Biomarker TDRD6 mutation and application thereof in guiding and assisting ovum activation technology application

Abstract

The invention discloses an application of a biomarker TDRD6 mutation in an auxiliary ovum activation technology aiming at non-disease diagnosis or treatment. The mRNA CDS sequence of the TDRD6 is as shown in SEQ ID NO. 1, and the mRNA CDS sequence of the TDRD6 is as shown in SEQ ID NO. Whether the TDRD6 is mutated or not is detected, the oocyte activation capacity of sperms in the fertilization process is judged, and whether the auxiliary ovum activation technology can be applied or not is guided. The invention also discloses a method for improving the normal fertility rate, the high-quality embryo rate and the living yield by using the biomarker TDRD6 mutation, and application of the biomarker TDRD6 mutation in preparation of medicines for improving the normal fertility rate, the high-quality embryo rate and the living yield. A drug / pharmaceutical composition for improving normal fertility rate, high quality embryo rate and live yield. The TDRD6 mutation and the application indication of the TDRD6 mutation as auxiliary ovum activation are beneficial to more accurate and efficient use of an auxiliary ovum activation technology, and the TDRD6 mutation is suitable for treatment application of target people conforming to the indication and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the fields of medical biotechnology and assisted reproductive technology, and in particular relates to a biomarker TDRD6 mutation and its use in guiding the application of assisted egg activation technology, namely, the indicator TDRD6 for guiding the application of assisted egg activation and its application. Background Art

[0002] The incidence of infertility has been increasing year by year and has become the third largest disease after cancer and cardiovascular and cerebrovascular diseases. It is a major problem affecting population growth and social development. Studies have found that 20-30% of infertility cases are caused by men alone, and 50% of cases are caused by both men and women[1]. Intracytoplasmic sperm injection (ICSI) injects a single sperm into the cytoplasm of the oocyte. The fertilization rate observed after ICSI is as high as 70-80%, which solves most male infertility problems in reproductive medicine and reduces the need for donor sperm insemination for couples with severe male infertility[2]. However, although the fertilization rate of ICSI can reach at least 65%[3], 2%-3% of ICSI cycles still fail to fertilize completely and may relapse in subsequent cycles[3]. For these patients, their treating physicians will use assisted oocyte activation (AOA) technology to try to improve the situation, but such attempts often lack standard application indications.

[0003] Oocyte activation is an important process for normal fertilization. Sperm entering the oocyte releases the soluble activation factor PLCζ it carries. PLCζ induces the release of inositol 1,4,5-trisphosphate (IP3) in the oocyte. IP3 binds to the IP3 receptor on the endoplasmic reticulum, promoting the influx of a large amount of calcium ions and forming calcium ion oscillations. The high concentration of calcium ions in the cytoplasm acts as a mitotic signal, prompting the resumption of oocyte meiosis, decondensation of the sperm nucleus, recruitment of maternal RNA, and the formation of male and female pronuclei, ultimately completing oocyte activation [4,5]. Studies have shown that oocyte activation failure is an important cause of fertilization failure and poor embryo quality after ICSI [6,7]. Assisted oocyte activation technology refers to the use of mechanical, physical, or chemical stimulation to artificially induce an increase in calcium in the oocyte cytoplasm or cause calcium oscillations to activate the oocyte [8].

[0004] However, there is still insufficient evidence from the multiple randomized controlled trials published to determine the effectiveness or safety of ICSI-AOA for key reproductive outcomes in couples with previous fertilization failure.[9,10] Failure of oocyte activation may be caused by various factors, such as sperm or oocyte, so the etiology of the patient must be diagnosed first. This technology requires clear and accurate pre-application diagnostic methods and treatment indications to address the current situation of blind application of oocyte activation technology and improve its effectiveness. Summary of the Invention

[0005] In order to address the deficiencies in the existing technology, the present invention innovatively proposes an application indication for guiding assisted egg activation technology, namely, the biomarker TDRD6 mutation and its application.

[0006] This invention innovatively proposes for the first time the use of the biomarker TDRD6 mutation in assisted oocyte activation (AOA) for non-disease diagnosis or treatment purposes. The biomarker TDRD6 mutation proposed in this invention serves as an indicator for the use of AOA. The biomarker TDRD6 refers to a gene, the sequence of which is NCBI ID: NM_001010870.3. The mRNA CDS sequence of TDRD6 is shown in SEQ ID NO. 1. Mutations in the TDRD6 gene can cause sperm to fail to activate the oocyte during fertilization, ultimately leading to fertilization failure.

[0007] SEQ ID NO.1:

[0008] >lcl|NM_001010870.3_cds_NP_001010870.1_1[gene=TDRD6][db_xref=CCDS:CCDS34470.1][protein=tudor domain-containing protein 6isoform 1][protein_id=NP_001010870.1][location=245..6535][gbkey=CDS]

