Mutant gene, mutant, transformant and genetic transformation plant of tobacco deoxycarboxamide lysine synthase and application of mutant gene, mutant, transformant and genetic transformation plant

Abstract

The invention is applicable to the technical field of molecular biology, and provides a mutant gene, a mutant, a transformant and a genetic transformation plant of tobacco deoxycarboxy-putrescine lysine synthase and application of the mutant gene, the mutant, the transformant and the genetic transformation plant of the tobacco deoxycarboxy-putrescine lysine synthase of the tobacco deoxycarboxy-putrescine lysine synthase of the tobacco deoxycarboxy-putrescine lysine synthase. The nucleotide sequence of the mutant gene is shown as SEQ ID NO.2 in a sequence table. After the gene is mutated, a mutant strain shows the phenotype of white veins, and various nutrients are greatly changed. According to the mutant gene of the tobacco deoxycarboxamide lysine synthase provided by the invention, by detecting the mutant and comparing the potassium content in tobacco leaves, the result shows that the mutant gene of the tobacco deoxycarboxamide lysine synthase can improve the potassium content in the tobacco leaves. Therefore, a better choice is provided for genetic improvement of new plant varieties, and the gene has important application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and particularly relates to a mutant gene of deoxyhypusine synthase in tobacco, a mutant, a transformant, a genetically transformed plant and their application. BACKGROUND

[0002] In plant cells, potassium is the most important and abundant cation. Potassium plays a very important role in many physiological processes of plants, such as enzyme activation, membrane transport, charge balance, osmotic regulation, etc. At the same time, as an important nutrient element, potassium also participates in important life activities including photosynthesis, transport and distribution of assimilates, etc., thereby having an important influence on the growth and development of plants. In the growth process of plants, the problem of insufficient potassium supply in soil often occurs. Therefore, plants have evolved a complex cell signal transduction and physiological regulation network to absorb sufficient potassium from soil to meet their own growth needs. Tobacco is a typical potassium-loving crop. For tobacco, potassium is not only a nutrient element, but also a quality factor closely related to the quality of tobacco. High potassium content in tobacco leaves can significantly improve the quality, increase the combustibility and industrial usability, reduce the amount of tar produced, and enhance the safety. However, the potassium content of Chinese tobacco leaves is generally lower than the minimum standard of 2% of the potassium content of high-quality tobacco leaves. Therefore, it is an important issue to be solved to deeply study the molecular mechanism of potassium absorption, and to take corresponding breeding and cultivation measures to increase the potassium content of tobacco leaves in China.

[0003] eIF-5A (eukaryotic translation initiation factor 5A) is the only protein containing a special amino acid-hypusine residue found so far. DHS (deoxyhypusine synthase) catalyzes the post-translational modification of eIF-5A with hypusine. eIF-5A is the only substrate of DHS found so far, and the functions of the two are closely related. Reducing the activity level of endogenous eIF-5A by inhibiting the expression of DHS has many effects on the growth and development, senescence, chlorophyll content of seeds of plants.

[0004] In recent years, great progress has been made in the molecular mechanism of potassium absorption in tobacco, but there are still few methods that can effectively increase the potassium content in tobacco leaves in large quantities. SUMMARY

[0005] The primary object of the present application is to provide a mutant gene of tobacco deoxy-carboxy putrescine lysine synthase, aiming to solve the problems raised in the background art. It is found for the first time that the mutation of the gene shows the phenotype of vein whitening and great changes in various nutrients. In particular, it is found that the mutant gene of tobacco deoxy-carboxy putrescine lysine synthase can increase the potassium content of tobacco leaves, which is of great significance.

[0006] The mutant gene of tobacco deoxy-carboxy putrescine lysine synthase of the present application has a nucleotide sequence as shown in the sequence table SEQ ID NO. 2.

[0007] The nucleotide sequence of the original gene of the above-mentioned tobacco deoxy-carboxy putrescine lysine synthase is shown in the sequence table SEQ ID NO. 1, which is named NtDHS1, has a full length of 1140 bp, a start codon of ATG, and a stop codon of TAA.

[0008] On this basis, the NtDHS1 is subjected to site-directed mutation by using CRISPR / Cas, the CT at the 693 and 694 sites is deleted, and the sequence is shown in SEQ ID NO. 2.

[0009] The second object of the present application is to provide a mutant of tobacco deoxy-carboxy putrescine lysine synthase, and the amino acid sequence of the mutant is shown in the sequence table SEQ ID NO. 4.

