Method for detecting in-situ release RNA of exosome based on rolling circle replication amplification

Abstract

The invention discloses a method for detecting in-situ release of RNA by exosome based on rolling circle replication amplification, and belongs to the technical field of exosome detection. The invention designs and develops a detection probe taking a sulfydryl hairpin probe and a Padlock probe as core components, the sulfydryl hairpin probe can target an exosome membrane protein CD63, and after substances such as the Padlock probe and Phi 29 DNA polymerase are added, an RCA amplification reaction is initiated. Triton X-100 can punch an exosome membrane so that the exosome membrane can release miRNA located in the exosome membrane, and the miRNA is combined with an amplification chain to release a hidden G4 chain body sequence. The added Hemin is combined with the G4 to form a G4 conjoined compound, and the compound can display peroxidase catalytic activity and can catalyze H2O2 to be decomposed to generate oxygen free radicals, so that a detectable signal is generated. The detection method provided by the invention can be used for carrying out high-sensitivity detection on the low-concentration exosome miRNA.

Description

Technical Field

[0001] The present invention belongs to the technical field of exosome detection, and specifically relates to a method for detecting in situ release of RNA from exosomes based on rolling circle replication amplification. Background Art

[0002] Exosomes are tiny vesicles secreted by cells. As an important tool for intercellular communication, they play a key role in physiological and pathological processes. They are highly stable and can resist degradation by enzymes such as nucleic acids and proteases in complex body fluid environments, thereby ensuring the integrity of the biomolecules they carry (such as proteins and nucleic acids). Exosomal RNA is one of the important biomolecules carried by exosomes and is involved in various physiological and pathological processes, including tumorigenesis, progression of neurodegenerative diseases, and immune regulation. Therefore, the precise detection of RNA released in situ by exosomes is of great significance for understanding the mechanisms of intercellular signaling, achieving early diagnosis of diseases, and evaluating prognosis.

[0003] Exosomal miRNAs have shown great potential as markers in diseases such as cancer, neurodegenerative diseases, and immune abnormalities. In the early stages of a disease (such as the budding stage of a tumor), the abundance of exosomal RNA released by diseased cells is extremely low, and its release process is closely related to the complex physiological microenvironment (such as the tumor microenvironment and tissue space). Traditional detection is difficult to meet the requirements of high sensitivity and in situ analysis and is prone to missed detection. In addition, the first step in existing exosomal miRNA analysis is to extract and enrich miRNAs in exosomes. The extraction process is relatively difficult and is easily degraded by nucleases in body fluids. In addition, the enrichment efficiency is low and the integrity of the exosomes is easily destroyed. These factors increase the difficulty of detection.

[0004] In recent years, RCA technology has been gradually applied to the field of exosome detection, but it still faces challenges in detecting exosome RNA: on the one hand, the RNA released by exosomes is mostly short-chain nucleic acids, which are difficult to directly use as templates to initiate RCA reactions. Special probes need to be designed to achieve efficient cyclization and improve detection sensitivity; on the other hand, background interference in complex biological samples (such as nonspecific nucleic acids and proteins) may affect the specificity of the RCA reaction, resulting in distortion of the detection signal.

[0005] Therefore, in view of the need to detect RNA in exosomes, developing a detection method that is both specific and capable of capturing trace amounts of exosome RNA has become a technical problem that needs to be urgently solved in this field. Summary of the Invention

[0006] In view of the above-mentioned prior art, the purpose of the present invention is to provide a method for detecting RNA released in situ from exosomes based on rolling circle replication amplification.

[0007] To achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a probe combination for detecting RNA released in situ from exosomes based on rolling circle replication amplification, wherein the probe combination comprises a thiol hairpin probe (SH-HP) and a Padlock probe (padlock probe), and the nucleotide sequence of the thiol hairpin probe is shown in SEQ ID NO. 1, and is specifically as follows:

[0009] SEQ ID NO.1:

[0010] SH-TTTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTTTTTCAGGG GTG.