[0009] ATGTGCTCGACGCCCGGAATGCCGGCGCCGGGGGCCTCGCTGGCCCTGCGGGTGTCCTT

[0010] CGTGGACGTGC

[0011] ATCCCGATGTGATCCCGGTGCAGCTGTGGGGGCTGGTGGGCGAGCGGCGGGGCGAGTA

[0012] CCTGCGGCTGAG

[0013] CCGGGAAATCCAGGAAGCGGCGGCCACGCGCGGCCAGTGGGCGCTGGGCAGCGCCTC

[0014] GGCCTCGCCCGGC

[0015] GAGCTGTGCCTGGTGCAGGTCGGGCTTTTGTGGCACCGCTGCCGCGTGGTCAGCCGGC

[0016] AGGCACAGGAGA

[0017] GCCGTGTCTTCCTGCTGGACGAGGGCCGCACCATCACGGCCGGAGCAGGCTCGCTGGC

[0018] GCCTGGGCGCAG

[0019] AGAGTTCTTCAATTTGCCCTCGGAAGTGCTGGGCTGCGTGCTAGCGGGCCTGGTGCCGG

[0020] CAGGCTGCGGC

[0021] GCGGGCTCAGGCGAGCCGCCGCAGCACTGGCCCGCCGACGCCGTGGACTTCCTTAGCA

[0022] ACCTTCAGGGCA

[0023] AGGAGGTGCACGGGTGCGTCCTGGACGTGCTGCTGCTCCATCGCCTGGTCCTCCTGGAG

[0024] GTGCCTGATGT

[0025] GTTCCAACAGATGCGGGAGCTGGGCCTGGCTCGGCGGGTGCCCGACAGCCTCTTCCGTT

[0026] CGCTGCTGGAG

[0027] CGCTATCTCACAGCGGCCACTGCTAGCGTGGGCTCCGGGGTCCCGGTTCTCTCGCGAGT

[0028] CCCGCTCAAGC

[0029] AAAAGCAGCCTGGTCTGGATTACTTCTATCCCCAGCTGCAGCTGGGCGTGACGGAGGCC

[0030] GTGGTCATAAC

[0031] CCAAGTGTGCCATCCCCACCGCATTCACTGCCAGCTCCGCAGCGTCTCGCAGGAGATCC

[0032] ACCGCCTCTCC

[0033] GAGAGCATGGCCCAGGTATACCGGGGTTCCACGGGGACAGGGGATGAGAACTCTACCA

[0034] GTGCCACCTGGG

[0035] AGGAGAGGGAGGAGAGCCCAGATAAGCCGGGCTCTCCGTGTGCATCCTGTGGCCTGGA

[0036] TGGACATTGGTA

[0037] CAGAGCACTGTTGCTTGAGACTTTTCGGCCCCAGCGCTGTGCCCAGGTGCTTCATGTGG

[0038] ACTATGGAAGG

[0039] AAGGAGTTAGTGAGTTGCAGCAGCCTTCGGTACTTGCTGCCTGAATATTTTCGAATGCCG

[0040] GTGGTGACCT

[0041] ACCCTTGTGCTTTGTATGGACTCTGGGACGGTGGGAGAGGCTGGTCTCGGTCACAGGTC

[0042] GGTGACCTGAA

[0043] GACACTGATACTAGGCAAGGCAGTGAATGCAAAGATTGAATTTTATTGCTCCTTTGAGCA

[0044] TGTGTATTAT

[0045] GTCAGCCTGTATGGAGAAGATGGGATTAATCTGAACCGTGTGTTTGGAGTACAGTCGTG

[0046] TTGCTTGGCTG

[0047] ACCGAGTCCTTCAGAGCCAGGCAACAGAGGAGGAGGAACCAGAAACATCTCAGTCTCA

[0048] GTCTCCTGCTGA

[0049] AGAAGTAGATGAAGAGATTTCACTCCCAGCCTTAAGATCTATCAGGTTAAAGATGAATGC

[0050] CTTCTACGAT

[0051] GCGCAGGTAGAGTTTGTTAAAAATCCTTCTGAGTTTTGGATTAGGTTGAGGAAACACAA

[0052] TGTCACCTTCA

[0053] GTAAGCTGATGAGGAGAATGTGTGGTTTCTATTCCTCTGCCAGTAAGCTGGATGGTGTAG

[0054] TTTTGAAACC

[0055] TGAACCTGATGACCTTTGCTGTGTCAAGTGGAAAGAAAATGGTTATTATAGGGCCATAGT

[0056] CACCAAATTG

[0057] GATGACAAGAGTGTGGATGTATTCTTAGTTGACCGAGGCAATTCGGAAAATGTGGACTG

[0058] GTATGACGTAA

[0059] GGATGCTGCTTCCTCAGTTTAGGCAGCTACCAATATTGGCTGTGAAGTGCACCCTGGCTG

[0060] ATATTTGGCC

[0061] TTTGGGAAAAAACTTGGAGCCAGGAGGCAGTTTCCTTTTTAAAAAGACTGTGCTCCACA

[0062] AAGAATTAGTC

[0063] ATCCATATTCTTGATAAACAGGATCATCAATATGTTATTGAGATTCTTGACGAATCAAGAA

[0064] CAGGGAAG

[0065] AAAACATTAGTAAGGTAATTGCCCAAGCTGGATATGCCAAGTATCAGGAATTTGAAACA

[0066] AAGGAAAATAT

[0067] CCTGGTAAATGCCCACTCCCCAGGGCATGTTTCAAACCACTTTACTACGGAGAGTAACA

[0068] AAATACCTTTT

[0069] GCCAAGACTGGAGAAGGAGAGCAGAAAGCCAAGAGAGAGAATAAAACCACATCTGTT

[0070] TCAAAAGCTTTGA

[0071] GTGACACAACAGTTGTAACAAATGGTTCAACTGAACTAGTTGTGCAGGAAAAAGTGAA

[0072] AAGAGCATCTGT

[0073] TTATTTTCCTCTTATGCAGAATTGCTTGGAAATTAAGCCAGGCTCCTCTAGTAAAGGAGA

[0074] GCTGGAAGTT

[0075] GGAAGTACAGTAGAAGTCAGAGTGTCTTTATGTTGAAAACCCTGGCTATTTCTGGTGTCA

[0076] GCTGACCAGGA

[0077] ACATACAAGGACTTAAAACTCTAATGTCTGATATTCAGTACTATTGCAAAAATACAGCTG

[0078] CTCCTCACCA

[0079] GAGAAACACCCTTGCTTGTTTGGCTAAGCGAACAGTAAACAGACAGTGGTCCAGAGCA

[0080] CTTATTAGTGGG

[0081] ATACAGTCTGTGGAGCATGTCAATGTAACATTTGTAGATTATGGAGACAGAGAAATGGTA

[0082] TCTGTGAAGA

[0083] ATATTTATTCAATTAGTGAAGAATTTCTGAAGGTTAAGGCACAGGCTTTTAGGTGCAGTC

[0084] TTTATAATTT

[0085] AATTCAACCAGTTGGCCAGAATCCCTTTGTTTGGGATGTAAAGGCAATACAAGCTTTCAA

[0086] TGAATTTATA

[0087] GATAATGCATGGCAAAAAAATCTAGAATTAAAATGTACAATATTTGCTCTGGCTTCAATTA

[0088] ATGAAGAAC

[0089] TGTTTAACATTGTGGATTTGCTAACCCCCTTTCAGAGTGCATGCCATTTCTTGGTAGAAA

[0090] AGAGACTTGC

[0091] AAGACCAGTAAAACTTCAGAAGCCTTTGGAGTCCTCTGTTCAGCTACATTCCTACTTCTA

[0092] TTCTACACAT

[0093] GATATGAAAATTGGAAGTGAAGAATTAGTTTATATAACGCATATTGATGACCCTTGGACAT

[0094] TTTATTGCC

[0095] AGCTGGCAAGAAATGCAAATATTTTAGAACAGTTGTCATGTAGTATTACACAATTAAGTA

[0096] AAGTTTTGCT

[0097] GAATTTAAAAACATCTCCCTTGAACCCTGGAACCTTGTGCCTTGCCAAGTATACTGATGG

[0098] AAACTGGTAT

[0099] AGGGGCATAGTAATAGAGAAAGAGCCAAAGAAAGTCTTCTTTGTTGATTTTGGGAATAT

[0100] TTATGTAGTAA

[0101] CAAGTGATGATCTGCTTCCAATACCTAGTGATGCATATGATGTCTTACTTTTGCCCATGCA

[0102] AGCTGTCAG

[0103] ATGTTCATTATCTGATATTCCTGATCATATACCAGAAGAAGTGGTGGTGTGGTTTCAGGAG

[0104] ACTATTTTA

[0105] GATAAGTCATTGAAGGCTTTAGTTGTAGCAAAAGATCCAGATGGAACACTGATTATAGAA

[0106] CTATATGGTG

[0107] ACAATATTCAAATTAGTGCTAGTATTAATAAGAAGTTGGGGCTACTTAGTTACAAAGATAG

[0108] AATAAGAAA

[0109] AAAAGAAAGTGAAGTCCTCTGTTCTACAACTGAAACTCTTGAAGAAAAAAATGAGAAT

[0110] ATGAAGTTGCCA

[0111] TGTACAGAGTATTTAAGTAAATCAGTAGGGTACAAGTTACCTAATAAAGAAATTTTGGAA

