A gender identification molecular marker, primer pair and gender identification method based on largemouth bass Y chromosome specific deletion
By using Y-chromosome-specific deletion molecular markers for sex identification in largemouth bass and their primer pairs, the problem of sex identification in the embryonic and larval stages of largemouth bass has been solved, achieving efficient and low-cost sex identification, supporting the construction of all-male populations, and improving aquaculture efficiency.
Patent Information
- Application Number
- CN202511363756.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-23
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-09-23
AI Technical Summary
Current technology makes it difficult to accurately identify the genetic sex of largemouth bass during the embryonic and larval stages, making it impossible to effectively build an all-male population and affecting aquaculture efficiency.
A molecular marker for sex identification based on a Y chromosome-specific deletion in largemouth bass and its primer pair are provided. Sex is identified by PCR amplification and agarose gel electrophoresis analysis using a 147 bp deletion sequence. Primer pairs SEQ ID NO. 3 and 4 are designed to amplify specific fragments of 326 bp and 179 bp, respectively. Genotype is determined based on band characteristics.
It enables accurate sex identification of largemouth bass, is easy to operate and low in cost, with an identification accuracy rate of 95%, supports the construction of all-male fry, and improves aquaculture efficiency.
Smart Images

Figure CN120843662B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker, primer pair, and sex identification method based on Y chromosome-specific deletion in largemouth bass. Background Technology
[0002] Largemouth bass (Micropterus salmoides), native to North America, is an important aquaculture species. Studies have shown that at 6 months of age, there is no significant difference in feed conversion ratio (GSI) between males and females. However, at 12 months of age, the GSI of females reaches 6-8%, while that of males is only 0.6-0.8%. Female largemouth bass are significantly inferior to males in terms of feed conversion ratio. Therefore, developing all-male fry is crucial for improving aquaculture efficiency. The establishment of an all-male largemouth bass population depends on the establishment of pseudo-females and pseudo-males. Pseudo-females and pseudo-males exhibit physiological sex opposite to their genetic traits; therefore, accurately determining the genetic sex of individuals is key to success in establishing an all-male population.
[0003] Before their gonads mature, it is difficult to distinguish males and females of the largemouth bass from their external morphology, and this is even more impossible during the embryonic and juvenile stages. Furthermore, the largemouth bass lacks heterochromatic chromosomes, making it impossible to determine their genetic sex from a cytological perspective.
[0004] Therefore, developing a molecular marker for identifying the genetic sex of largemouth bass is of great value for production applications in achieving sex-controlled breeding. Summary of the Invention
[0005] The purpose of this invention is to address existing problems by providing a molecular marker, primer pair, and sex identification method based on Y chromosome-specific deletion in largemouth bass.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A molecular marker for sex identification based on a Y chromosome-specific deletion in largemouth bass, wherein the mutation position of the molecular marker is NW_024040041.1:34063789, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, which is a 147 bp deletion sequence of the male Y chromosome.
[0008] SEQ ID NO. 1: acactggctcccggtccattttagaaaacattttaagatcttattgtttgtttttaaatcacagaatggcttggcacctcgctacatctcagacctctttacgagcctacaccccctcacggtcacttaagtctactgatcaactt
[0009] Another objective of this invention is to provide a primer pair for identifying molecular markers for sex determination in largemouth bass, wherein the primer pair is designed for the aforementioned molecular markers for sex determination and can specifically amplify the fragments corresponding to the molecular markers.
[0010] The primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 4.
[0011] SEQ ID NO. 3:GCTTTTATCGCCACTCG tm52 53%g
[0012] SEQ ID NO. 4:TCCACTGTTTAGGGGCT tm50 53%gc
[0013] More preferably, the sequence used to design the primer is shown in SEQ ID NO. 2.
[0014] SEQ ID NO. 2: attaataaaaaaaatgaatttccaatttaccgaatgaaaatctgtatgaattttaagcccaagaaaattattatttacaaagttacctgaatttaaataatgttgttaaatcacgtttttatcacttgaggcttttgtctaaaattaaacctgttttatatcgtaagcactttgagcatgtg attcatgcttttatcgccactcgtccaggctactgtgatgcactttacattggcgttaaccaagtctctccctcacgcttacagttagtacaaaactcggccgctcgtcctggctacactggctcccggtccattttagaaaacattttaagatcttattgtttgttttttaaatcacagaatggct tggcacctcgctacatctcagacctctttacgagcctacaccccctcacggtcacttaagtctactgatcaacttcagctggtcgctccaaaaaccaggttaaaaaccaggagcgacttttcagtagcagcccctaaacagtggaattagttacctccgcaggtcaaattttttaaatcccgtctta atactcacttttattccctggcttttaacccagcatgttttatgttgttttaagtgttctatgtgtttttatgtttatttcttgtccagtactttataaaacctttgtttttttaaatgcgctatataaataaaatagattggatttaaaaacactttattataatactcacattcatatttaataca
[0015] Another object of the present invention is to provide a largemouth bass sex identification kit, comprising the above-mentioned primer pairs and conventional components required for PCR reaction.