[0011] The nucleotide sequence of the Padlock probe is shown in SEQ ID NO.2, and is as follows:

[0012] SEQ ID NO.2:

[0013] TCTAGCACCGACACACCCCTGAGTTGGGTAGCTTATCAGACTGATGTTGACCCA ACCCGCCCTACCCGTAACTGTTTCCT.

[0014] The term "exosomes release RNA in situ" refers to the release of RNA molecules carried by exosomes in a specific cell or tissue environment.

[0015] In a second aspect, the present invention provides the use of the above-mentioned probe combination in the preparation of a product for detecting RNA released in situ from exosomes.

[0016] Preferably, the product type for detecting the in situ release of RNA from exosomes is: a kit for detecting the in situ release of RNA from exosomes or a biosensor for detecting the in situ release of RNA from exosomes.

[0017] In a third aspect, the present invention provides a kit for detecting RNA released in situ from exosomes, the kit comprising the above-mentioned probe combination.

[0018] The kit further comprises: 2×T4 buffer, 2×T4 ligase, Phi29 buffer, Phi29 polymerase, dNTPs, Triton X-100, Hemin and ABTS color development solution.

[0019] In a fourth aspect, the present invention provides a method for detecting the concentration of RNA released in situ from exosomes based on rolling circle replication amplification, wherein the method uses the above-mentioned kit for detecting RNA released in situ from exosomes.

[0020] The method comprises the following steps:

[0021] (1) Exosomes were extracted and RCA amplification was performed by adding 2×T4 buffer, Phi29 buffer, thiol hairpin probe, Padlock probe, ATP, and ultrapure water;

[0022] (2) Take the RCA amplification reaction product obtained in step (1), add Triton X-100 and Hemin, and incubate at 37°C for 25-30 minutes;

[0023] (3) Add ABTS colorimetric solution to the product after incubation in step (2), incubate at 37°C for 25-30 minutes, and measure the OD 420nm The absorbance at the wavelength reflects the concentration of RNA released from exosomes in situ.

[0024] In step (1), the RCA amplification reaction conditions are as follows: heating in a 95°C metal bath for 8-10 minutes, then cooling to room temperature, adding T4 ligase, Phi29 polymerase, and dNTPs, gently mixing, incubating at 37°C for 1.8-2 hours, heating again in a 95°C metal bath for 8-10 minutes, and then cooling to room temperature to complete the RCA amplification.

[0025] In step (1), the added amounts of the 2×T4 buffer, Phi29 buffer, thiol hairpin probe, Padlock probe, ATP, ultrapure water, T4 ligase, Phi29 polymerase, and dNTPs are 10 μL, 2 μL, 1 μL, 1 μL, 2 μL, 3 μL, 1 μL, 1 μL, and 1 μL, respectively.

[0026] Preferably, the concentration of the ABTS color developing solution is 10 mM.

[0027] The detection method provided by the present invention does not require the extraction of miRNA from exosomes for detection. Instead, it only targets exosomes and then, based on an RCA amplification reaction, adds Triton X-100 to perforate the exosome membrane to release the miRNA located inside. The presence of miRNA is then converted into an easily detectable colorimetric signal, enabling the detection of RNA released from exosomes in situ. The detection range of the present invention's targeted identification of exosomes is 10-30,000 exosomes / μL, with a detection limit of 7.08 exosomes / μL. The detection range of miRNA released in situ from exosomes using the method provided by the present invention is 1-10,000 pM, with a detection limit of 2.58 pM.

[0028] Beneficial effects of the present invention:

[0029] 1. The present invention designs and develops a detection probe with a thiol hairpin probe and a Padlock probe as core components. The thiol hairpin probe can target the exosome membrane protein CD63. After adding the Padlock probe and Phi 29 DNA polymerase and other substances, an RCA amplification reaction will be triggered. Triton X-100 can perforate the exosome membrane to release the miRNA located inside. The binding of miRNA to the amplified chain (also known as the RCA amplification product) will release the G4 chain sequence (GGGTAGGGCGGGTTGGG) originally hidden in the amplified chain. Hemin is added to bind to it to form a G4 chain complex. The complex can exhibit peroxidase catalytic activity and can catalyze the decomposition of H2O2 to produce oxygen free radicals, thereby generating a detectable signal. The detection method provided by the present invention can convert the presence of miRNA into an easily detectable colorimetric signal. By measuring the absorbance change of the system at a specific wavelength, high-sensitivity detection of low-concentration exosomal miRNA can be achieved, which can provide early warning of related diseases earlier than imaging or conventional biochemical indicators, thereby improving the efficiency of early diagnosis of diseases.

