sensitivity and specificity are shown in Table 6.

[0114] Table 6 Area under ROC curve and sensitivity and specificity

[0115]

[0116] Example 4 Comparison of different combinations of circRNAs

[0117] In addition to the 5 circRNAs, the present application further explores hsa_circ_0000976, hsa_circ_0003620, hsa_circ_0000284, and when beta-actin is used as an internal reference, their AUC values are 0.7316, 0.8055, and 0.7764, respectively, and the P value is less than 0.0001( Figure 7 ).

[0118] (1) The combination of the 5 circRNA joint groups and hsa_circ_0000976, hsa_circ_0003620, and hsa_circ_0000284 has a certain diagnostic value for liver cancer, with an AUC of 0.935, a sensitivity of 0.855, and a specificity of 0.949( Figure 8 ).

[0119] (2) The combination of 3 circRNAs (circ_0005986, hsa_circ_0067531, and hsa_circ_0000839) in the 5 circRNA joint groups and hsa_circ_0003620, hsa_circ_0000284, and the like 5 circRNAs has an AUC of 0.8111, a sensitivity of 0.927, and a specificity of 0.627( Figure 9 ).

[0120] (3) The combination of 2 circRNAs (hsa_circ_0005986 and hsa_circ_0067531) in the 5 circRNA joint groups and hsa_circ_0000976, hsa_circ_0003620, hsa_circ_0000284, and the like 5 circRNAs has an AUC of 0.791, a sensitivity of 0.927, and a specificity of 0.61( Figure 10 ).

[0121] In summary, through R language 4.2.2, Prism, and IBM SPSS Statistics 21 software for data statistical analysis, combined with the contribution of each circRNA marker, the present application finally determines that the 5 circRNA joint groups of hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411, and hsa_circ_0003489 have a significantly better diagnostic value for liver cancer.

[0122] ​​​​Example 5 verifies the diagnostic performance of the circRNA combined panel

[0123] The present application takes the verification sample to carry out the experiment, in order to further verify the diagnostic performance of 5 circRNA combined panels for liver cancer patients.

[0124] According to the above detection steps, the sample is tested:

[0125] Sample 1: The CT value of hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489 and the CT value of the internal reference β-actin were detected by fluorescence quantification respectively (taking the average value of three repeated holes), and the indicators were 21.09, 25.67, 22.147, 32.184, 20.738 and 15.251 respectively. The 2 -△C t values were 0.002184, 0.00073, 0.008398, 0.000008 and 0.022297 respectively, the prediction probability value obtained by binary Logistics regression was 0.12909, and the diagnostic standard Cut off value was 0.5105804. Therefore, it is judged that it is not a liver cancer patient.

[0126] Sample 2: The CT value of hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489 and the CT value of the internal reference β-actin were detected by fluorescence quantification respectively (taking the average value of three repeated holes), and the indicators were 30.397, 28.936, 27.967, 31.504, 24.806 and 17.778 respectively. The 2 -△Ct t values were 0.00016, 0.000441, 0.000863, 0.000074 and 0.007714 respectively, the prediction probability value obtained by binary Logistics regression was 0.89642, and the diagnostic standard Cut off value was 0.5105804. Therefore, it is judged that it is a liver cancer patient.

[0127] Sample 3: The CT value of hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489 and the CT value of the internal reference β-actin were detected by fluorescence quantification respectively (taking the average value of three holes), the indicators were 24.186, 25.522, 23.59, 30.389, 18.699 and 13.246 respectively, and the 2 -△Ct The values were 0.000509, 0.000202, 0.00077, 0.000007, and 0.022829 respectively, and the prediction probability value obtained by binary Logistics regression was 0.6249, and the diagnosis standard Cut off value was 0.5105804. Therefore, it was judged to be a liver cancer patient.

[0128] More sample results are shown in the following table

[0129] Table 7 Diagnosis of 5 circRNA combined groups in verification samples

[0130]

[0131]

[0132] Table 8 Diagnosis efficiency of 5 circRNA combined groups in verification samples

[0133]

[0134] Meanwhile, the different 5 circRNA combinations in Example 4-(2) and Example 4-(3) were verified. Through binary Logistics regression analysis, the Cut off values of the 5 circRNA groups in Example 4-(2) and Example 4-(3) were 0.3943533 and 0.4003889 respectively.

[0135] Table 9 Diagnosis of 5 circRNA combinations in Example 4-(2) in verification samples

[0136]

[0137]

[0138] Table 9 Diagnosis efficiency of 5 circRNA combinations in Example 4-(2) in verification samples

[0139]

[0140] Table 10 Diagnostic performance of the 5 circRNA combinations in Example 4-(3) in the validation samples

[0141]

[0142]

[0143] Table 11 Diagnostic performance of the 5 circRNA combinations in Example 4-(3) in the validation samples

[0144]

[0145] The above describes the preferred embodiments of the present application. It should be noted that, for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, which should also be considered as the protection scope of the present application.