[0016] Another objective of this invention is to provide a largemouth bass sex identification kit for use in identifying or assisting in the identification of the genetic sex of largemouth bass or in assisted breeding.
[0017] Another object of the present invention is to provide a method for sex determination of largemouth bass, comprising the following steps:
[0018] (1) Extract genomic DNA from the fin rays or blood tissue of the largemouth bass individuals to be tested;
[0019] (2) PCR amplification was performed using the primer pair;
[0020] (3) The amplification products were analyzed by agarose gel electrophoresis, and the genotype was determined based on the band characteristics.
[0021] More preferably, the PCR amplification reaction system comprises, in 20 μL increments, 2 μL of largemouth bass genomic DNA to be tested, 0.5 μL of forward primer, 0.5 μL of reverse primer, 10 μL of Taq DNA polymerase, and 6 μL of DEPC water.
[0022] More preferably, the PCR amplification reaction conditions are: 95℃ pre-denaturation for 5 min; 60℃ annealing for 30 s, 72℃ extension for 30 s; and 72℃ final extension for 10 min after 35 cycles.
[0023] More preferably, the amplification products are analyzed by agarose gel electrophoresis, and the genotype is determined based on the band characteristics. The correspondence between the band characteristics and the genotype is as follows:
[0024] Only 326 bp bands were found in XX-type females;
[0025] The 326 bp and 179 bp bands are XY-type males;
[0026] Only 179 bp bands are YY-type supermales.
[0027] The present invention has the following advantages over the prior art:
[0028] This invention discloses a molecular marker for sex identification based on a Y-chromosome-specific deletion in largemouth bass and its application. The marker is a 147 bp deletion sequence at position 34063789 bp on the male Y chromosome (NW_024040041.1) (SEQ ID NO. 1), which exhibits a completely linked genetic relationship with sex. The XX genotype corresponds to female individuals, the XY genotype corresponds to male individuals, and the YY genotype corresponds to supermale individuals. Primer pairs (SEQ ID NO. 3 and 4) specifically amplify this marker are also provided. During detection, only genomic DNA needs to be extracted from the fin tissue of the individual to be tested. PCR amplification is performed using the primer pairs, and the amplified bands are analyzed by agarose gel electrophoresis. The genotype can be accurately determined based on the number of bands. This method has significant advantages such as simple operation, low cost, and reliable results. Attached Figure Description
[0029] Figure 1 This is an agarose gel electrophoresis image of the sex determination of largemouth bass according to the present invention;
[0030] Figure 2 This is an experimental flowchart of the sex determination method for largemouth bass according to the present invention. Detailed Implementation
[0031] To further explain the present invention, the following specific embodiments are described.
[0032] Example 1: Screening of molecular markers for structural variations
[0033] Download the sequencing data of largemouth bass from the NCBI public database (Table 1).
[0034] Use the SRA Toolkit to convert the data to FASTQ format.
[0035] Structural variations were mined using both minimap2+sniffles and pbmm2+pbsv methods. The merge command of the SURVIVOR software was used to merge the structural variation files identified by the two methods together. The specific parameters were that the coordinates of the start and end sites should not differ by more than 100 bp, the type and direction of the structural variations should be consistent, and the length should be greater than 30 bp.
[0036] Table 1 NCBI Public Data Login Number
[0037]
[0038] The number of structural variants detected by the Sniffles and PBSV software differed, with insertions and deletions being the most numerous. After merging the data, the SURVIVOR software yielded a total of 29,849 structural variants, the majority of which were deletions (Table 2).
[0039] Table 2. Differences in the number of structural variations identified by Sniffles and PBSV.
[0040]
[0041] After screening, a total of 76 structural variants were found to be homozygous in females and heterozygous in males, meeting the criteria. The longest variant was 3503 bp, and the average length was 511 bp. To further verify the reliability of the structural variants, reads from the 30-37 Mb region of chromosome 10 were extracted from the next-generation sequencing data and imported into IGV software. The 76 structural variants were manually evaluated, and deletions that showed an average sequencing depth in females and a sequencing depth of half that of normal sequences in males were identified as high-confidence variants. After manual screening, a total of 5 highly reliable structural variants were selected and validated by PCR experiments (Table 3). The results showed that pbsv.DEL.10772 had 100% accuracy.
[0042] Table 3 High-confidence structural variants and validation primers
[0043]
[0044] Example 2: Primer design and validation (e.g.) Figure 2 )
[0045] Primer design: Primers were designed for the selected candidate structural variant sites using Primer Premier 5.0 software to ensure that the amplified fragment contained the target structural variant site. The primer pair amplified fragment lengths were (X: 326 bp, Y: 179 bp).