[0030] 2. When detecting miRNA in tumor cell exosomes, the present application is different from previous detection methods. The detection method provided by the present invention does not require the extraction of miRNA in tumor cell exosomes for measurement. Instead, it effectively captures exosomes and directly detects the miRNA concentration in exosomes through electrochemical detection, without the need for traditional RNA extraction and nucleic acid amplification processes. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the exosome RNA detection method provided by the present invention.

[0032] Figure 2 Schematic diagram of the structure of the thiol hairpin probe.

[0033] Figure 3 This is a PAGE gel electrophoresis diagram.

[0034] Figure 4 This is the ABTS concentration optimization test chart; Figure 4 A in the middle is the ABTS concentration optimization pop chart, Figure 4 Middle B is the line graph of ABTS concentration optimization.

[0035] Figure 5 It is the positive and negative control experiment detection diagram; Among them, Figure 5 A in the middle is the positive and negative control experiment pop diagram, Figure 5 Middle B is the bar graph of positive and negative control experiments.

[0036] Figure 6 is the detection limit diagram of standard miRNA-21 and miRNA in exosomes; Figure 6 A in the middle is the detection limit pop chart of standard miRNA-21, Figure 6 Middle B is the detection limit pop chart of miRNA in targeted exosomes. Figure 6 Middle C is the standard curve of the detection limit of standard miRNA-21, Figure 6 Middle C is the standard curve of the detection limit of miRNA targeting exosomes. DETAILED DESCRIPTION

[0037] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0038] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present invention, rather than to limit the scope of the present invention.

[0039] As mentioned above, high-sensitivity detection of in situ release of RNA from exosomes (i.e., direct detection of released RNA molecules in the exosome microenvironment) is of great value in early disease diagnosis and monitoring of treatment effects. Therefore, achieving specific and highly sensitive detection of exosome-derived miRNA is the focus of researchers.

[0040] Based on this, the present invention provides a method for detecting in situ release of RNA from exosomes based on rolling circle replication amplification. The present invention designs and develops a detection probe with a thiol hairpin probe and a Padlock probe as core components. The thiol hairpin probe is a single-stranded nucleic acid molecule designed as a hairpin structure, comprising complementary arms and an unpaired loop (structure such as Figure 2 The Padlock probe is a DNA polymerase (DNA)-binding protein (shown in Figure 2), which can target the exosomal membrane protein CD63, achieving specific capture of target exosomes. In the presence of target exosome molecules, the hairpin structure undergoes a conformational change, opening the hairpin arms and exposing the previously hidden RCA primer sequence (GGGGTG). Subsequently, the RCA primer binds to the Padlock probe, initiating the RCA amplification reaction under the action of substances such as Phi29 DNA polymerase, continuously generating a large number of long single-stranded DNA products.

[0041] Triton X-100 is added to the RCA amplification reaction product. Triton X-100 pores the exosome membrane, releasing the miRNA within. The miRNA then binds to the amplified strand, releasing the G4 strand sequence (GGGTAGGGCGGGTTGGG) hidden within the amplified strand. Hemin, added to the reaction, binds to the specific G4 strand sequence to form a G4 strand complex. This complex exhibits peroxidase catalytic activity, catalyzing the decomposition of H2O2 in the ABTS colorimetric solution (ABTS solution + H2O2 + H2O) to produce oxygen free radicals. These oxygen free radicals react with the ABTS solution to produce a detectable colorimetric signal. This process cleverly transforms the presence of miRNA into an easily detectable colorimetric signal. By measuring the absorbance change of the system at a specific wavelength, highly sensitive detection of low-concentration exosomal miRNA is achieved.