[0112] GAGTCATATA

[0113] AACCTCAGATCAACTCATCATACAAGGAACTCAAACTTTTACAAAGTTTAACAAAAACA

[0114] AACTTAGTCAC

[0115] TCAATATCAAGACTCTGTGGGAAATAAAAATAGTCAAGTGTTTCCATTAACAACAGAAA

[0116] AGAAAGAAGAA

[0117] ATTCTGCTGAGACACCCTTGAAAACAGCAAGAGTAGAAGCTACTCTTTCAGAGAGAA

[0118] AAATAGGAGATT

[0119] CATGTGACAAAGATTTGCCTCTGAAATTTTGTGAGTTCCCACAGAAGACTATAATGCCTG

[0120] GATTTAAAAC

[0121] AACTGTATATGTTTCTCATATAAATGACCTTTCAGACTTTTATGTTCAACTAATAGAAGAT

[0122] GAAGCTGAA

[0123] ATTAGTCATCTTTCAGAGAGATTAAACAGTGTTAAAACAAGGCCCGAATATTATGTAGGT

[0124] CCACCTTTGC

[0125] AAAAGGAGATATGATATGTGCTGTTTTCCCCAGAAGATAATTTATGGTATCGTGCTGTGAT

[0126] CAAGGAGCA

[0127] ACAACCCAATGACCTTCTCTCTGTGCAGTTTATAGATTATGGCAATGTTTCTGTGGTTCAT

[0128] ACTAACAAA

[0129] ATAGGTAGGCTTGACCTTGTTAATGCAATATTGCCGGGGTTGTGCATTCATTGCTCCTTGC

[0130] AGGGATTTG

[0131] AGGTTCCTGACAATAAAAATTCTAAGAAAATGATGCATTACTTTTCCCAACGGACCAGCG

[0132] AGGCTGCAAT

[0133] AAGATGTGAATTTGTTAAATTTCAAGACAGATGGGAAGTTATTCTTGCTGATGAACATGG

[0134] GATCATAGCA

[0135] GATGATATGATTAGCAGGTATGCTCTCAGTGAAAAATCTCAAGTAGAACTTTCTACCCAA

[0136] GTAATTAAA

[0137] GTGCCAGTTCAAAGTCTGTTAACAAATCAGACATTGACACTTCAGTATTTCTTAACTGGT

[0138] ATTATCCAGA

[0139] AAAAAAAATGATAAGAGCTTATGCCACTGTGATAGATGGACCTGAGTACTTTTGGTGTCA

[0140] GTTTGCTGAT

[0141] ACGGAGAAACTTCAGTGTTTAGAAGTAGAAGTACAGACTGCTGGAGAACAGGTAGCAG

[0142] ACAGGAGAAATT

[0143] GTATCCCATGTCCTTATATTGGAGATCCTTGTATAGTAAGATACAGAGAAGATGGACATTA

[0144] TTATAGGGC

[0145] ACTTATCACTAATATTTGTGAAGATTATCTTGTATCTGTCAGGCTTGTGGACTTTGGAAAC

[0146] ATTGAAGAC

[0147] TGTGTGGACCCAAAAGCACTCTGGGCCATTCCTTCTGAACTTCTGTCGGTTCCCATGCA

[0148] AGCCTTTCCAT

[0149] GTTGCCTCTCAGGGTTTAACATTTCAGAAGGATTATGTTCTCAAGAGGGAAATGACTATT

[0150] TCTATGAAAT

[0151] AATAACAGAAGATGTGTTGGAAATAACAATACTAGAATCAGAAGGGATGTTTGTGATAT

[0152] CCCTTTAGCA

[0153] ATTGTTGACTTGAAAAGCAAAGGTAAAAGTATTAATGAGAAAATGGAGAAATATTCTAA

[0154] GACTGGTATTA

[0155] AAAGTGCTCTTCCCTATGAAAATATTGACTCAGAGATAAAGCAGACTCTTGGGTCCTACA

[0156] ATCTTGATGT

[0157] AGGACTTAAGAAATTAAGTAATAAAGCTGTACAAAATAAAATATATATGGAACAACAGAC

[0158] AGATGAGCTT

[0159] GCTGAAATAACTGAAAAAGATGTAAACATTATTGGAACCAAACCAAGTAACTTCCGTGA

[0160] CCCTAAAACTG

[0161] ATAACATTTGTGAAGGGTTTGAAAACCCCTGCAAAGATAAAATTGATACTGAGGAACTG

[0162] GAAGGTGAATT

[0163] AGAGTGCCATCTGGTTGACAAAGCAGAGTTTGATGATAAATACCTGATTACAGGATTTAA

[0164] CACATTACTA

[0165] CCACATGCTAATGAAACAAAGGAGATACTAGAACTGAATTCACTTGAGGTGCCGCTTTC

[0166] TCCTGATGATG

[0167] AATCAAAAGAATTCTTAGAACTGGAATCTATTGAGTTACAGAATTCTCTGGTGGTGGATG

[0168] AAGAAAAAGG

[0169] GGAGCTAAGCCCGGTGCCACCGAATGTGCCACTCTCCCAAGAGTGTGTCACAAAAGGC

[0170] GCCATGGAGCTA

[0171] TTTACACTGCAGCTTCCTCTCAGCTGTGAAGCTGAGAAACAGCCAGAACTAGAACTACC

[0172] TACAGCCCAGC

[0173] TGCCTTTAGATGACAAGATGGATCCTTTGTCTTTAGGAGTTAGTCAGAAAGCACAGGAAT

[0174] CCATGTGTAC

[0175] TGAGGACATGAGAAAGTCAAGTTGTGTAGAATCTTTTGATGACCAGCGCAGGATGTCAT

[0176] TGCATCTACAT

[0177] GGAGCAGATTGTGATCCTAAAACACAGAATGAAATGAATATTGGAAGAAATTTGT

[0178] AGAGTATAAAA

[0179] ACAGGGATGCCATTTCGGCATTGATGCCTTTGTTCTCTGAGGAAGAAAGCAGTGATGGA

[0180] AGCAAGCAAA

[0181] TAATGGTTTACCAGATCATATCTCAGCTCAACTACAGACACCTACACTCTGAAAGCCTT

[0182] TACTGTTGGA

[0183] TCTAAATGTGTTGTGTGGTCAAGTCTAAGAAACACATGGTCTAAATGTGAGATTTTAGAA

[0184] ACAGCTGAAG

[0185] AAGGAACAAGGGTTTTTGAACCTTTCAAATGGTATGGAGGAGAGATAGTGAACCCTGAGAT

[0186] GTCTGGAAATGG

[0187] CATACCCAAATTGGATAAGAGTCCACCTGAGAAAAGGGGTTTGGAGGTGATGGAGATTT

[0188] AA

[0189] The biomarker TDRD6 is a gene encoding a Tudor domain protein located on human chromosome 6. It is 24,052 base pairs in size and contains 5 exons. TDRD6 is present in ribonucleoprotein granules (RNP granules) in male germ cells and is specifically expressed in the testes of humans and mice. Figure 1 TDRD6 is one of the structural components of the chromatoid body (CB), a characteristic organelle of sperm. It is essential for spermatogenesis and the regulation of miRNA expression, and is closely related to the pathogenesis of oligoasthenoteratozoospermia in men.

[0190] The present invention proposes the use of the biomarker TDRD6 mutation in assisted oocyte activation (AOA) technology for non-disease diagnosis or treatment purposes. In this application, by detecting the presence of a TDRD6 mutation, the ability of sperm to activate oocytes during fertilization can be determined. The present invention can be used to guide the suitability of AOA technology. In this invention, the testing includes, but is not limited to, Sanger analysis of TDRD6 mutations and their types, or other methods.