[0010] The third object of the present application is to provide a gene editing vector NtDHS1-pCAS9 of tobacco NtDHS1 gene function loss obtained by using CRISPR / Cas technology.

[0011] The fourth object of the present application is to provide a transformant containing the mutant gene of the tobacco deoxy-carboxy putrescine lysine synthase.

[0012] Further comprising: plant cells, microorganisms.

[0013] The fifth object of the present application is to provide a genetically transformed plant containing the mutant gene of the tobacco deoxy-carboxy putrescine lysine synthase.

[0014] Further comprising: tobacco plants.

[0015] The sixth object of the present application is to provide the application of the mutant gene, the mutant, the vector, the transformant, or the genetically transformed plant in improving the potassium content of tobacco leaves.

[0016] Compared with the prior art, the tobacco deoxy-carboxy putrescine lysine synthase gene provided by the present application has the following beneficial effects: after the tobacco deoxy-carboxy putrescine lysine synthase gene is mutated, the mutant strain shows a leaf vein whitening phenotype and a great change in various nutrients. Through detection of the potassium content in the mutant and control tobacco leaves, the results show that the mutant gene of the tobacco deoxy-carboxy putrescine lysine synthase can increase the potassium content in the tobacco leaves, which is helpful to improve the quality of the tobacco. Therefore, the present application provides a better selection for genetic improvement of new plant varieties, and has important application value. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 : Electrophoretogram of transgenic material containing CAS9 gene and control; Figure 2 : NtDHS1 gene mutation sequence deletion result schematic diagram; Figure 3 : NtDHS1 homozygous mutation and control K326 potassium content. DETAILED DESCRIPTION

[0018] In order to more clearly and specifically introduce the tobacco deoxy-carboxy putrescine lysine synthase mutant gene, mutant and application provided by the embodiments of the present application, the technical solutions in the present application will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0019] Embodiment 1

[0020] The example provides a cloning method of the original gene NtDHS1 of the tobacco deoxy-carboxy putrescine lysine synthase.

[0021] The cloning method of the original gene NtDHS1 of the tobacco deoxy-carboxy putrescine lysine synthase includes the following steps: 1. RNA extraction: total RNA of tobacco leaves is extracted by using EasyPure® Plant RNA Kit (ER301-01) of Qiagen. Specifically as follows: 1) Take the tobacco leaves and grind them into powder in liquid nitrogen, 0.1-0.2 g of the powder is added into 1 ml of BB6, 10 ul of β-mercaptoethanol is added into each 1 ml of BB6, and the mixture is mixed by vortexing and incubated at room temperature for 3 minutes.

[0022] 2), centrifuge at 12,000Xg for 2-5 minutes, and carefully aspirate the supernatant in the centrifuge tube into an RNase-free centrifuge tube.

[0023] 3) Add 0.5 times volume of absolute ethanol to the supernatant, mix well (at this time, a precipitate may appear).

[0024] 4) Mix thoroughly by vortexing, disperse the precipitate.

[0025] 5) Add the obtained solution and precipitate to the centrifugal column, centrifuge at 12,000Xg for 30s, discard the effluent.

[0026] 6) Add 500ul CB6, centrifuge at 12,000Xg for 30s at room temperature, discard the effluent.

[0027] 7) Add 500ul WB6, centrifuge at 12,000Xg for 30s, discard the effluent.

[0028] 8) Repeat step S16 once.

[0029] 9) Centrifuge at 12,000Xg for 2min at room temperature to completely remove residual ethanol.

[0030] 10) Add 30-300ul RNase-free Water to the center of the centrifugal column, stand at room temperature for 1min.

[0031] 11) Centrifuge at 12,000Xg for 2min at room temperature, elute the RNA, and store the RNA at -80°C.

[0032] 2. Reverse transcription: The extracted RNA was reverse transcribed using the HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (R212) from Novoprotein.

[0033] As shown in Table 1 below:

[0034] The premix solution mixed according to Table 1 was incubated at 42°C for 2min, The first strand cDNA synthesis reaction solution was prepared, and the specific reaction system is shown in Table 2 below:

[0035] The entire reaction system in Table 2 was placed in a PCR instrument, and the program was set to 50°C for 15min and 85°C for 2min.