[0046] Primer sequences:
[0047] SEQ ID NO. 3:GCTTTTATCGCCACTCG tm52 53%gc
[0048] SEQ ID NO. 4:TCCACTGTTTAGGGGCT tm50 53%gc
[0049] Primer verification:
[0050] Genomic DNA was extracted from the tail fins of the experimental fish.
[0051] The tail fins of largemouth bass were cut off using scissors sterilized with alcohol and stored in anhydrous ethanol at room temperature. Genomic DNA was extracted from the fin rays using a marine animal tissue genomic DNA extraction kit (Tiangen).
[0052] The extracted genomic DNA was used as a template for PCR amplification.
[0053] The PCR amplification reaction system consisted of: 2 μL of largemouth bass genomic DNA to be tested, 0.5 μL of forward primer, 0.5 μL of reverse primer, 10 μL of Taq DNA polymerase, and 6 μL of DEPC water.
[0054] The reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation, 60℃ annealing for 30 s, 72℃ extension for 30 s; 35 cycles, 72℃ final extension for 10 min.
[0055] The PCR products were detected by 1.5% agarose gel electrophoresis.
[0056] Agarose gel electrophoresis procedure: 2 μL sample loading, program: 120 V, 45 min;
[0057] Normal female samples showed a single 326 bp electrophoretic band;
[0058] Normal male samples showed double bands at 326 bp and 179 bp;
[0059] The super-male fish sample showed a single 179 bp electrophoretic band ( Figure 1 ).
[0060] Example 3: Reagent Kit Application
[0061] The kit consists of: lyophilized primer pairs, Taq DNA polymerase, and DEPC water;
[0062] Includes lyophilized primer pairs
[0063] SEQ ID NO. 3:GCTTTTATCGCCACTCG
[0064] SEQ ID NO. 4:TCCACTGTTTAGGGGCT
[0065] Verification process:
[0066] This invention was used to test 120 largemouth bass samples from four groups. The four groups were the Youlu No. 3 group raised by Foshan Liangshi Aquatic Seed Industry. The 120 samples were randomly selected for dissection and statistical analysis, and a total of 50 physiological females and 70 physiological males were obtained. The tail fins were collected for DNA extraction.
[0067] DNA extraction: Take 0.2 g of fin sample and extract DNA using a rapid DNA extraction kit to serve as a PCR template.
[0068] PCR amplification
[0069] The reaction system consisted of: 2 μL of largemouth bass genomic DNA to be tested, 0.5 μL of forward primer, 0.5 μL of reverse primer, 10 μL of Taq DNA polymerase, and 6 μL of DEPC water.
[0070] The reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation, 60℃ annealing for 30 s, 72℃ extension for 30 s; 35 cycles, 72℃ final extension for 10 min.
[0071] Agarose gel electrophoresis:
[0072] PCR amplification products were detected using 1.5% agarose gel electrophoresis. 2 μL of sample was loaded onto the gel at 120 V for 45 min.
[0073] The results showed that there were 3 errors in the females and 3 errors in the males, including 2 errors of type XX and 1 error of type YY, with an identification accuracy of 95%, as shown in Table 4.
[0074] Table 4. Marker Identification Accuracy
[0075]
[0076] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A molecular marker for sex identification based on Y chromosome-specific deletion in largemouth bass, characterized in that, The mutation location of the molecular marker is NW_024040041.1:34063789, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, which is a 147 bp deletion sequence on the male Y chromosome.
2. A primer pair for identifying the sex of largemouth bass using molecular markers, characterized in that, The primer pair is designed for the sex identification molecular marker described in claim 1 and can specifically amplify the fragment corresponding to the molecular marker. The primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
4.
3. A largemouth bass sex identification kit, characterized in that, Includes the primer pair, Taq DNA polymerase, and DEPC water as described in claim 2.
4. A method for sex determination of largemouth bass, characterized in that, Includes the following steps: (1) Extract genomic DNA from the fin rays or blood tissue of the largemouth bass individuals to be tested; (2) PCR amplification using the primer pair described in claim 2; (3) The amplification products were analyzed by agarose gel electrophoresis, and the genotype was determined based on the band characteristics; The correspondence between the band features and genotypes is as follows: Only 326 bp bands were observed in XX-type females; The 326 bp and 179 bp bands are XY-type males; Only 179 bp bands are YY-type supermales.
5. The method according to claim 4, characterized in that, The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation, 60℃ annealing for 30 s, 72℃ extension for 30 s; 35 cycles followed by a final extension at 72℃ for 10 min.
Citation Information
Patent Citations
Micropterus salmoides gender-related molecular marker
CN112111582A
InDel molecular marker related to genetic sex identification of micropterus salmoides and application of InDel molecular marker
CN113637766A