[0191] In a specific embodiment, in the application, target patients are screened and Sanger test is performed to determine whether TDRD6 gene mutations and their types occur in male patients and whether ICSI-AOA treatment is used.

[0192] The method for detecting the biomarker TDRD6 gene mutation comprises the following steps:

[0193] Step 1: Collection of peripheral blood samples; wherein the peripheral blood samples are taken from the male patient of an infertile couple;

[0194] Step 2: extracting a genomic DNA sample from the peripheral blood sample;

[0195] Step 3: Capturing the exome of the genomic DNA sample extracted in the second step;

[0196] Step 4: Perform Sanger sequencing on the data captured in the third step to detect whether the TDRD6 gene mutation is carried and its type;

[0197] Step 5: Analyze the data captured in the third step.

[0198] In the third step, TruSeq TM The exome enrichment kit (Illumina, San Diego, USA) was used;

[0199] In the fourth step, the sequencing data is subjected to mutation detection using Sentieon software.

[0200] In a specific embodiment, the specific steps are: analyzing the sequencing data obtained in the fourth step, screening for variations and interpreting them, and then determining whether it is a TDRD6 gene mutation.

[0201] The first step is the collection of peripheral blood samples: 2 mL of peripheral blood sample is collected from the male partner of the infertile couple;

[0202] The second step is to extract a genomic DNA sample from the peripheral blood sample: preferably, QIAamp DNA Blood Maxi Kit (Qiagen, Dusseldorf, Germany) is used to extract the patient's genomic DNA sample from the peripheral blood sample;

[0203] The third step is to capture the exome of the genomic DNA sample extracted in the second step: preferably using TruSeq TM Genomic DNA samples were extracted from peripheral blood samples using an exome enrichment kit (Illumina, San Diego, USA);

[0204] The fourth step is to perform Sanger sequencing on the exome captured in the third step.

[0205] The fifth step is to analyze the sequencing data obtained in the fourth step: preferably, the sequencing data is subjected to mutation detection using Sentieon software to determine whether it is a TDRD6 gene mutation and its type.

[0206] The mRNA CDS sequence of TDRD6 is shown in SEQ ID NO.1.

[0207] The method for determining the ability of sperm to activate an oocyte during fertilization involves microscopically observing the oocyte within 24 hours after ICSI to determine whether two pronuclei and a second polar body are formed. If these are formed, it indicates that the oocyte has been successfully fertilized, meaning that the oocyte has been effectively activated. If these are not formed, it indicates that the oocyte has not been successfully fertilized, meaning that the oocyte has not been effectively activated. Failure to effectively activate the oocyte further indicates that the TDRD6 gene in the sperm that failed to effectively activate the oocyte has mutated.

[0208] In a specific embodiment, the present invention provides a method for detecting whether an oocyte is activated by observation, wherein the oocyte is observed under a microscope to determine whether it is successfully fertilized. Specifically, the oocyte is observed under a microscope to determine whether it is activated. If the oocyte forms two pronuclei and a second polar body within 24 hours after ICSI, it is considered to be in a normal fertilization state, indicating that the oocyte has been effectively activated.

[0209] Among them, the guidance is whether the method of assisted egg activation technology can be applied, in which the TDRD6 mutation and its type are detected by Sanger sequencing; if the test result is a TDRD6 gene mutation, it is assessed that the assisted egg activation technology can be applied.

[0210] In a specific embodiment, the method for evaluating assisted oocyte activation using TDRD6 involves detecting TDRD6 mutations and their types through Sanger sequencing of a sample obtained from a patient with a history of low fertilization rates after ICSI. If the sample is found to have a TDRD6 gene mutation, assisted oocyte activation technology can be used.

[0211] The present invention also proposes the use of the biomarker TDRD6 mutation in the preparation of a drug for improving the normal fertilization rate, the high-quality embryo rate and the live birth rate, wherein the drug is used to intervene in AOA after ICSI in sperm with the biomarker TDRD6 mutation, wherein the mRNA CDS sequence of the biomarker TDRD6 is shown as SEQ ID NO.1.