[0036] 3. Amplification of the full-length ORF of the NtDHS1 gene; According to the NtDHS1 gene ORF gene sequence published by the tobacco genome database, the specific cloning primer of the gene was designed by using bioinformatics software Snapgen according to the primer design principle, as shown below: FP: 5'-ATGGGAGAGGCCCTCAACGT-3'; SEQ ID NO. 5 RF: 5'-TTAAACTTGGCATCTTATCTGGGAG-3'; SEQ ID NO. 6.

[0037] The cDNA obtained by reverse transcription was used as a template to clone NtDHS1 using 2 x Taq Plus Master Mix (Dye Plus), and the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4. Note: If the target band of the first PCR is too shallow, the product can be recovered and used for PCR, and the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4:

[0038]

[0039] 4. DNA fragment recovery of NtDHS1: The NtDHS1 target fragment was recovered using the gel recovery kit of OMEGA, and the specific steps are as follows: 5. After electrophoresis, the gel block containing the NtDHS1 target fragment was cut and weighed, and placed in a 1.5 ml centrifuge tube. According to the weight of the gel block, about 100 mg of gel corresponds to the addition of 100 ul XP2.

[0040] 6. The centrifuge tube was placed in a 55°C-60°C metal bath for incubation for 7 minutes or until the gel was completely melted, and the centrifuge tube was shaken or vortexed every 2-3 minutes.

[0041] 7. The centrifugal column was installed in the standard 2 ml collection tube.

[0042] 8. The above mixture was added to the centrifugal column, and 10,000X was centrifuged at room temperature for 1 min.

[0043] 9. Discard the centrifugate, and install the centrifugal column in the collection tube just used. If the solution volume is greater than 700ul, repeat the operation.

[0044] 10. Add 300ul XP2 to the centrifugal column, centrifuge at 10,000X at room temperature for 1 min, discard the centrifugate, and reuse the collection tube.

[0045] 11. Add 700ul SPW Wash buffer diluted with anhydrous ethanol, centrifuge at 10,000X at room temperature for 1 min.

[0046] 12. Discard the centrifugate, and centrifuge the empty centrifugal column (>13,000Xg) for 2 min.

[0047] 13. Place the column in a clean 1.5 ml microcentrifuge tube. Add 15-30 ul Elution buffer directly to the column matrix, and incubate at room temperature for 2 min.

[0048] 14. Centrifuge at 13,000 Xg for 1 min to elute the DNA. The DNA solution obtained in this step is stored at -20°C or used in the following experiments.

[0049] Example 2

[0050] Obtaining of gene editing vector 1. According to the sequence of tobacco NtDHS1 gene, a 20bp long gene editing target sequence is designed, and the target sequence and the reverse complementary sequence of the third forward primer are synthesized by using the following primers. After annealing of the forward and reverse primers, a 20bp target sequence for CRISPR-CAS9 gene editing of NtDHS1 gene can be specifically obtained, which has specificity, and the two primers contain 4-base adaptors at both ends. After annealing of the two primers, the target at both ends contains complementary sticky ends after enzyme digestion of the gene editing vector, so that the connection reaction can be directly carried out without enzyme digestion of the obtained target sequence, only the CRISPR vector needs to be enzyme-digested for connection, which saves cost, is efficient and time-saving. The above-mentioned primers include: the third forward primer (TargetF) SEQ ID NO. 7: GATTGTCTTCTGTCCTGGCTTAAC the third reverse primer (TargetR) SEQ ID NO. 8: AAACGTTAAGCCAGGACAGAAGAC Among them, the first 4 GATT in the third forward primer and the first 4 AAAC in the third reverse primer are connection adaptors.

[0051] 2. Dissolve the target sequence and the reverse complementary sequence obtained above in water to 50 μM, then anneal, and the annealing system is: 5x annealing buffer, 10 μL; the third forward primer, 10 μL; the third forward and reverse primers, 10 μL; ddH2O, 10 μL; the above system is placed in a PCR instrument, and the PCR instrument annealing reaction program is: 95℃ reaction for 2 min, -0.1℃ / 8s, and reduced to 25℃. If there is no gradient annealing PCR, the mixture can also be incubated at 95℃ for 3 min in a PCR instrument, and then naturally cooled to room temperature.

[0052] 3, The annealed product was connected into the gene editing final vector pCas9 by T4 ligase, and the reaction system was 2 μL pCAS9 vector digested by BsaI enzyme, 2 μL T4 ligase buffer, 1 μL T4 ligase, 5 μL annealed product, and ddH2O was added to the system and placed at room temperature for 10 min; 4, The above product was transformed into E. coli DH5a, sequenced, and identified to obtain a tobacco NtDHS1 gene function loss gene editing vector, named NtDHS1-pCAS9.