[0042] The experimental design of this invention first verified the feasibility of the constructed probe system in terms of structural design and functional performance. By optimizing the ABTS color development conditions and the detection limit of exosomal RNA concentration, the color development reaction was able to stably and sensitively reflect the content of exosomal miRNA. The results of positive and negative control experiments verified the specificity and accuracy of the detection method, demonstrating that the constructed system can eliminate interference from other components and specifically identify exosomal miRNA.

[0043] The detection method established in the present invention has good sensitivity, specificity and simplicity, and shows broad application prospects in exosome-related research and clinical applications.

[0044] The H2O2 concentration in the ABTS color developing solution used in the examples of the present invention is 10 μM.

[0045] Example 1: Preparation of probe

[0046] (1) Preparation of thiol hairpin probes

[0047] The thiol hairpin (SH-HP) nucleotide sequence designed by the present invention is shown in SEQ ID NO.1.

[0048] (2) Preparation of Padlock probe

[0049] The nucleotide sequence of the Padlock probe is shown in SEQ ID NO.2.

[0050] Example 2: Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) verification of probe hybridization

[0051] To evaluate the feasibility of the detection strategy, SDS-PAGE was used to examine the hybridization of the probes under ex situ conditions.

[0052] The CD63 nucleotide sequence used in this example is shown in SEQ ID NO.3, and is as follows:

[0053] SEQ ID NO.3:

[0054] TAGCATTAGTGTCACGGGAGCGAGGTGGGGTG.

[0055] 1. Experimental Methods

[0056] First, prepare samples ① to ⑥ according to the following configuration system, as follows:

[0057] Sample ①: 10 μL 5 μM thiol hairpin (SH-HP) solution;

[0058] Sample ②: 10 μL 5 μM CD63 solution;

[0059] Sample ③: 10 μL 5 μM Padlock solution;

[0060] Sample ④: 5 μL 10 μM thiol hairpin (SH-HP) solution + 5 μL 10 μM CD63 solution;

[0061] Sample ⑤: 5 μL 10 μM thiol hairpin (SH-HP) solution + 5 μL 10 μM CD63 solution + 5 μL 10 μM Padlock solution;

[0062] Sample ⑥: 1 μL 100 μM thiol hairpin (SH-HP) solution + 1 μL 100 μM CD63 solution + 1 μL 100 μM Padlock solution + 10 μL 2×T4 buffer + 2 μL Phi29 buffer + 2 μL 100 μM ATP + 3 μL ultrapure water.

[0063] After assembly, all samples were heated in a 95°C metal bath for 10 minutes to anneal. Next, 1 μL of T4 DNA ligase, 1 μL of Phi29 DNA polymerase, and 1 μL of dNTPs were added to sample ⑥, gently mixed, and incubated at 37°C for 2 hours. Subsequently, all samples were heated in a 95°C metal bath for 10 minutes again to anneal and set aside. The step-by-step assembly process of the probe hybridization was characterized using polyacrylamide gel electrophoresis (PAGE) at 110 V for 45 minutes.

[0064] 2. Experimental Results

[0065] Judging from the gel imaging test results, SH-HP, CD63 probe, and Padlock template each produced a single band. The co-existence of SH-HP and CD63 resulted in the appearance of a new band, indicating successful hybridization between the two probes. Similarly, in samples where SH-HP, CD63, and Padlock co-existed, the bands were relatively close to the top due to the larger molecular weight, indicating that the three were successfully hybridized (Padlock was only partially bound, resulting in an extra band at the bottom). In the last group, in the co-presence of SH-SP, CD63, Padlock, and Phi29 DNA polymerase, a band with almost no displacement was produced, indicating that the four probes were successfully hybridized. This observation indicates that CD63 can effectively open the DNA hairpin and can continue to amplify under the joint action of Padlock and Phi29 DNA polymerase. These findings confirm the effectiveness of this strategy in design and assembly ( Figure 3 ).