[0212] The present invention also proposes a method for improving normal fertilization rate, high-quality embryo rate and live birth rate by utilizing TDRD6 mutation. In the method, sperm with the biomarker TDRD6 mutation is subjected to AOA intervention after ICSI; wherein the mRNA CDS sequence of the biomarker TDRD6 is shown as SEQ ID NO.1.

[0213] In a specific embodiment, post-ICSI AOA treatment is performed on sperm and oocytes isolated from patients with a TDRD6 biomarker mutation. Oocytes are retrieved 32-38 hours after maturation induction or ovarian stimulation. The retrieved oocytes are washed and cultured in human tubal fluid supplemented with 10% serum replacement. Two to three hours after oocyte retrieval, the cumulus ovarian corona radiata complex (OCC) is carefully digested with hyaluronidase. The corona radiata is mechanically removed to expose the oocyte. Within two hours of detachment of the cumulus ovarian corona radiata, intracytoplasmic sperm injection (ICS) is performed under a 200x magnifying microscope (Nikon, Japan) equipped with a heating plate (37°C) and a manipulator (Narishige, Tokyo, Japan). The sperm tail is immobilized by pressing the needle tip against it. The sperm is then slowly drawn into the needle, with the needle tip aligned with the immobilized sperm tail. Gently hold the oocyte to be injected with the needle. Use the needle to rotate the oocyte so that the polar body is positioned at the 6 or 12 o'clock position, then secure the oocyte with suction. Gently press the needle against the oocyte to ensure the oocyte and needle are aligned. Gently push the leading sperm into the needle opening and insert the needle into the oocyte at the 3 o'clock position, approximately two-thirds of the oocyte's diameter. Before sperm ejaculation, aspirate the cytoplasm until it rapidly flows through the needle. Immediately, inject the sperm, along with the aspirated cytoplasm, into the oocyte. Once the sperm head enters the cytoplasm, gently withdraw the needle from the oocyte. One hour after ICSI, transfer the oocyte to the prepared activation reagent using a Pasteurized capillary tube. Time for 10 minutes to induce artificial activation. Remove the oocytes from the activation reagent and rinse several times in human oviductal fluid supplemented with 10% serum replacement without the activation reagent. Return the oocytes to the embryo culture growth plate and store in an incubator at 37°C and 5% CO2. Fertilization should be checked 12-20 hours after injection, and embryo development and grade should be recorded daily.

[0214] The present invention also provides a drug / pharmaceutical composition for improving normal fertilization rates, high-quality embryo rates, and live birth rates. The drug / pharmaceutical composition is used to intervene in post-ICSI AOA in sperm harboring the biomarker TDRD6 mutation. Specifically, the drug / pharmaceutical composition comprises an assisted oocyte activation reagent / AOA reagent, which includes ionomycin and DMSO. Other suitable components may also be included.

[0215] The AOA reagent is 10 μM ionomycin (Sigma, St. Louis, MO, USA). Ionomycin is a common calcium ion carrier, generally produced by Streptococcus bacteria, which can bind to Pb 2+and Ca 2+ As an effective mobile carrier of these two cations, it can rapidly and controllably induce an increase in intracellular calcium levels across the cell membrane. Therefore, it is widely used in cell biology research and is a tool for studying calcium signaling and the downstream effects of calcium signaling pathways. To prepare the activator working solution: Dissolve 1mg of Sigma's ionomycin powder in DMSO and aliquot into 1.5ml EP tubes, with each tube containing 10μl (0.01μmol ionomycin / tube). Store in a -20°C freezer. When used, add 990μl of human fallopian tube fluid supplemented with 10% serum replacement to each tube, resulting in a final concentration of 10μmol / L of the prepared activating reagent. Dimethyl sulfoxide (DMSO) is a sulfur-containing organic compound and a polar aprotic solvent with the chemical formula (CH3)2SO. In experimental research, it is primarily used as a solvent for chemical reactions and as a freezing medium to protect cells from mechanical damage induced by ice crystals.

[0216] In a specific embodiment, the present invention, compared with no AOA intervention, the use of AOA using TDRD6 mutation as a guide has a significant improvement in the outcome of ICSI cycles in patients, as reflected in the following major clinical outcome indicators: normal fertilization rate, high-quality embryo rate, and live birth rate. In a specific implementation plan, for example: a patient had 11 mature eggs, 3 normal fertilizations, 0 high-quality embryos, a normal fertilization rate of 27.3%, and a high-quality embryo rate of 0% in a previous ICSI cycle; in a cycle treated with ICSI-AOA, the patient had 5 mature eggs, 3 normal fertilizations, 1 high-quality embryo, a normal fertilization rate of 60%, and a high-quality embryo rate of 33.3%; another patient had 21 mature eggs, 3 normal fertilizations, 0 high-quality embryos, a normal fertilization rate of 14.3%, and a high-quality embryo rate of 0% in a previous ICSI cycle; in a cycle treated with ICSI-AOA, the patient had 22 mature eggs, 19 normal fertilizations, 5 high-quality embryos, a normal fertilization rate of 86.4%, and a high-quality embryo rate of 26.3%. The patient became pregnant after transplantation and had a live birth.

[0217] The above-mentioned application, or the above-mentioned method, or the above-mentioned medicine / drug composition is characterized in that the oocyte includes granulosa cells, derived from follicular fluid or from culture medium; and / or the oocyte is capable of producing a viable pregnancy after fertilization; and / or the TDRD6 gene mutation includes heterozygous mutations c.A1256G (p.Y419C) and c.1550_1553delinsT (p.R519del), a homozygous mutation combined with a frameshift mutation c.3026_3027delinsC (p.N1010Ifs*3), and the mutant sequence is shown in SEQ ID NO.2-SEQ ID NO.4.

[0218] The biomarker provided by the present invention, namely the indicator TDRD6 mutation, can be used as one of the reference factors not used for treatment or diagnosis, for genetic testing and evaluation of test samples taken from patients with previous ICSI failure, low fertilization rate or poor embryo quality, to screen the target population, which helps to solve the problems of the current technology application due to the lack of parameters for relevant accurate pre-application diagnostic methods and treatment indications, and greatly reduces the phenomenon of blind application. And under the precise guidance of the application of this indicator TDRD6 mutation, the use and post-use effects of assisted egg activation technology are effectively improved and improved. In specific embodiments, for example, the patient's fertilization outcome and embryo outcome are improved. The biomarker TDRD6 mutation of the present invention and its application indication as an assisted egg activation help to make the use of oocyte activation technology more accurate and efficient, and are suitable for therapeutic applications in target populations that meet this indication. The present invention is suitable for use in assisted egg activation technology for the purpose of diagnosing or treating male infertility. The present invention has broad application prospects.