Claims

1. A circRNA-based molecular marker combination comprising hsa_circ_0005986 and hsa_circ_0067531.

2. The molecular marker combination according to claim 1, further comprising one, two or more selected from hsa_circ_0000839, hsa_circ_0039411, hsa_circ_0003489, hsa_circ_0003620, hsa_circ_0000284 and hsa_circ_0000976.

3. The molecular marker combination according to claim 1 or 2, comprising hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489; Preferably, the nucleotide sequence of the cDNA of hsa_circ_0005986 is SEQ ID NO: 1; and / or, the nucleotide sequence of the cDNA of hsa_circ_0067531 is SEQ ID NO: 2; And / or, the nucleotide sequence of the cDNA of hsa_circ_0000839 is SEQ ID NO: 3; And / or, the nucleotide sequence of the cDNA of hsa_circ_0039411 is SEQ ID NO: 4; And / or, the nucleotide sequence of the cDNA of hsa_circ_0003489 is SEQ ID NO: 5; and / or, the nucleotide sequence of the cDNA of hsa_circ_0000976 is SEQ ID NO: 24; and / or, the nucleotide sequence of the cDNA of hsa_circ_0003620 is SEQ ID NO: 25; And / or, the nucleotide sequence of the cDNA of hsa_circ_0000284 is SEQ ID NO:

26. The molecular marker combination according to claim 1 , further comprising an internal reference β-actin.

5. Use of the molecular marker according to any one of claims 1 to 4 in the preparation of a diagnostic kit for detecting liver cancer.

6. A diagnostic kit for liver cancer, comprising a PCR reaction system; the PCR reaction system comprises a primer pair designed for any molecular marker in the molecular marker combination according to any one of claims 1 to 4; The molecular marker combination is selected from: 1) hsa_circ_0005986 and hsa_circ_0067531; 2) hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411 and hsa_circ_0003489; 3) hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0003620 and hsa_circ_0000284; 4)hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000976, hsa_circ_0003620 and hsa_circ_0000284 5) hsa_circ_0005986, hsa_circ_0067531, hsa_circ_0000839, hsa_circ_0039411, hsa_circ_0003489, hsa_circ_0000976, hsa_circ_0003620 and hsa_circ_0000284.

7. The diagnostic kit according to claim 6, wherein The primer pair for hsa_circ_0005986 comprises a forward primer with a nucleotide sequence of SEQ ID NO.6 and a reverse primer with a nucleotide sequence of SEQ ID NO.7; and / or, The primer pair for hsa_circ_0067531 comprises a forward primer with a nucleotide sequence of SEQ ID NO.8 and a reverse primer with a nucleotide sequence of SEQ ID NO.9; and / or, The primer pair for hsa_circ_0000839 comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.10 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.11; and / or, The primer pair for hsa_circ_0039411 comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.13; and / or, The primer pair for hsa_circ_0003489 comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.15; and / or, The primer pair for hsa_circ_0000976 comprises a forward primer with a nucleotide sequence of SEQ ID NO.18 and a reverse primer with a nucleotide sequence of SEQ ID NO.19; and / or, The primer pair for hsa_circ_0003620 comprises a forward primer with a nucleotide sequence of SEQ ID NO.20 and a reverse primer with a nucleotide sequence of SEQ ID NO.21; and / or, The primer pair for hsa_circ_0000284 includes a forward primer with a nucleotide sequence of SEQ ID NO.22 and a reverse primer with a nucleotide sequence of SEQ ID NO.

23.

8. The diagnostic kit according to claim 6 or 7, wherein It also comprises an internal reference primer pair for an internal reference marker, wherein the internal reference marker is β-actin; preferably, the internal reference primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.16 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.

17.

9. The diagnostic kit according to any one of claims 6 to 8, wherein The PCR reaction system also includes SYBRGreen mixed solution, forward primer solution, reverse primer solution and pure water; Preferably, the total volume of the PCR reaction system is 20 μL; The volume of the SYBR Green mixture is 10 μL, the volume of the forward primer solution is 0.4 μL, the volume of the reverse primer solution is 0.4 μL, the volume of the cDNA template is 2 μL, and the rest is nuclease-free pure water; the concentration of the forward primer solution is 10 μM, the concentration of the reverse primer solution is 10 μM; the DNA template is the original solution after the reverse transcription reaction system reaction; Preferably, the PCR reaction conditions are: 40 cycles of pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing at 53°C for 30 s, and extension at 72°C for 30 s were performed.

10. The diagnostic kit according to any one of claims 6 to 9, further comprising a reverse transcription reaction system; preferably, the reverse transcription reaction system comprises gDNA Remover, 4×RT Master Mix and Nuclease-free ddH2O.

Images