[0066] Example 3: Isolation and purification of exosomes

[0067] (1) Cell culture

[0068] Lung cancer cell line A549 cells were used and the cells were grown in a nutrient solution supplemented with 10% FBS and streptomycin (0.1 mg mL -1 ) and penicillin (0.1 mg mL -1 ) in F12K medium and cultured in a humidified incubator containing 5% CO2 at a density of 5 × 10 5 cells / mL to 2×10 6 cell / mL.

[0069] (2) Isolation and purification of exosomes

[0070] Exosomes were purified by classical differential centrifugation. Cells were cultured in exosome-free medium for 24 h, and the supernatant was collected. The supernatant was then subjected to consecutive centrifugation steps at 2000 g for 10 min and 20,000 g for 30 min, discarding the pellet each time. The resulting supernatant was filtered through a 0.22 μm filter, and the pellet was collected by centrifugation at 120,000 g in a 70Ti rotor (Beckman). The supernatant was discarded, and the pellet was resuspended in PBS and then ultracentrifuged again at 100,000 g for 70 min. The collected exosomes were used for experiments.

[0071] Example 4: Method for detecting RNA released in situ from exosomes based on rolling circle replication amplification

[0072] (1) Take 1 μL of the exosomes extracted in Example 3, add 1 μL of 100 μM thiol hairpin (SH-HP) solution, 1 μL of 100 μM Padlock solution, 10 μL of 2×T4 buffer, 2 μL of Phi29 buffer, 2 μL of 100 μM ATP and 3 μL of ultrapure water, heat in a 95°C metal bath for 10 min, and then cool to room temperature.

[0073] (2) Continue to add 1 μL T4 ligase, 1 μL Phi29 polymerase, and 1 μL dNTPs, mix gently, and incubate at 37°C for 2 h. After incubation, heat again at 95°C in a metal bath for 10 min, then cool to room temperature to complete RCA amplification.

[0074] (3) 1.5 μM Triton X-100 and 10 μL 1 mM Hemin were added to the RCA amplification product obtained in step (2) and incubated at 37°C for 30 min.

[0075] (4) The product obtained after the incubation in step (3) was diluted to 150 μL. 50 μL of the diluted product was added dropwise to a 96-well plate. 50 μL of ABTS colorimetric solution (0.5–10 mM) was added to each well in the dark. The 96-well plate was wrapped with tin foil and placed in a constant temperature incubator at 37°C for 30 minutes. The 96-well plate was placed in a microplate reader and the absorbance value was measured at a wavelength of 420 nm to draw a spectrum. A standard curve was drawn with the exosome concentration as the horizontal axis and the absorbance value as the vertical axis. The concentration of the detected exosomes can be obtained according to the standard curve.

[0076] The nucleotide sequence of the RCA amplification product mentioned in step (3) is shown in SEQ ID NO. 4, which is as follows:

[0077] SEQ ID NO.4:

[0078] AGGAAACAGTTACGGGTAGGGCGGGTTTGGGTCAACATCAGTCTGATAAGCTACCCAACTCAGGGGTGTGTCGGTGCTAGA.

[0079] Example 5: Optimization of ABTS color development solution concentration

[0080] To ensure smooth progress in subsequent ABTS color development experiments, it was necessary to optimize the concentration of the ABTS colorimetric reagent and select the concentration with the most significant effect for subsequent experiments. The ABTS colorimetric solution was diluted with PBS to a concentration gradient of 0μM, 0.1μM, 0.5μM, 0μM, 1μM, 10μM, and 50μM. The miRNA-21 standard was then tested and placed in a microplate reader for UV-visible absorption measurement.

[0081] The nucleotide sequence of the miRNA-21 standard used in this example is shown in SEQ ID NO.5, and is as follows:

[0082] SEQ ID NO.5:

[0083] UAGCUUAUCAGACUGAUGUUGA.

[0084] Note: According to the WIPOST.26 standard, uracil "U" in the nucleotide sequence of the miRNA-21 standard is represented by "T" in the sequence listing.