[0219] In the present invention,

[0220] The term intracytoplasmic sperm injection (ICSI) refers to the technique of micromanipulating a single sperm into the cytoplasm of an oocyte. ICSI is currently the most effective treatment for male infertility, such as severe oligoasthenozoospermia. Fertilization rates after ICSI can exceed 65%.

[0221] The term assisted oocyte activation (AOA) refers to techniques that rapidly increase cytoplasmic calcium concentration, generating calcium oscillations and ultimately activating oocytes, through methods including calcium ionophores (including ionomycin and calcium ionomycin [A23187]), mechanical stimulation, electrical stimulation, and strontium chloride (SrCl2). AOA is currently the most commonly used treatment for partial and complete fertilization failure following ICSI.

[0222] The term Sanger assay refers to a DNA sequencing technique that uses DNA polymerase and specially labeled dNTPs to synthesize DNA chains and separate DNA fragments of different lengths by electrophoresis to determine the DNA sequence.

[0223] Normal fertilization rate = number of normally fertilized eggs / number of mature eggs × 100%. Normal fertilization of oocytes undergoing ICSI-AOA is characterized by the formation of two pronuclei and a second polar body within 24 hours after ICSI. Mature oocytes are MII oocytes.

[0224] The term "high-quality embryo rate" equals the number of high-quality embryos divided by the total number of cleavage embryos. Embryo quality is assessed 48-72 hours after oocyte retrieval using a cleavage-stage embryo scoring system. Cleavage-stage embryos are categorized into four grades based on cell size, number, and fragmentation: Grade I embryos: Regular cell morphology, uniform size, clear cytoplasm, and <10% fragmentation; Grade II embryos: Slightly irregular cell morphology, slightly uneven size, 10%-20% fragmentation; Grade III embryos: Irregular cell morphology, significantly uneven size, granular cytoplasm, and 20%-30% fragmentation; Grade IV embryos: Severely irregular cell morphology, severely uneven size, uneven granular cytoplasm, and >30% fragmentation. Grade I and II embryos are considered high-quality embryos. High-quality embryo transfer can improve clinical pregnancy and live birth rates, while low-quality embryo transfer is associated with higher miscarriage rates and lower ongoing pregnancy rates.

[0225] The term live birth rate = number of cycles with live birth / number of transfer cycles.

[0226] The terms "comprise" and "include" in the present invention are open expressions, that is, they include the contents specified in the present invention but do not exclude other aspects.

[0227] As used herein, the term "about" when applied to a value means allowing some slight imprecision in the value in the calculation or measurement (approximately or reasonably close to the value; nearly).

[0228] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items. BRIEF DESCRIPTION OF THE DRAWINGS

[0229] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without paying any creative work.

[0230] Figure 1 TDRD6 is specifically expressed in human and mouse testes. The data comes from the database: https: / / www.proteinatlas.org / ENSG00000180113-TDRD6 / tissue.

[0231] Figure 2 Figures 1 and 2 show the heterozygous mutations c.A1256G (p.Y419C) (mutation 1) and c.1550_1553delinsT (p.R519del) (mutation 2) of Example 1.

[0232] Figure 3This is a diagram of the homozygous mutation combined with the frameshift mutation c.3026_3027delinsC (p.N1010Ifs*3) (mutation 3) of Example 2. DETAILED DESCRIPTION

[0233] The invention will be further described in detail with reference to the following specific examples and accompanying drawings. The process, conditions, experimental methods, etc. for implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the field, and the present invention has no special restrictions. The protection content of the present invention is not limited to the following examples. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the appended claims. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. The following description of at least one exemplary embodiment is actually only illustrative and is in no way intended to limit the present invention and its application or use.

[0234] In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary, rather than limiting. Therefore, other examples of the exemplary embodiments may have different values. The present invention will be further explained below by way of non-limiting examples. The test materials used in the examples, unless otherwise specified, are conventional biochemical reagents.

[0235] The present invention relates to the field of medical assisted reproductive technology and discloses the use of a biomarker, TDRD6 mutation, in assisted oocyte activation (AOA) techniques for non-disease diagnosis or treatment. The sequence of TDRD6 is shown in SEQ ID NO. 1. By detecting whether TDRD6 is mutated, the ability of sperm to activate oocytes during fertilization can be determined, thereby providing guidance on whether AOA techniques are suitable. The present invention also provides a method for using the biomarker TDRD6 mutation to improve normal fertilization rates, high-quality embryo rates, and live birth rates; a use of the biomarker TDRD6 mutation in the preparation of a drug for improving normal fertilization rates, high-quality embryo rates, and live birth rates; and a drug / drug composition for improving normal fertilization rates, high-quality embryo rates, and live birth rates. The biomarker TDRD6 mutation and its use as an indication for AOA help make AOA techniques more precise and efficient, and are suitable for therapeutic applications in target populations meeting this indication. The present invention has broad application prospects.

[0236] The present invention constructs an application indication TDRD6 that can be used to guide assisted egg activation.

[0237] In this invention, a series of related tests are performed to conduct genetic diagnosis on patients who have previously failed IVF or ICSI fertilization or have poor embryo quality. Assisted egg activation technology is then performed on the target population that meets the application indications. The specific technical process is as follows:

[0238] 1. Screening target patients: infertile men with complete failure of IVF or ICSI fertilization, low fertilization rate (<30%) or poor embryo quality.

[0239] 2. Sanger sequencing to detect TDRD6 gene mutation in male patients: Peripheral blood samples were collected from patients, and genomic DNA samples were extracted from the peripheral blood samples using QIAamp DNA Blood Maxi Kit (Qiagen, Dusseldorf, Germany). Exome capture was performed using TruSeq TM Exome enrichment kit (Illumina, San Diego, USA) was used to detect TDRD6 coding region mutations and their types in blood samples by polymerase chain reaction (PCR) and Sanger sequencing.

[0240] The sequence of TDRD6 is shown in SEQ ID NO.1.

[0241] The sequence of TDRD6 mutation 1 is shown in SEQ ID NO. 2, and the sequence of TDRD6 mutation 2 is shown in SEQ ID NO. 3. Example 1: Heterozygous mutations c.A1256G (p.Y419C) (mutation 1) and c.1550_1553delinsT (p.R519del) (mutation 2), see Figure 2 .