[0053] Example 3

[0054] Obtaining of positive transgenic materials The tobacco NtDHS1 gene function loss gene editing vector was transformed into Agrobacterium LBA4404, and the tobacco leaf was transformed by leaf disc method, and the positive transgenic materials were obtained by resistance screening and molecular identification.

[0055] PCR preliminary identification of transgenic tobacco Since the obtained transgenic materials contain CAS9 gene, but not all NtDHS1 genes of the materials with CAS9 gene are edited, because if the CAS9 gene is not detected in the transgenic material, the NtDHS1 gene must not be edited, therefore, in the identification of positive materials, it is necessary to identify the materials containing CAS9 gene in the transgenic materials by PCR technology, so as to screen the positive plants of NtDHS1 gene edited, the specific method is as follows: 1, Extracting the genomic DNA of transgenic tobacco; 2, Designing detection primer CAS9, which can effectively and specifically amplify CAS9 gene, said detection primer CAS9 comprising: Sixth forward primer (CAS9-JCF) SEQ ID NO. 9: ACATCGTGGACGAAGTTGCTTATC; Sixth reverse primer (CAS9-JCR) SEQ ID NO. 10: ATATCACTCAGAAGTATAGCGTCC; 3, Using the detection primer CAS9 to perform PCR preliminary identification on the transgenic tobacco, as shown in Figure 1 It can be seen that the transgenic material containing CAS9 gene has been obtained, which provides material for the next step of screening NtDHS1 gene edited plants.

[0056] Identification of positive transgenic materials 1. Design the second identification primer, which can specifically amplify the NtDHS1 sequence from the tobacco genome, and the amplified sequence contains the target sequence edited in this example, thereby identifying the editing of NtDHS1 gene. The second identification primer includes: The fifth forward primer (NtDHS1-jcF) SEQ ID NO. 11: GCTACCCTGGTATTTATCATCAT; The fifth reverse primer (NtDHS1-jcR) SEQ ID NO. 12: TAATCCAAAAGACAGCACCAG; 2. Extract the transgenic tobacco genomic DNA; 3. Use the above obtained DNA as a template, use the fifth forward primer and the fifth reverse primer for PCR amplification, and connect the amplification product to the pBlunt-T vector. Pick single clones for identification, as shown in Figure 2 It can be seen from Figure 2 that the NtDHS1 gene edited material is obtained. Plant the edited material to obtain T1 generation plants, screen homozygous mutant single plants by sequencing and collect seeds to obtain T2 generation tobacco seeds with NtDHS1 homozygous mutation.

[0057] Example 4

[0058] Potassium content determination of edited material The obtained T2 generation tobacco seeds with NtDHS1 homozygous mutation are planted in the field to obtain T2 generation tobacco lines. After harvesting and curing the middle tobacco leaves, the potassium content of the cured tobacco leaves is detected by the method of NY / T 2017-2011.

[0059] As shown in Figure 3 , it can be seen that the potassium content of NtDHS1 homozygous mutation is significantly higher than that of the control K326.

Claims

1. Mutant genes of tobacco desoxycarbonylputrescine lysine synthase, characterized in that, The nucleotide sequence of the mutant gene is shown in SEQ ID NO.

2.

2. The mutant gene of a tobacco desoxycarbonylputrescine lysine synthase according to claim 1, characterized in that, The nucleotide sequence of the original gene of the tobacco deoxy-carboxy putrescine lysine synthase is shown in SEQ ID NO.

1.

3. Mutant of tobacco desoxycarbonylputrescine lysine synthase characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO.

4.

4. A gene editing vector NtDHS1-pCAS9 for functional deletion of the tobacco NtDHS1 gene obtained by using CRISPR / Cas technology.

5. A transformant containing the mutant gene of the tobacco deoxy-carboxy putrescine lysine synthase according to claim 1.

6. The transformant according to claim 5, characterized by including: Plant cells, microorganisms.

7. A genetically transformed plant containing the mutant gene of the tobacco deoxy-carboxy putrescine lysine synthase according to claim 1.

8. The genetically transformed plant of claim 7, wherein, including: Tobacco plants.

9. Use of the mutant gene according to claim 1 or 2, the mutant according to claim 3, the vector according to claim 4, the transformant according to claim 5 or 6, or the genetically transformed plant according to claim 7 or 8 in improving the potassium content of tobacco leaves.

Images