[0085] The experimental steps for optimizing the ABTS concentration are the same as those in Example 4, specifically as follows:

[0086] (1) Prepare the reaction sample according to the following reaction system: 1 μL 100 μM thiol hairpin (SH-HP) solution + 1 μL 100 μM miRNA-21 standard + 1 μL 100 μM Padlock solution + 10 μL 2× T4 buffer + 2 μL Phi29 buffer + 2 μL 100 μM ATP + 3 μL ultrapure water. After preparation, heat the reaction sample in a 95°C metal bath for 10 min and then cool to room temperature.

[0087] (2) Add 1 μL T4 DNA ligase, 1 μL Phi29 DNA polymerase, and 1 μL dNTPs to the reaction sample, mix gently, and incubate at 37°C for 2 h. After incubation, heat the reaction sample again in a 95°C metal bath for 10 min, then cool to room temperature.

[0088] (3) 1.5 μM Triton X-100 and 10 μL 1 mM Hemin were added to the RCA amplification product obtained in step (2) and incubated at 37°C for 30 min.

[0089] (4) The product obtained after the incubation in step (3) was diluted to 150 μL. 50 μL of the diluted product was added dropwise to a 96-well plate, and 50 μL of ABTS colorimetric solution of different concentrations (0, 0.1, 0.5, 1, 10, 50 μM) was added to each well in the dark. Three biological replicates were set for each concentration (0, 0.1, 0.5, 1, 10, 50 mM) of ABTS colorimetric solution. After wrapping the 96-well plate with tin foil, it was placed in a constant temperature box at 37 ° C for 30 minutes. The absorbance value was measured at a wavelength of 420 nm using an enzyme reader to draw a pop chart, and a line chart was drawn with the ABTS colorimetric solution concentration as the horizontal axis and the absorbance value as the vertical axis.

[0090] Figure 4 A in the middle shows the changes in UV-visible absorption spectra at different ABTS colorimetric solution concentrations (0, 0.1, 0.5, 1, 10, 50 μM). Figure 4 Zhong B further quantified the relationship between absorbance at specific wavelengths and ABTS concentration. The results showed that ABTS exhibited the most significant absorbance changes within the 0.5-10 mM range, demonstrating a good concentration dependence. The absorbance plateaued between 10 and 50 mM, suggesting that the optimal concentration was 10 mM, taking into account economic factors.

[0091] Example 6: Positive and negative control experiments

[0092] Positive control: normal addition of miRNA-21 standard + thiol hairpin (SH-HP) solution + Padlock + Phi29 polymerase + Hemin;

[0093] Negative controls: five groups without thiol hairpin (SH-HP) solution, Padlock, Phi29 polymerase, exosome sample, or Hemin.

[0094] The experimental steps were the same as those in Example 4. The concentration of the added ABTS color development solution was 10 mM.

[0095] Pop chart ( Figure 5 A) and histogram ( Figure 5 The test results in Figure B) show that the positive control group (f) in the figure has a clear absorption peak at 420 nm, while the absorption peak is almost undetectable in the other negative control groups. The test results indicate that the absorption peak cannot be detected without any of the reagents, that is, the detection method provided by the present invention can be used to specifically detect exosomal miRNA.

[0096] Example 7: Detection limit determination

[0097] 1. miRNA-21 standard detection

[0098] (1) The miRNA-21 standard was serially diluted to prepare concentrations of 0, 1, 3, 10, 30, 100, 300, 1000, 3000, 10000, and 30000 pM, respectively.

[0099] (2) The experimental steps were the same as those in Example 4. The concentration of the added ABTS colorimetric solution was 10 mM. The absorbance value at a wavelength of 420 nm was detected and a pop chart was drawn. A standard curve was drawn with the concentration of the miRNA-21 standard as the horizontal axis and the absorbance value as the vertical axis.

[0100] 2. Targeted miRNA detection in exosomes

[0101] (1) The exosome samples extracted in Example 3 were diluted in a gradient concentration to prepare concentrations of 0, 10, 30, 100, 300, 1000, 3000, 10000, 30000, and 100000 exosome / μL, respectively.