[0242] SEQ ID NO.2:

[0243] ATGTGTGTTATGTCAGC

[0244] SEQ ID NO.3:

[0245] AGCTGATGAGAATGAGG

[0246] The sequence of TDRD6 mutation 3 is shown in SEQ ID NO. 4. Example 2: Homogeneous mutation combined with frameshift mutation c.3026_3027delinsC (p.N1010Ifs*3) (mutation 3), see Figure 3 .

[0247] SEQ ID NO.4:

[0248] GAAATGCAATATTTTAGA

[0249] 3. ICSI-AOA Intervention: Oocyte retrieval is performed 32-38 hours after induction of maturation or ovarian stimulation. The retrieved oocytes are washed and cultured in human tubal fluid supplemented with 10% serum replacement. Two to three hours after oocyte retrieval, the cumulus ovarian complex, the outer layer of the cumulus ovarian complex, is carefully digested with hyaluronidase. The corona radiata is mechanically removed to expose the oocyte. Within two hours of detachment of the cumulus ovarian complex and corona radiata, intracytoplasmic sperm injection (ICSI) is performed under a 200x magnifying microscope (Nikon, Japan) equipped with a heating plate (37°C) and a manipulator (Narishige, Tokyo, Japan). The tip of the injection needle is pressed against the tail of the sperm and the needle is quickly passed over the tail to immobilize the sperm. The needle tip is aligned with the tail of the immobilized sperm and the sperm is gently drawn into the injection needle. The oocyte to be injected is gently held with the needle. The oocyte is rotated with the injection needle to position the polar body at the 6 or 12 o'clock position, and the oocyte is then firmly aspirated. After gently pressing the needle against the oocyte to ensure alignment, the leading sperm is gently pushed into the needle opening. The needle is then inserted into the oocyte at the 3 o'clock position, approximately two-thirds of the oocyte diameter. Prior to sperm ejaculation, the cytoplasm is aspirated until it rapidly flows through the needle. The sperm, along with the aspirated cytoplasm, is then immediately injected into the oocyte. Once the sperm head enters the cytoplasm, the needle is gently withdrawn from the oocyte. One hour after ICSI, oocytes are exposed to AOA reagent (10 μM ionomycin, Sigma, St. Louis, MO, USA) for 10 minutes and then cultured in continuous single embryo culture growth trays throughout developmental stages. Fertilization is checked 12–20 hours after injection, and embryo development and grade are recorded daily.

[0250] Example 1

[0251] Sanger sequencing revealed compound heterozygous mutations in the TDRD gene in an infertile man with teratozoospermia. The patient was treated with ICSI-AOA, which included the following steps:

[0252] Prepare the activator working solution: Dissolve 1 mg of Sigma ionomycin powder in DMSO and aliquot into 1.5 ml EP tubes, 10 μl per tube (0.01 μmol ionomycin / tube). Store in a -20°C refrigerator. Add 990 μl of human fallopian tube fluid supplemented with 10% serum replacement to each tube for a final concentration of 10 μmol / L of the activated reagent.

[0253] ICSI: Follow the routine steps in the technical protocol.

[0254] AOA: One hour after ICSI, transfer the oocytes using a Pasteurized capillary tube into the prepared activation reagent for 10 minutes to induce artificial activation. Remove the oocytes from the activation reagent and rinse several times in human oviductal fluid supplemented with 10% serum replacement without the activation reagent. Return the oocytes to the embryo culture growth plate and store in an incubator at 37°C and 5% CO2.

[0255] Fertilization observation: Check whether fertilization has occurred and whether pronuclei have been formed 12-20 hours after injection.

[0256] Embryo observation: Observe embryo cleavage daily and record embryo grade.

[0257] Embryo development of the patient treated with ICSI-AOA: 5 mature eggs, 3 of which were normally fertilized, and 1 high-quality embryo was obtained.

[0258] Example 2

[0259] A homozygous mutation in the TDRD gene was detected by Sanger sequencing in an infertile male with teratozoospermia. The patient was treated with ICSI-AOA, which included the following steps:

[0260] Prepare the activator working solution: Dissolve 1 mg of Sigma ionomycin powder in DMSO and aliquot into 1.5 ml EP tubes, 10 μl per tube (0.01 μmol ionomycin / tube). Store in a -20°C refrigerator. Add 990 μl of human fallopian tube fluid supplemented with 10% serum replacement to each tube for a final concentration of 10 μmol / L of the activated reagent.

[0261] ICSI: Follow the routine steps in the technical protocol.

[0262] AOA: One hour after ICSI, transfer the oocytes using a Pasteurized capillary tube into the prepared activation reagent for 10 minutes to induce artificial activation. Remove the oocytes from the activation reagent and rinse several times in human oviductal fluid supplemented with 10% serum replacement without the activation reagent. Return the oocytes to the embryo culture growth plate and store in an incubator at 37°C and 5% CO2.

[0263] Fertilization observation: Check whether fertilization has occurred and whether pronuclei have been formed 12-20 hours after injection.

[0264] Embryo observation: Observe embryo cleavage daily and record embryo grade.

[0265] Embryo development after ICSI-AOA: 22 mature eggs, 19 of which were fertilized normally, resulting in 5 high-quality embryos. One pregnancy occurred after transfer, resulting in a live birth.

[0266] Comparison Example 1

[0267] The data of Comparison Example 1 were derived from the embryonic development of the patient in Example 1 during the previous ICSI cycle: 11 mature eggs, 3 normal fertilizations, and 0 high-quality embryos.

[0268] Comparison Example 2

[0269] The data of Comparison Example 2 were derived from the embryonic development of the patient in Example 2 during the previous ICSI cycle: 21 mature eggs, 3 normal fertilizations, and 0 high-quality embryos.

[0270] The improvement of patient cycle outcomes by using TDRD6 as an indicator to guide assisted egg activation is shown in Table 1.

[0271] Table 1

[0272] Oocyte activation Number of mature eggs Normal fertilization rate High-quality embryo rate Example 1 AOA 5 60％ 33.3％ Comparison Example 1 Not AOA 11 27.3％ 0％ Example 2 AOA 22 86.4％ 26.3％ Comparison Example 2 Not AOA 21 14.3％ 0％

[0273] The above application results show that for patients with TDRD6 gene mutations, assisted egg activation after ICSI can improve the normal fertilization rate and high-quality embryo rate, and one patient gave birth alive.

[0274] References

[0275] [1]Vander Borght,M.,&Wyns,C.(2018).Fertility and infertility:Definition and epidemiology.Clinical biochemistry, 62, 2–10. https: / / doi.org / 10.1016 / j.clinbiochem.2018.03.012. [2] Esteves, SC, Roque, M., Bedoschi, G., Haahr, T., & Humaidan, P. (2018). Intracytoplasmic sperminjection for male infertility and consequences for offspring. Nature reviews.Urology,15(9),535–562. https: / / doi.org / 10.1038 / s41585-018-0051-8.

[0276] [3]ESHRE Special Interest Group of Embryology,&Alpha Scientists inReproductive Medicine(2017).The Vienna consensus:report of an expert meetingon the development of art laboratory performance indicators.Humanreproduction open,2017(2),hox011.https: / / doi.org / 10.1093 / hropen / hox011.

[0277] [4]Esfandiari,N.,Javed,M.H.,Gotlieb,L.,&Casper,R.F.(2005).Completefailed fertilization after intracytoplasmic sperminjection--analysis of10years'data.International journal of fertility and women's medicine,50(4),187–192.

[0278] [5]Sanusi,R.,Yu,Y.,Nomikos,M.,Lai,F.A.,&Swann,K.(2015).Rescue offailed oocyte activation after ICSI in a mouse model of male factorinfertility by recombinant phospholipase Cζ.Molecular human reproduction,21(10),783–791.https: / / doi.org / 10.1093 / molehr / gav042.

[0279] [6]Swann K.(2018).The role of Ca2+in oocyte activation during InVitro fertilization:Insights into potential therapies for rescuing failedfertilization.Biochimica et biophysica acta.Molecular cell research,1865(11PtB),1830–1837.https: / / doi.org / 10.1016 / j.bbamcr.2018.05.003.

[0280] [7]Flaherty,S.P.,Payne,D.,&Matthews,C.D.(1998).Fertilization failuresand abnormal fertilization after intracytoplasmic sperminjection.Humanreproduction(Oxford,England),13Suppl 1,155–164.https: / / doi.org / 10.1093 / humrep / 13.suppl_1.155.

[0281] [8]Liu,J.,Nagy,Z.,Joris,H.,Tournaye,H.,Devroey,P.,&Van Steirteghem,A.(1995).Successful fertilization and establishment ofpregnancies afterintracytoplasmic sperminjection in patients with globozoospermia.Humanreproduction(Oxford,England),10(3),626–629.https: / / doi.org / 10.1093 / oxfordjournals.humrep.a136000.

[0282] [9]Kashir,J.,Ganesh,D.,Jones,C.,&Coward,K.(2022).Oocyte activationdeficiency and assisted oocyte activation:mechanisms,obstacles and prospects for clinical application.Human reproduction open,2022(2),hoac003.https: / / doi.org / 10.1093 / hropen / hoac003.

[0283]

[10] Sfontouris, IA, Nastri, CO, Lima, ML, Tahmasbpourmarzouni, E., Raine-Fenning, N., & Martins, WP (2015). Artificial oocyte activation to improve reproductive outcomes in women with previous fertilization failure: asystematic review and meta-analysis of RCTs. Human reproduction(Oxford,England),30(8),1831–1841. https: / / doi.org / 10.1093 / humrep / dev136.

[0284] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the appended claims.

Claims

1. Application of the biomarker TDRD6 mutation in assisted oocyte activation technology for the purpose of non-disease diagnosis or treatment, characterized in that: The mRNA CDS sequence of TDRD6 is shown in SEQ ID NO.

1. By detecting whether TDRD6 is mutated, the ability of sperm to activate oocytes during fertilization is determined, and guidance is provided on whether assisted egg activation technology can be applied.

2. The use according to claim 1, characterized in that The method for detecting whether the TDRD6 mutation occurs comprises the following steps: Step 1: Collection of peripheral blood samples; wherein the peripheral blood samples are taken from the male patient of an infertile couple; Step 2: extracting a genomic DNA sample from the peripheral blood sample; Step 3: Capturing the exome of the genomic DNA sample extracted in the second step; Step 4: Perform Sanger sequencing on the data captured in the third step to detect whether the TDRD6 gene mutation is carried and its type; Step 5: Analyze the data captured in the third step.

3. The use according to claim 2, characterized in that The third step, using TruSeq TM Exome enrichment kit (Illumina, San Diego, USA) is used; and / or, in the fourth step, the sequencing data is subjected to mutation detection using Sentieon software.

4. The use according to claim 1, wherein The method for guiding whether assisted egg activation technology can be applied is to perform Sanger detection on the sample to be tested for TDRD6 mutation and its type; if the test result is TDRD6 gene mutation, it is assessed that assisted egg activation technology can be applied.

5. The use according to claim 1, characterized in that The method for determining the ability of sperm to activate oocytes during fertilization is to observe under a microscope whether the oocyte forms two pronuclei and a second polar body within 24 hours after ICSI; if so, it indicates that the oocyte has been successfully fertilized, that is, the oocyte has been effectively activated; if not, it indicates that the oocyte has not been successfully fertilized, that is, the oocyte has not been effectively activated; wherein the TDRD6 gene of the sperm that has not effectively activated the oocyte has a mutation; wherein the mRNA CDS sequence of the TDRD6 is shown in SEQ ID NO.

1.

6. A method for improving normal fertilization rate, high-quality embryo rate and live birth rate using the biomarker TDRD6 mutation, characterized in that: In the method, sperm with the biomarker TDRD6 mutation is subjected to AOA intervention after ICSI; wherein the mRNA CDS sequence of the biomarker TDRD6 is shown as SEQ ID NO.

1.

7. Use of a biomarker TDRD6 mutation in the preparation of a drug for improving normal fertilization rate, high-quality embryo rate, and live birth rate, wherein the drug is used to intervene in AOA after ICSI in sperm with the biomarker TDRD6 mutation, wherein: The mRNA CDS sequence of the biomarker TDRD6 is shown in SEQ ID NO.

1.

8. A drug / drug composition for improving normal fertilization rate, high-quality embryo rate and live birth rate, characterized in that: The drug / drug composition is used to intervene in AOA after ICSI on sperm with the biomarker TDRD6 mutation, wherein: The mRNA CDS sequence of the biomarker TDRD6 is shown in SEQ ID NO. 1; the drug / drug composition comprises an assisted egg activation reagent / AOA reagent; and the reagent includes ionomycin and DMSO.

9. The use according to any one of claims 1 to 5, or the method according to claim 6, or the use according to claim 7, or the medicine / pharmaceutical composition according to claim 8, characterized in that: The oocyte includes a granulosa cell, is derived from follicular fluid or is derived from a culture medium; and / or, the oocyte is capable of producing a viable pregnancy after fertilization; and / or, the mutant sequence of the TDRD6 mutation is shown in SEQ ID NO.2-SEQ ID NO.4.

Images