[0102] (2) The experimental steps were the same as those in Example 4. The concentration of the added ABTS colorimetric solution was 10 mM. The absorbance value was measured at a wavelength of 420 nm to draw a pop chart, and a standard curve was drawn with the exosome miRNA concentration as the horizontal axis and the absorbance value as the vertical axis.

[0103] The results of miRNA-21 detection limit analysis are as follows Figure 6 As shown, Figure A shows the changes in the UV-visible absorption spectra of 11 miRNA-21 standards with different concentrations; Figure C is the fitted standard curve of the miRNA-21 standard concentration, logC miRNA-21 It was linearly related to the absorbance, with an R2 of 0.99602 for the fitting curve. The standard curve of the miRNA-21 standard concentration was y=0.14687x+0.17093, with a detection range of 1-10000 pM and a detection limit of 2.58 pM.

[0104] Figure B shows the changes in the UV-visible absorption spectra of miRNA in exosomes at 10 different concentrations; Figure D shows the fitted standard curve of the miRNA concentration in the targeted exosomes, logC exosome It is linearly related to the absorbance, with an R2 of 0.9987 for the fitting curve. The standard curve for the concentration of miRNA targeting exosomes is y = 0.18451x - 0.07372. The detection range is 10-30,000 exosomes / μL, and the detection limit is 7.08 exosomes / μL.

[0105] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent replacements, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. A probe combination for detecting RNA released in situ from exosomes based on rolling circle replication amplification, characterized in that: The probe combination includes a thiol hairpin probe and a Padlock probe. The nucleotide sequence of the thiol hairpin probe is shown in SEQ ID NO.1, and the nucleotide sequence of the Padlock probe is shown in SEQ ID NO.

2.

2. Use of the probe combination according to claim 1 in the preparation of a product for detecting RNA released in situ from exosomes.

3. The use according to claim 2, characterized in that The product type for detecting the in situ release of RNA from exosomes is: a kit for detecting the in situ release of RNA from exosomes or a biosensor for detecting the in situ release of RNA from exosomes.

4. A kit for detecting RNA released in situ from exosomes, characterized in that: The kit comprises the probe combination according to claim 1.

5. The kit for detecting in situ release of RNA from exosomes according to claim 4, characterized in that: The kit further comprises: 2×T4 buffer, 2×T4 ligase, Phi29 buffer, Phi29 polymerase, dNTPs, Triton X-100, Hemin and ABTS color development solution.

6. A method for detecting the concentration of RNA released in situ from exosomes based on rolling circle replication amplification, characterized in that: The method uses the kit for detecting in situ release of RNA from exosomes according to claim 4 or 5.

7. The method according to claim 6, characterized in that The method comprises the following steps: (1) Exosomes were extracted and RCA amplification was performed by adding 2×T4 buffer, Phi29 buffer, thiol hairpin probe, Padlock probe, ATP, and ultrapure water; (2) Take the RCA amplification reaction product obtained in step (1), add Triton X-100 and Hemin, and incubate at 37°C for 25-30 minutes; (3) Add ABTS colorimetric solution to the product after incubation in step (2), incubate at 37°C for 25-30 minutes, and measure the OD 420nm Absorbance at wavelength.

8. The method according to claim 7, characterized in that In step (1), the RCA amplification reaction conditions are as follows: heating in a 95°C metal bath for 8-10 minutes, then cooling to room temperature, adding T4 ligase, Phi29 polymerase, and dNTPs, gently mixing, incubating at 37°C for 1.8-2 hours, heating again in a 95°C metal bath for 8-10 minutes, and then cooling to room temperature to complete the RCA amplification.

9. The method according to claim 8, characterized in that In step (1), the added amounts of the 2×T4 buffer, Phi29 buffer, thiol hairpin probe, Padlock probe, ATP, ultrapure water, T4 ligase, Phi29 polymerase, and dNTPs are 10 μL, 2 μL, 1 μL, 1 μL, 2 μL, 3 μL, 1 μL, 1 μL, and 1 μL, respectively.

10. The method according to claim 7, characterized in that In step (3), the concentration of the ABTS color developing solution is 10 mM.

Images